Emilio pushes a 100 kg freshman with 200 N of force. How much is the freshman accelerated?

Answers

Answer 1

Explanation:

F = MA

200 = 100 * A

A = 200/100

A = 2m/sec^2

hope it helps you

Related Questions

a ball is thrown vertically upwards from the ground. The ball rises and falls back to the ground. Describe the changes in the mechanical energy of the ball as it rises.

Answers

Answer:

as the ball is thrown, the enegry rises up, when it falls, the ball relseases all energy

Explanation:

3. A 3.0 g bullet traveling at a speed of 400 m/s enters a tree and exits the other side with a speed of 200 m/s. Where did the I bullet's lost KE go, and what was the energy transferred? Solution:​

Answers

Answer:I had two questions: 1) Shouldnt the equation be : Change of internal energy= Change in Ke or KEi +Ui=KEf+Uf .. I cant seem to understand how the change in KE+ Change in Internal Energy equals 0 2) Also, it has a note which says that if the bullet alone was chosen as a system, then work would be done on it and the heat transfer woudl occur. How would one formulate an equation for this?

Explanation:

Why do you need to learn about Volcanoes?

Answers

that they sometimes explode?

Answer:

Without volcanoes, most of Earth's water would still be trapped in the crust and mantle . Early volcanic eruptions led to the Earth's second atmosphere, which led to Earth's modern atmosphere . Besides water and air, volcanoes are responsible for land, another necessity for many life forms .

Explanation:

I hope it helps

Which natural resource is renewable?
Coal
Wind
Topsoil
Oil

Answers

Answer:wind

Explanation:

The natural resource that is renewable is wind. Explanation on wind as a renewable resource can be found below.

What is renewable resource?

Renewable resources are those resources that is replenished or replaced by natural processes at a rate comparable to its rate of consumption by humans or other users.

Renewable resources cannot be exhausted as a result of use, unlike, their non-renewable counterparts.

Examples of renewable natural resources are as follows:

SunWindWater

Therefore, the natural resource that is renewable is wind.

Learn more about renewable resource at: https://brainly.com/question/19604560

Shawn is doing drills out on the field by pulling a tire behind him for 30 m. If Shawn is applying a net force of

1200 N to pull the tire, then how much work is Shawn doing?

Answers

Answer:

The work done by Shawn in moving the tire is 36,000 J

Explanation:

Given;

net force applied by Shawn , F = 1200 N

distance he moved the tire, d = 30 m

The work done by Shawn in moving the tire is calculated as;

W = Fd

Substitute the given values and solve for Work done;

W = 1200 x 30

W = 36,000 J

Therefore, the work done by Shawn in moving the tire is 36,000 J

Why aren’t all the islands of Hawaii the same age?

Answers

Answer:

The age trend of the volcanoes is thought to be due to the way in which the islands are built on the moving sea floor of the North Pacific Ocean: the Pacific Ocean is mostly floored by a single tectonic plate (known as the "Pacific Plate") that is moving over the layer in the Earth known as the Asthenosphere

Explanation:

List various ways through which AIDS spreads
please its aurgent fast​

Answers

Answer:

Blood, semen, bodily fluids, breast milk

Explanation:

Explanation:

Through.....

1) blood

2) breast feeding

3) semen

4) unprotected sex etc

Hooke's Law Question - Will mark brainliest

A spring of natural length 10cm and spring constant 4.00Ncm −1 has a load of 22.0N placed on it. What is its new length?

Answers

Explanation:

Hooke's Law: Fe = kx

x = Fe / k = (22.0N) / (4.00N/cm) = 5.50cm.

10.00cm + 5.50cm = 15.50cm

The new length of the spring is 15.50cm.

PLS HELP WILL MARK BRAINLIEST IF RIGHT NEED IMMEDIATELY PLEASEEEEE
According to O*NET, what are some common work activities performed by Psychiatrists? Check all that apply.

assisting and caring for others
making decisions and solving problems
performing general physical activities
handling and moving objects
inspecting equipment and structures
getting information

Answers

Answer:

Explanation:

Prescribe medications.

Prescribe treatments or therapies.

Treat patients using psychological therapies.

Collect medical information from patients, family members, or other medical professionals.

Record patient medical histories.

Develop medical treatment plans

Answer:assisting and caring for others

making decisions and solving problems

getting information

Explanation:

I'm pretty sure about the answer. Thank you

A clock's hour hand goes through 1.5 revolutions in 90
minutes.Calculate the angular displacement of the minute hand in
degrees

Answers

Answer:

Explanation:

how far around a circle is once around in degees?

1.5 * 360 = 540°

a catcher "gives" with the ball when he catches a 0.196 kg baseball moving at 31 m/s. if he moves his glove a distance of 5.32 cm, what is the average force acting on his hand?

Answers

Answer:

3540.5N

Explanation:

Step one:

given data

mass m= 0.196kg

speed  v= 31m/s

distance r= 5.32cm = 0.0532m

Step two

The expression relating force, mass, velocity and distance is

F= mv^2/r

substitute we have

F=0.196*31^2/0.0532

F=0.196*961/0.0532

F=188.356/0.0532

F=3540.5N

a camel can walk easily on sandy desert but a horse cannot, why?
plz anyone tell​

Answers

Answer:

I believe the camels hooves or whatever are built diffrenet.

Explanation:

Please help. I will mark you as brainliest !!!

You place a book on top of a spring and push down, compressing the spring by 10 cm. When you let go of the book, it is pushed up by the spring. Which statement describes what happens to the energy of the spring book system?

A. The elastic potential energy of the system increases.
B. The gravitational potential energy of the system increases.
C. The kinetic energy of the system decreases.
D. The total energy of the system increases.

Answers

Answer:

Eliminate D as there is no nonconservative force, then look at each energies before and after. The speed of the book will increase, so kinetic energy is increasing. The height of the book is increasing, so gravitational potential energy is increasing. However, since the spring is becoming decompressed, the elastic potential energy is decreasing.

Explanation:

Answer:

it is A

Explanation:

In the picture above, if the cue stick strikes the 0.2-kg cue ball with a force of 1.1 N, what will be the acceleration of the cue ball?

Answers

Answer:

0.55 m/s².

Explanation:

From the question given above, the following data were obtained:

Mass (m) of ball = 2 Kg

Force (F) applied = 1.1 N

Acceleration (a) =?

Force (F) is defined as the product of mass (m) and acceleration (a). Mathematically, the force (F) can be represented as:

Force (F) = mass (m) × acceleration (a)

F = ma

With the above formula, we can calculate the acceleration of the ball as follow:

Mass (m) of ball = 2 Kg

Force (F) applied = 1.1 N

Acceleration (a) =?

F = ma

1.1 = 2 × a

Divide both side by 2

a = 1.1 / 2

a = 0.55 m/s²

Therefore, the acceleration of the ball is 0.55 m/s²

A family is skating at an ice rink. The 58.2 kg mother is holding the
hand of her 35.5 kg daughter. The father grabs his wife's free hand and pulls horizontally with a constant force of 100. N. Assume that the skates glide without friction on the ice and that the family's hands andarms approximate ideal strings. How much net force does the daughter experience?

Answers

Answer:

When I got this question I had to draw it out so if you have to do that, draw 3 stick figures holding hands, one representing the mother, father, and daughter. Then you write their weights on top of them and then draw an arrow pointing from the father to the mother.

Explanation:

use this formula :

[tex]a_{y}[/tex] = [tex]\frac{Fdadshandy}{msys}[/tex]

then you fill it in :

[tex]a_{y}[/tex] = [tex]\frac{100N}{35.5kg+58.2kg}[/tex]

[tex]a_{y}[/tex] = [tex]\frac{100N}{93.7kg}[/tex]

[tex]a_{y}[/tex] = [tex]1.0672[/tex] [tex]m/s^{2}[/tex]

then you multiply that with the daughters weight :

[tex]T_{2} x= m_{2} a_{y}[/tex]

[tex]T_{2} x = 35.5kg (1.0672 m/s^{2})[/tex]

[tex]T_{2} x = 37.89N[/tex]

and that's the answer :) : 37.89N

Which statement about the relationship between air pressure and air density is accurate?

A) Air pressure decreases as air density increases
B) Air pressure increases as air density increases
C) Air pressure increases as air density decreases
D) Air pressure is unrelated to air density

Answers

Answer:

A: Air pressure decreases as air density increases

Explanation:

Pressure is a force exerted on or against an object by being in contact with a substance. Thus, air pressure is due to the bombardment of the air (gas) particles with a surface. Density is defined as the mass per volume of a substance. Thus, air density is defined as the mass of air per unit volume.

If that Explanation does not make any sense let me make it easier.

The air at the top of a mountain is cooler than the air at the bottom. This temperature difference is due to a phenomenon that occurs in Earth’s atmosphere. Air rises and sinks based on differences in temperature and pressure. Here’s a quick experiment that will help explain the role of pressure.Take in a deep breath as if you were ready to blow out birthday candles. Puff your cheeks with air like a chipmunk. Hold it for a few seconds, and then blow the air slowly from your cheeks.Cold air sinks while warm air rises because cold air is denser than warm air. When a lot of cold air sinks, it creates an area of high air pressure where it hits the surface. This high-pressure air flows to an area of low pressure, creating wind. When this air warms, it rises up into the atmosphere.Temperature decreases as altitude increases. That’s why a mountain peak may be covered with snow while the bottom of the mountain is full of green plants and trees. When warm air rises into the atmosphere, it cools. The density of the air increases as it cools, which eventually creates an area of high pressure and starts the cycle again.

If not for this phenomenon of air rising and sinking in the atmosphere, there would be no wind or weather.

I hope that helped!

An electric motor transforms potential energy into mechanical energy.


Please select the best answer from the choices provided

T
F

Answers

Answer:

t

Explanation:

Answer:

False

Explanation:

Which of the following statements best describes the relationship between the environment and the collective health of the world? A. The environment does not affect our health. B. When the environment is damaged, our health improves. C. What is good for the environment is good for our health. D. Our collective health is not related to the health of the environment. Please select the best answer from the choices provided. A B C D Mark this and return

Answers

Answer:

its C

Explanation:

The statement that describes the relationship between the environment and the collective health of the world is; "what is good for the environment is good for our health."

Humans must maintain a very good interaction with their environment because the interaction between man and his environment is very necessary for healthy living.

Man depends on water, air etc to sustain life. These are part of the natural environment, when these are polluted due to neglect of the environment, human health is adversely affected.

Learn more: https://brainly.com/question/4593618

Jeff uses a solar cell to run a small motor. What energy transformation occurred?
(A) Light to electric to potential
(B) Light to electric to kinetic
(C) Electric to solar to kinetic
(D) Kinetic to electric to mechanical

Answers

Light to Electric to kinetic

A beaver runs at a speed of 2.0\,\dfrac{\text m}{\text s}2.0 s m ​ 2, point, 0, start fraction, start text, m, end text, divided by, start text, s, end text, end fraction with 45\,\text J45J45, start text, J, end text of kinetic energy.

Answers

Answer:

22.5kg

Explanation:

Since we not told wat to find, we can as well find the mass of the beaver.

Kinetic energy formula is expressed as;

KE = 1/2mv²

m is the mass

v is the speed

Given

KE = 45Joules

v = 2.0m/s

Substitute into the formula and get the mass

45 = 1/2m(2)²

45 = 2m

m =45/2

m = 22.5kg

Hence the mass of the beaver is 22.5kg

Which statement describes a characteristic of a question that can be answered through scientific inquiry? (A.It requires the application of ethical standards.) (B.It can be answered using measurements.) (C.It can be answered using a philosophical argument.) (D.It requires the approval of more than one scientist.)

Answers

Answer:

B. It can be answered using measurements.

Explanation:

Scientific inquiry can be defined as the various ways, techniques and approach used by scientists to study the world and provide a detailed description (information) based on the empirical evidence derived from the investigation.

Measurements can be defined as a technique which typically involves the process of identifying and determining the dimensions, quality and quantity of a physical object.

Hence, the statement which best describes a characteristic of a question that can be answered through scientific inquiry is that, it can be answered using measurements. Using scientific inquiry to answer questions entails using measurements to propose specific and evidential explanations, as well as back up theories associated with the question.

In 1630 at the beginning of European settlement, about 425,000,000 hectares of the United States were covered with trees. By 2017, the area covered by trees was reduced to 300,000,000 hectares. What is the percentage decrease in the area covered by trees between 1630 and 2017?

Answers

Answer:

29.41%

Explanation:

Given that,

In 1630 at the beginning of European settlement, about 425,000,000 hectares of the United States were covered with trees.

By 2017, the area covered by trees was reduced to 300,000,000 hectares.

We need to find the percentage decrease in the area covered by trees between 1630 and 2017.

The percentage decrease in any value is given by :

[tex]\%=\dfrac{300,000,000 -425,000,000 }{425,000,000 }\times 100\\\\=29.41\%[/tex]

So, the percentage decrease in the area covered by the trees is 29.41%.

help plz will give brainliest and dont answer if u dont know

Answers

i think most likely the answer is the first one. meeting other students. if not then maybe the second one, highly motivated.

Answer:

is highly motivated

Explanation:

no wrong answers please

Answers

sorry i can’t help sorry good luck tho!!!!

Is visible light a form of
radiation? Explain.

Answers

Answer:

Yes,in fact visible 'light' is a form of radiation, which can be defined as an energy that travels in the form of electromagnetic waves. It can also be described as a flow of particle-like 'wave-packets', called photons, that travel constantly at the speed of light (about 300 000 kilometres per second).

Explanation:

What are the types of motion that can be observed in a pendulum ? Some one please answer.√

Answers

Answer:

periodic motion

Explanation:

The massive object is affectionately referred to as the pendulum bob. When the bob is displaced from equilibrium and then released, it begins its back and forth vibration about its fixed equilibrium position. The motion is regular and repeating, an example of periodic motion.

Plants appear green because they do not absorb the green wavelengths of light. What happens to those green light waves when they hit a plant? The are diffracted. They are absorbed. They are reflected. They are refracted.

Answers

Answer:

They are reflected.

Explanation:

Red light is absorbed while green light is reflected, causing the color to be green in human eyes.

Answer:

C

Explanation:

what material would you use to build countertops

Answers

Answer:   Natural stone

Explanation:

Answer:

Natural stone

Explanation:

The most common natural stones used to make countertops include granite, marble, soapstone, and slate.

The north pole of one bar magnet is near the south pole of another bar
magnet. What happens to the magnets?
O A. They repel each other.
B. They attract each other.
C. They twist away from each other.
O D. They neither attract nor repel each other.

Answers

B
Opposites attract
Like poles repel

Answer: they attract each other .

Explanation: jus took it.

Jada runs exactly 2 laps around a 400 meter track. What is the displacement?


a:
0
b:
400
c:
800

Answers

Answer:

Option B 400meters

Explanation:

What is displacement

Displacement is a vector whose length is the shortest distance from the initial to the final position of a point P undergoing

Given data

number of laps = 2

length of lap= 400meters

Since after every one lap she returns to her initial position ]

the displacement is 400meters

Other Questions
Thirteen more than three times a number is 25. What can you infer about the schools educational and social goals, based on Doves experiences? help would be appreciated ** if you could explain thatd be cool but if not thats ok Help me please Im begging u 3) What type of government did the Aztecs have? *A.One kingB. Prime MinisterC.PriestsD. Decentralized government made up of city states, each with their own kingsqueens what is 1256x - 14x + 16x simplified Use the restriction enzyme EcoRi to cut DNAVictim DNA :GGAAG ATTCTACATTACTGACGGACGTGACGTGACCTTCTTAA GATGTAATGACTGCCTGCACTGACTNumber of restriction fragments ( pieces of DNA after digestion) :Size of restriction fragments ( count the number of bases on the top strand of each fragment , listed from largest to smallest ) :Suspect 1 DNA :GGAATTAAGCTTATTG AATTCTTATAG AATTCGGGGCCCAAGCTTATG AATTCAATT CCTTAATTCGAATAACTTAA GAATATCTTAA GCCCCGGGTTCGAATACTTAA GTTAANumber of restriction fragments ( pieces of DNA after digestion) :Size of restriction fragments ( count the number of bases on the top strand of each fragment , listed from largest to smallest ) :Suspect 2 DNA :CCATATAG AATTCAAGCTTAAG AATTCGGGGGAACGTTG AATTCAATTAATTGGGGGTATATCTTAA GTTCGAATTCTTAA GCCCCCTTGCAACTTAA GTTAATTAACCCNumber of restriction fragments ( pieces of DNA after digestion) :Size of restriction fragments ( count the number of bases on the top strand of each fragment , listed from largest to smallest ) :PLEASE HELPPP!!!!I WOULD APPRECIATE A LOT :) list the difference between sdram and dram What is 2/5 divided 1/3 Kaden, Keith, and Kipp compete in a series of daily 3-way races. For each race, the probability that Kaden wins is 1/6, the probability that Keith wins is 1/2, and the probability that Kipp wins is 1/3. On a day that Kaden doesn't win, what is the probability that Keith beats Kipp? a file that serves as a starting point for a new document A dental hygienist is a health-care professional who works alongside a dentist to meet the oral health care needs of patients. Asked by one of her clients who needs to get a cavity filled what the average number of cavities a person gets filled by the time they are 50 years old, the hygienist responds that she will gather and determine not just the average, but also the median and the mode - because she would like to know this information herself. A bit of research turns up the following data table taken from a research project of a graduate student. The graduate student surveyed 20 people aged 50 from around Idaho.Patient ID# Cavities Filled1 12 83 74 95 116 127 78 59 210 011 812 913 714 615 816 917 818 919 820 8a. What is the mean (average) number of cavities a person gets filled by age 50?b. What is the median number of cavities a person gets filled by age 50?c. What is the most often an occurring number of cavities filled in this data set? Solve for n.(33)^2 = n^6 A biologist is recording the loss of fish in a pond. He notes the number of fish, f, in the pond on June 1. On July 1 there were 63 fish in the pond, which is 52 fewer fish than were in the pond on June 1. What is the number of fish in the pond on June 1?Which equation can be used to find the number of fish in the pond on June 1?63f=52f52=63f52=63f63=52 i need help!!!!!!!!! Which expression is equivalent to 8(5-2a)? 3 Write an expressionto represent:"Twice a number 51increased by 51" Your friend says that enough information is giving to prove that x=12. Is your friend correct? All of the following represent the same function except _____.y = x - 1{(0, 1), (2, 3), (4, 5), (7, 8)}x y1 03 25 48 7 If UW = 9x -9, what is UW in units?