Complete question:
Use the sequence below to answer the following questions
3’-ACGGATCCTCCCTAGTGCGTAATACG-5’
5’-TGCCTAGGAGGGATCACGCATTATGC-3’
1. Enter the sequence of the coding strand with a 5’-3’ polarity
Answer:
coding strand → 5´- GCATAATGCGTGATCCCTAGGCA -3´
Explanation:
When referring to the coding strand, we are talking about the sequence that turns to be the same as the mRNA that results from the transcription of the same DNI segment -switching bases T for U-.
The coding strand receives that name because it is the sequence that codes for each amino acid composing the proteins.
When the DNI molecule separates into two strands to form the transcription bubble, we can identify two separate segments: coding strand and template strand.
The coding strand goes in direction 5´ to 3´, while the complementary strand -template strand- grows in direction 3´ to 5´.
Whenever we have a DNI molecule and we need to determine which strand is the coding one, we just need to look for the presence/absence of start or stop codons.
So, in the exposed example we have two strands, but we do not know yet which one is the coding one.
Conventionally, the first strand is always the coding one. However, let us analyze it by using the presence/absence of codons.
First-strand:
3’-ACGGATCCTCCCTAGTGCGTAATACG-5’
let us write it is 5´to 3´direction
5´- GCATAATGCGTGATCCCTAGGCA -3´
now let us identify the start and stop codons in 5´⇒3´direction.
Start codon ⇒ ATGStop codon ⇒ TAA, TAG, TGA5´- GCATAATGCGTGATCCCTAGGCA -3´ ⇒ 1 start codon at the beginning
5´- GCATAATGCGTGATCCCTAGGCA -3´ ⇒ 3 Stop codons
Second strand: We will do exactly the same procedure
5’-TGCCTAGGAGGGATCACGCATTATGC-3’⇒ 1 start codon near the end
5’-TGCCTAGGAGGGATCACGCATTATGC-3’⇒ 1 stop codon at the beginning
What we did here was to identify in both provided strands, where the start and stop codons are placed. We can see that in the first strand we have the start codon near the beginning, while in the second strand we have it near the end of the sequence. From this information, we can assume that the first strand is the coding one. However, you need to know that some coding sequences do not have start and stop sequences, because they might correspond to a sequence in the middle of a gene.
So, the sequence of the DNA coding strand with a 5-3 polarity is
5´- GCATAATGCGTGATCCCTAGGCA -3´
Reviewing video surveillance is part of which alert food defense
Answer:
The correct answer is - look.
Explanation:
Alert is an acronym that is used in food defense that stands for Assure, Look, Employees, Reports, and Threat. It helps in increasing the awareness of food safety in food industries.
The Look is the type of alert that includes video surveillance in the food industry or store to check and maintain food safety and security. It helps in looking during and after the food defense.
The accurate solution is =look for is part of which alert food defense.
Alert is an acronym this is utilized in meals protection that stands for Assure, Look, Employees, Reports, and Threat. It facilitates in growing the attention of meals protection in meals industries.
The Look is the sort of alert that consists of video surveillance withinside the meals enterprise or shop to test and keep meals protection and security. It facilitates in searching in the course of and after the meals protection.
What is food defense?Food protection is the safety of meals merchandise from infection or adulteration supposed to reason public fitness damage or financial disruption.
Thus it is well expailned.
To learn more about the food defense refer to link :
https://brainly.com/question/20543853
which is more vulnerable to disturbances, a simple food web with only a few species or a more complex one
Answer:
few species
Explanation:
in a complex one im not sure as to how the question measures complexity but a complex one may have more options and more things to adapt to
Discuss the origin of the Neandertals in terms of biological adaptation and other forces of evolution.
Answer:
Neandertals are closest relative to modern humans as their large brains size had to do with their meat diets. There were many theories including the Allens theory or Bergman theory their larger nasal apertures to cold environments.
Smaller bodies are adapted to more hot climates, and larger bodies are adapted to more cold climates as per Bergman's rule. Allen's rule says that the principle that limbs are longer in hot environments and shorter in cold environments.
explain the importance of taking named precautions before blood transfussion can be done?
Answer:
To minimize the chance of an adverse reaction during a transfusion, health care practitioners take several precautions. Before starting the transfusion, usually a few hours or even a few days beforehand, the person is cross-matched with the donor blood (not done for transfusions of plasma or platelets).
Fill in the blanks: Antibodies are produced by _______________________________________ and bind to specific ________________________________ on erythrocytes, causing ________________________________, or clumping of erythrocytes.
Answer:
Antibodies are produced by _white cells__ and bind to specific _antigens_ on erythrocytes, causing __agglutination__, or clumping of erythrocytes.
Explanation:
Macrophages are one of the different types of cells that intervene in the organism's defense system against strange substances and pathogen agents. These cells are the principal actors in the immune response.
Macrophages have several functions. They are the principal phagocytes of tissues, capable of recognizing different strange molecules that penetrate the organism, such as bacterias, parasites and, viruses. Macrophages phagocyte these substances and eliminate them, a process known as phagocytosis. When macrophages are activated, they release cytokines that favor inflammation response, which is used to neutralize the pathogen agent. When macrophages phagocyte strange substances, they show the antigens in their surfaces to be recognized by lymphocytes.
Antigens are defined as the strange substances that enter the organism and trigger a series of cellular events that produce defense mechanisms. Antibodies recognize antigens as invaders.
In the organism, there are leucocytes or lymphocytes (white cells) in charge of immune defense. These are B cells, which produce antibodies, and T cells that can destroy infected cells from the body. They all circulate in the blood.
Antibodies are globular proteins produced by lymphocytes in response to the presence of strange molecules. Each type of antibody recognizes and combines with a particular antigen, immobilizing it. After that, the antigen is destroyed by other components of the immune system.
how myelinated and nonmyelinated neurons differentiated?
Answer:
The main difference between these two types of neurons is the speed of conduction of impulse. ... Majority of the neurons in the central and peripheral nervous system are myelinated since they require fast conduction speeds. A neuron with unmyelinated axon has a comparatively lower speed of conduction of the nerve signals.
Explanation:
n
Mauna Loa is the most active volcano on Earth.
O True
O False
h
Answer:
it's "True"
Mauna Loa is the most active volcano on Earth
Answer:
True
Explanation:
Because A^2+B^2=C^2
Which statement is true?
A.Peat is a fossil fuel because rewetting it takes only 3–5 years.
B.Peat is a fossil fuel because the total time for restoration is lengthy.
C.Peat is not a fossil fuel because it has biologic origins, making it a biofuel.
D.Peat is not a fossil fuel because humans can promote the replenishment of peat.
Peat is not a fossil fuel because humans can promote the replenishment of peat is a correct statement.
What do you mean by Fossil fuels?Fossil fuels may be defined as fuels that are derived from decomposed plants and animals. It includes coal, petroleum, oil, and natural gases.
Peat is considered forgotten fossil fuel because through the activity of humans it may be replenished into other forms for different use. It may maximum takes 3-5 years for rewetting.
Therefore, the true statement is Peat is not a fossil fuel because humans can promote the replenishment of peat.
To learn more about Fossil fuels, refer to the link:
https://brainly.com/question/79954
#SPJ2
5. The major functions of carbohydrates irſclude
A. Structure framework. B. Storage C. Both Aan B
D . None of these
Answer:
D
Explanation:
used to provide energy to the body
how is the oxygen cycle disturbed by deforestation
Answer:
If deforestation is disturbed then the photosynthesis cycle is disturbed, which results in the oxygen cycle being affected. With a decrease in trees, a decrease in photosynthesis occurs, which cause a decline in the oxygen cycle. A decline in the oxygen cycle results in more polluted air.
Explanation:
Without trees, humans would not be able survive because the air would be unsuitable for breathing. Due to deforestation, there would be fewer trees to "clean" the air. Deforestation is the action or process of clearing of forests, or the state of having been cleared of forests.
Trees and plants, in general, produce energy for growth using a process known as photosynthesis. Using light, water and carbon dioxide, a plant produces energy in the form of sugar and releases oxygen into the air.
Deforestation, as well as a rise in the emissions and our global temperature, affects the air that we breathe. This is because all trees take in carbon dioxide and other pollutants which are known to cause a lot of problems in the atmosphere and to humans. This inevitably results in people breathing dirtier and more polluted air that normally wouldn't happen.
Long-term exposure to polluted air can have permanent health effects such as: Accelerated aging of the lungs. Loss of lung capacity and decreased lung function. Development of diseases such as asthma, bronchitis, emphysema, and possibly cancer.
Trees are responsible for taking the carbon from the atmosphere through photosynthesis in order to make energy. This carbon is then either transferred into oxygen and released into the air by respiration or is stored inside the trees until they decompose into the soil. Therefore, the absence of trees would result in significantly higher amounts of carbon dioxide in the air and lower amounts of oxygen. This bad quality air would also be full of airborne particles and pollutants like carbon monoxide, sulfur dioxide and nitrogen dioxide.
In addition to the decrease of oxygen in the atmosphere, it would allow excessive amounts of carbon dioxide to remain. In the short term, since CO2 is one of the major greenhouse gases, it will undoubtedly lead to higher global temperatures which, in turn, would quicken the melting of the polar ice caps.
The importance of water properties on plants and animals
The importance of water properties on plants and animals.
Answer:The importance of water in plants is that it helps plants to make their own food, because water plays a very important role in Photosynthesis, and as well it helps them to grow.
The important of water in animals is that it is main need for animals to survive as well as humans. Without water even a single organism won't exist in this Earth.
Hope it helps you :)The human body is made up of more than three-fourths of water, and all animals and plants require water to thrive.
Why water is essential for plants and animals?Water is used by all living things to transport nutrients throughout the body and remove waste. Among its many crucial functions, water aids in the digestion of food and the preservation of organisms' heat.
The term "universal solvent" refers to water's enormous capacity to dissolve a wide range of molecules, and it is this capacity that makes water such a priceless life-sustaining agent.
Water's function as a solvent aids cells in the transfer and utilization of molecules like oxygen or nutrients on a biological level.
Therefore, to do all the cellular processes by plants and animals there is need of water.
Learn more about water, here:
https://brainly.com/question/7977819
#SPJ2
Below is a mature eukaryotic mRNA transcript. Translate this mRNA into a protein, also showing the tRNA anticodons involved. Make sure you start and end translation in the right place! Label the ends of the polypeptide chain as N and C terminus.
mRNA: 5'GMUUACAUGCGGCUCAGUUGAGGCGAAAAAA 3'
tRNA:
amino acids:
Answer:
mRNA ⇒ 5'GMU UAC AUG CGG CUC AGU UGA GGC GAA AAA A 3'
tRNA ⇒ UAC GCC GAG UCA ACU
protein ⇒ N - MET ARG LEU SER Stop - C
Explanation:
In protein synthesis, the ribosome reads mRNA in the 5´ to 3´ direction, and, according to the codons that are being readen, tRNA transfers the correct amino acids to build the polypeptide chain. A codon is a short sequence of three nucleotides that store the genetic information for the aminoacids´ assembly. Each tRNA has two important sites. One of them that couples with the codon of the mRNA molecule, named anticodon. The other site couples with an amino acid. tRNA allows amino acids to align according to the nucleotidic sequence in the mRNA molecule.
Once the new amino acid links to the growing peptidic chain, the binding between the amino acid and the tRNA molecule breaks. The tRNA is now free to join another amino acid and repeat the cycle.
The protein is synthesized from the amino terminus to the carboxy terminus, while the added amino acids to the chain are coded by a codon formed by three bases in the mRNA. mARNs also have a start and end codon that are the signals of the synthesis initiation and finish. When the ribosome reaches the end codon, protein synthesis is over.
Each of the codons represents one of the 20 amino acids used to build the protein. Each amino acid can be codified by more than one codon. From the total 64 codons, 61 codify amino acids, and one of them is a start codon. The left three codons are stopping translation points.
The codons indicating the initiation or stop points during the translation process are:
• The start codon AUG is the most common sequence used by eukaryotic cells and places near the 5´extreme of the molecule.
• The end codons are UAA, UAG, UGA.
Protein synthesis initiates in the AUG start codon -Metionin-, and ends when reaching either of the stop codons UAA, UAG, UGA.
In the exposed example we have the following mRNA.
mRNA ⇒ 5'GMU UAC AUG CGG CUC AGU UGA GGC GAA AAA A 3'
Codons are separated by a space left between them. AUG is the start codon placed near the 5´ extreme. UGA is the end codon near the 3´ extreme. tRNA will add amino acids from the start codon, not before.
tRNA ⇒ UAC GCC GAG UCA ACU
Anticodons are separated by a space left between them.
protein ⇒ N - MET ARG LEU SER Stop - C
Each mRNA codon codifies for an amino acid. The start codon codifies for methionine. AUG = Met, CGG = Arg, CUC = Leu, AGU = Ser, UGA = Stop codon. The amino terminus is represented as an N and the carboxy terminus is a C. The first extreme to be translated carries the amino-terminal group, while the other extreme carries the carboxy-terminus group.
There is a Y chromosome gene in humans that has two alleles influencing hair growth on the pinna (external ear). One allele causes very hairy ears. The phenotypic effect of the other allele is to not have hairy ears. A man with hairy ears and a woman without hairy ears are starting a family. What is the probability their first child will be a girl with hairy ears
Answer:
Since the gene is located on the Y chromosome, and the Y chromosome is absent in females, the probability their first child will be a girl with hairy ears is zero
Explanation:
Y-linkage, also known as holandric inheritance is a form of sex linkage in which inherited traits in offsprings are produced by genes located on the Y chromosome. The Y chromosome is one of the sex-determining chromosomes and is present only in males. Males have a copy of the Y chromosome and an X chromosome while females have two copies of the X chromosome.
For a trait that is linked to the Ychromosome, the phenotypic effect occurs only in males and is always manifested in these males. Since the Y chromosome is absent in females, the character and its phenotypic effect are absent from daughters of trait carriers. Therefore, all daughters will be normal.
Since the gene for hair growth onnthe pinna is located on the Y chromosome, and the Y chromosome is absent in females, the probability their first child will be a girl with hairy ears is zero.
The probability that their first child will be a girl with hairy ears is zero.
The sex chromosomes in humans are the X and Y chromosomes. They determine the sex of a baby and also carry the sex linked traits. A baby girl results from XX and a baby boy results from XY.
We are told that this gene for hairy ears is located on the Y chromosome. This chromosome is absent in a girl child. hence, the probability that their first child will be a girl with hairy ears is zero.
Learn more: https://brainly.com/question/16243729
Consider the following statements:
1. RNA is ribonucleic acid.
2. RNA is used for information transport (known as mRNA). Choose the correct answer from the given codes:
A Only 1
B Only 2
C Both
D Neither 1 nor 2
E None of the above
Answer:
Only A
Explanation:
RNA is used for storing and transporting information through mostly virus only..
3. A bacterial isolate from a urine specimen was grown in culture, Gram stained, and then tested for its ability to ferment sugars and hydrolyze various subtrates. What approach to bacterial identification is this an example of
Answer:
Phenotypic approach for bacterial identification
Explanation:
Bacterial identification can be done by conventional methods, which are based on phenotypical characteristics. These methods are much affordable and reasonable.
Phenotypical identification is based on bacteria´s observable characteristics, such as their morphology, development, and biochemical/metabolic properties.
It is important to consider that these methods do not provide absolute certainty. They can only indicate the genera or species to which the bacteria under study may belong.
Some primary evidence is usually used for fast bacteria identification:
Gram staining, morphology, growth at different media or different incubation atmospheres, glucose fermentation, spores production, motion, aerobiosis/anaerobiosis, among others.Knowing that the bacteria in the exposed example was isolated and grown in culture, then Gram-stained and tested for biochemical reaction, we can assume that the approach for its identification is phenotypic.
How old is the sun?
Our little teenage Sun is nearly 4.6 billion years old.
In the aerobic metabolism of proteins by chemoheterotrophs (e.g., E. coli and you):____.
A. Proteins are broken down into smaller peptides and eventually into amino acids by proteases (peptidases).
B. Certain amino acids may be converted to pyruvate.
C. Certain amino acids may be converted to intermediates (e.g. oxaloacetate) of the Krebs cycle.
D. Certain amino acids may be converted to acetyl-CoA.
E. All of the above are true.
Solve the equation of mava=mbvb max5.0ml=5.2mlx0.10m
Answer:
0.104M
Explanation:
The following equation is given in this question:
mava=mbvb
Where;
ma = molarity of acid (M)
mb = molarity of base (M)
va = volume of acid (ml)
vb = volume of base (ml)
According to this inputted values;
max5.0ml=5.2mlx0.10m
ma = unknown molarity of acid
mb = 0.10M
va = 5.0ml
vb = 5.2ml
Hence, ma x 5.0ml = 5.2ml x 0.10m
5ma = 0.52
ma = 0.52 ÷ 5
ma = 0.104M
In a certain population, the allele causing sickle cell anemia has a frequency of 0.2. If the population is in genetic equilibrium for this allele, what fraction of the population would be heterozygous for this gene
Answer:
32% population would be heterozygous for this gene.
Explanation:
Due to technical problems, you will find the complete explanation in the attached files
In mice, apricot eyes is recessive to black eyes. Tail length is governed by another gene, linked to the eye color gene. Long tails is dominant to short tails. To determine the distance between the two genes, a double heterozygote is mated in a testcross and the classes of progeny produced were as follows:
Apricot eyes, Long tails 33
Apricot eyes, Short tails 20
Black eyes, Long tails 17
Black eyes, Short tails 30
Determine whether the heterozygous parent is in the cis or trans arrangement.
a. Cis
b. Trans
Answer:
trans
Explanation:
From the given information:
The study observes the genes present in mice for eye color and tail length. Since both genes are linked, it implies that they exist in the same chromosomes.
Black eyes is dominant over apricot eyes
Let Black eye be B and apricot eyes be b
Long tail is dominant over short tail
Let long tail be L and short tail be l
If double heterozygote(homoozygous-recessive) engage in the testcross
Then:
From the result given:
The parental combinations are:
Apricot eyes, Longtail (bL / bl) = 33
Black eyes, Short tails (Bl / bl) = 30
The recombinant genes are:
Black eyes, Long tails (BL / bl) = 17
Apricot eyes, Short tails (bl / bl) = 20
The recombination frequency relates to the distance between the two genes which can be computed as:
= (20+17)/100
= 37%
Thus; the heterozygous parent is in trans arrangement.
Warfarin acts by inhibiting the activity of the VKORC1 protein, which helps to produce functional clotting factors. There is a variant in the VKORC1 gene that lowers the dose of warfarin required for treatment, and individuals with this variant have increased risk of bleeding when they are treated with warfarin. This variant is found 1639 base pairs upstream of the translational start site. This variant likely:______.
a. decreases the activity of the VKORC1 protein.b. increases the activity of the VKORC1 protein.c. decreases expression of the VKORC1 gene.d. increases expression of the VKORC1 gene.
Answer:
The correct answer - c. decreases expression of the VKORC1 gene.
Explanation:
Mutation of Guanine nucleotide into Adenosine is the reason for this particular type of mutation. This mutation expresses the less expression of the VKORC1 protein.
The mutation results in a decrease in the affinity of the binding site of the transcription factor which causes less expression. Since the VKORC1 protein is less in the body so Warfarin doses are decreased
Thus, the correct answer is - decreases expression of the VKORC1 gene.
In pulsus paradoxus, even if the pulse cannot be palpated, it can still be heard by using a BP cuff and stethoscope.
a. True
b. False
Answer:
False.
Explanation:
Pulse can't be heard by using a BP cuff and stethoscope because these devices are used to measure the heartbeat and blood pressure of the body. Digital monitors display both blood pressure and heart rate, but you can determine the pulse by checking your pulse by using hand while on the other hand, heartbeats can easily be heard using a good stethoscope so we can say that pulse can't be heard through BP cuff and stethoscope.
Which of the following sentences uses commas correctly? Carol was the last person out of the house wasn't, she? Carol was the last person, out of the house wasn't she? Carol was the last person out of the house, wasn't she? Carol, was the last person out of the house wasn't she?
Answer:
The third sentence......................
Explanation:
The correct sentence is Carol was the last person out of the house, wasn't she?
Why is a comma important?Commas help your reader figure out which words go together in a sentence and which parts of your sentences are most important. Using commas incorrectly may confuse the reader, signal ignorance of writing rules, or indicate carelessness.
What are the Rules of commas?Comma Rules
Use a comma after an introductory phrase or clause. Use commas before and after a parenthetical phrase or clause. Use a comma to separate two independent clauses linked by a coordinating conjunction (and, but, for, nor or, so, yet) Use a comma to separate items in a series.Learn more about the use of commas here https://brainly.com/question/2251561
#SPJ2
The ABO locus for blood typing consists of three alleles, A, B and i. An analysis the ABO blood types in the population of the Pingelap atoll of Micronesia is being planned. A Chi-Square analysis is being planned as part of the data analysis. How many degrees of freedom are there in the experiment
Answer:
1/8(12.5) if the answer is correct plz mark me as brainliest.
Which of these molecules are used for short term energy by
organisms?
Select one:
a. Proteins
b. Nucleic Acids
O c. Carbohydrates
d. Lipids
Describe how table salt dissolves in water in 300 words.
Answer:
salt disloves in 300 words
Answer:
Salt (sodium chloride) is made from positive sodium ions bonded to negative chloride ions. Water can dissolve salt because the positive part of water molecules attracts the negative chloride ions and the negative part of water molecules attracts the positive sodium ions.
Explanation:
When sodium chloride is dissolved in water, the polar water molecules are able to work their way in between the individual ions in the lattice. The water molecules surround the negative chloride ions and positive sodium ions and pull them away into the solution. This process is called dissociation.
10.
All of the following are examples of specialized cells except
Answer:
Zygote
Explanation:
Prokaryotes and eukaryotes are similar in all of these aspects except
A. having all four types of macromolecules.
B. the size of their cells.
C. having at least one cell.
D. the presence of DNA
Answer:
D its D its D its D ddddddddddddddddd
An older woman is transported to the hospital on Thanksgiving Day. While visiting with family for the holiday, the woman fell out of her chair and was unresponsive to her family. Upon arrival to the emergency department, the family reports that the woman lives independently. Before her current state, she recognized family members and was speaking normally. She begins to arouse, and her family notes that she seems unaware of her surroundings and does not respond to questions.
A defect of recognition may be tactile, visual, or auditory. These are known as:___________
Answer:
Agnosia typically is defined as the inability to recognize sensory stimuli. Agnosia presents as a defect of one particular sensory channel, such as visual, auditory, or tactile.
Which of the following particles has no charge?
O A. Electron
O B. Neutron
C. Proton
D. Ion
Answer:
B. Neutron.
Explanation:
[tex]{ \tt{ {}^{1} _{0}{ \huge{n}} }}[/tex]