Explain how autotrophs need both cellular respiration and photosynthesis

Answers

Answer 1

Answer:

They get energy from food. Autotrophs make their own food through the process of photosynthesis, in which light energy from the sun is changed to chemical energy that is stored in glucose. And as for cellular respiration, all organisms use it to break down glucose, release its energy, and make ATP.

Explanation:

_____________


Related Questions

A dead organism takes matter out of the ecosystem cycle and that matter
can never be used again. *
O True
False

Answers

Answer:

Decomposers break down dead organisms into nutrients and gases so that they can be used by other organisms. Nutrients can enter or exit an ecosystem at any point and can cycle around the planet.

Answer:

False

Explanation:

Which statement best explains the myth about how Romulus and Remus founded Rome?

Answers

After deciding to build a town on one of seven hills, Romulus and Remus had to decide which hill to base it off of and Romulus chose Palatine hill and Remus chose Aventine Hill, Later leaving Romulus to kill Remus in a fight and build the city on Palatine hill hence the name Rome.

Answer: Romulus defeated his brother, then founded Rome on one of the seven hills.

Explanation: Despite there is no answer choices, I'm thinking back on a little quiz I took, and it had the same exact question with the same exact answer choices, and that was the correct answer

Which of the following foods are native to rainforests?
a. papayas
b. mangoes
c. Sugarcane
d. all of the above

Answers

Answer:

on edge here's the correct answer

Explanation:

Answer: It is D)

Explanation:

Why is weather different from place to place?​

Answers

Answer:

There are differences in climate around the world because of differing amounts of radiation received from the Sun at different parts of the Earth at different times of the year.

Explanation:

Hope this helps :)

Answer:

because according to where they are located, atmosphere brings different weather and temperature, and some places are further away from the sun, just like when it is day in one side but night on the other

Explanation:

PLEASE HELPPPPPPP

(Monstro the Goldfish & Epigenetics)

Answers

Answer:

mmmmmmmmmmmmdddddd

Explanation:

ddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddd

There are many different types of cells with many different types of cellular structures and functions. Which of these structures is found in all types of eukaryotic cells?
A. chloroplast
B. cell wall
C. nucleus
D. centrioles​

Answers

Answer:

nucleus

Explanation:

chloroplasts and cell walls are only found in plant (and fungi) cells, while centrioles are only in animal cells.

The structure that is found in all types of eukaryotic cells is the nucleus. The correct option is C.

What are eukaryotic cells?

Eukaryotic cells are those cells that contain true cell organelle. These cells are present in the higher organism, and they perform complex functions like replication, mitosis, etc.

There are two types of cells. They are prokaryotic and eukaryotic cells. Prokaryotic cells are those that do not contain an organelle and a nucleus. They are present in smaller organisms.

The nucleus is the brain of cells. It controls all functions of cells, and it contains the genetic material of the organisms. In prokaryotic cells, the nucleus is absent and in eukaryotic cells, the nucleus is present. That is the difference between them.

Thus, the correct option is C. nucleus.

To learn more about eukaryotic cells, refer to the link:

https://brainly.com/question/982048

#SPJ6

17. What causes evaporation?
O Air that is unsaturated with water vapor comes into contact with the surface of the water
O Air that is cooler than the water comes into contact with the surface of the water
O Air that is warmer than water comes into contact with the surface of the water
O Air that is supersaturated with water vapor comes into contact with the surface of the water in

Answers

the answer is the first one

Evaporation occurs when air that is warmer than water comes into contact with the water's surface, hence option A is correct.

What is evaporation?

As a liquid transforms into a gas, evaporation, a sort of vaporization, occurs on the liquid's surface. For instance, a high concentration of the evaporating substance in the surrounding gas significantly slows down evaporation when humidity affects the rate of evaporation of water.

It takes in moisture from garden soil as well as the biggest lakes and seas, and the level of the water will decrease when it is heated by the sun.

Therefore, solar energy, or heat from the sun, is what causes the evaporation process to occur, hence option A is correct.

Learn more about evaporation, here:

https://brainly.com/question/5019199

#SPJ5

(GIVING BRAINLIEST!!)


James made the following table to compare the common characteristics of planets. Which of the following would best replace X?


A) Asteroids

B) Comets

C) Moons

D) Stars

Answers

Answer: moons

Explanation:

Mars and Neptune both have moons

Answer:

hi answer is moons

Explanation:they have moons :)

please help i will give brainlist

Answers

Answer:

I think it's c hope I hope I helped if not I'm sorry:(

Option B is i hope
I think it is

what RNA nitrogen bases match with the following DNA nitrogen bases?

Answers

While DNA has the ATCG nitrogenous bases, RNA replaces thymine with uracil, making its bases AUCG. So, that means that whenever DNA has adenine, instead of pairing this with thymine, RNA will use uracil instead.

Select the correct bisector of the segment.
B
A
B
B
B
А
M
B
B
D

Answers

Answer:

C

Explanation:

it has the example figure number 7 and also it has the correct bisector

An example of __ is the color of betta fish. When a RED fish (GG) is crossed with a YELLOW fish (gg), all of the offspring will be a ORANGE color (Gg)

Answers

Answer:

The correct answer is  - incomplete dominance.

Explanation:

In the betta fish, there are different types of colors found in the fishes depends on the alleles present in their gene which follows incomplete dominance. Incomplete dominance is an inheritance pattern where a dominant allele does not mask completely and produce a blend of both alleles if present in heterozygous condition.

In the question, It is stated that when a cross between RED fish (GG) and a YELLOW fish (gg) produce orange color fish as offspring (Gg) which is a mix or blend of both alleles Red (dominant) and yellow (recessive).

The charged particles in the beams that Thomson studied came from atoms. As these particles moved away from their original atoms, they formed a visible beam. The current model of the atom includes protons, neutrons, and electrons.

What is the best use of an atomic model to explain the charge of the particles in Thomson’s beams?

An atom’s negative particles are surrounded by positive matter, so the positive particles are easier to remove.
An atom’s positive particles are surrounded by negative matter, so the negative particles are easier to remove.
An atom’s smaller negative particles are at a distance from the central positive particles, so the negative particles are easier to remove.
An atom’s larger positive particles are at a distance from the central negative particles, so the positive particles are easier to remove.

Answers

The question to the above information is;

What is the best use of an atomic model to explain the charge of the particles in Thomson's beams?

Answer;

An atom's smaller negative particles are at a distance from the central positive particles, so the negative particles are easier to remove.

Explanation;

-Atoms are comprised of a nucleus consisting of protons (red) and neutrons (blue). The number of orbiting electrons is the same as the number of protons and is termed the "atomic number" of the element.

J.J. Thomson discovered the electron. Atoms are neutral overall, therefore in Thomson’s ‘plum pudding model’:

atoms are spheres of positive chargeelectrons are dotted around inside

Answer:

Its C on edge

Explanation:

Which statement is true about gold and helium?
A. They both occur as a gas at room temperature.
B. They are both made of subatomic particles.
C. They are both used in balloons.
D. One of made of protons and the other of only electrons.

Answers

Answer:

The answer is B

B. They are both made of subatomic particles.

What increases as you move from the surface to the interior of the Earth?

Answers

Answer:

Heat/temperature

Explanation:

"There are three main sources of heat in the deep earth: (1) heat from when the planet formed and accreted, which has not yet been lost; (2) frictional heating, caused by denser core material sinking to the center of the planet; and (3) heat from the decay of radioactive elements." These give the core and a few of the outer layers of the earth more and more heat.

PLSPLSPLS HELP ASAP



a scientist discovers that the acidity of a lake increases overtime. at the same time, its population of Minnows grew smaller. when the adicity of the lake return to normal, The Minnow population recover.

In what two ways can the minnow population be used to monitor the Lakes water quality?

Answers

Answer:

In the above case we can understand that,

If the pH of the water increases the population of Minnows decreases.Minnows population can be determined by the acidity of the lake water.Minnows cannot survive in basic water.

Answer:  The answer is "It can be used to identify possible pH changes." and "It can be used as a bioindicator."

Explanation:

I got it right.

Which is the source of energy, which drives the water cycle?

Answers

Answer:

it's the sun

Explanation:

the water cycle is driven primarily by the energy from the sun

list one part of the cell theory in your own words, explain what it means

Answers

One part of the cell theory is that pre-existing cells can form more cells

This means that cells that currently exist are capable of creating more cells, however it’s a slow process

Which of these is an advantage of fossil fuels? *

O Reliable
O Large reserves
O Greenhouse gas emissions
O Non-renewable





Answers

Answer:

reliable

Explanation:

Explanation:

Fossil fuels are a non-renewable resource.

How is the rock in the deep mantle similar to the rock in the parts of the mantle nearest the surface? How is it different?

Answers

Answer:

Rocks within the mantle contain more magnesium and iron than the ones in the crust. Difference: Rocks in the deep mantle are under intense heat and pressure.

Why are some theories more widely accepted than others such as the theory of evolution?

Answers

Answer:

Scientific theories is accepted as a scientific truth, supported by evidence collected by many scientists. The theory of evolution by natural selection is a classic theory. Keeping in mind a Hypothesis is a possible answer to scientific questions.

Explanation:

I majored in Biology

Help me ASAP! CORRECT ME IF AM WRONG TY BOYS AND GIRLS

Answers

Answer:

CORRECT

Explanation:

6. A characteristic common to both diffusion and active transport is that
the movement of molecules occurs
energy is needed
oxygen is moved across a membrane
O
molecules move from low concentration to high concentration

Answers

Answer:

oxygen is moved across a membrane O, cause the others are untrue.

Can someone please help me

Answers

Answer:

carbon dioxide plus water in the presence of light energy to sugar and oxygen

“Fish and other wildlife become unhealthy and die without __________.”

Oxygen
Carbon Dioxide
Eutrophication

(This is 7th grade science)

Answers

Answer:

Oxygen

Explanation:

Andwer is oxygen if not then eutrophication

What is the purpose of the other tube of water?

Answers

Explanation:

cant see photo

Answer:

delude the other thing

there is no picture so i have no idea what your asking. ill edit this answer to be more specific when you explain

Explanation:

Answer this please I promise 30 points + mark as brainliest ( only relevant answers )

Answers

Answer:

A) Group X = Rose ,mango tree,marigold,palm tree

B) This is the answer of group X =Rose ,mango

This is the answer of group Y =Fern ,pine trees

Explanation:

Answer:

jen, from my heart im saying i lu.v u for real

its been almost 5 months weren't having the same old c.hat we used to have.

ik that ur scared to c.hat with  me since the day ur mom caught u

but still the old memories keep coming into me how many times i try to forget u, i still lu.v u jen still lu.v u

and as i made u a promise that one day we'll meet, i still keep thqat word and that day even if its just one day, we're gonna enjoy the max we could

i'll be waiting for that moment and i hope u would be too...

still lu.v u :(  .......

write the code for RNA from this DNA STRAND :

AAAAAATTTTTTCCCGGGGTTTATATATC

Answers

Answer:

UUUUUUAAAAAAGGGCCCCAAAUAUAUAG

Explanation:

All you have to do is apply the same concept as DNA, but T (Thymine) is replaced with U (Uracil)

write a short paragraph on hydra​

Answers

Answer:

at the moment i am thinking of 3 different hydra, marvel, mythical creature and creation on sexual reproduction between plants. If you could tell me the subject i could explain it to you. :)

Explanation:

Hydra are simple invertebrates, with two layers of body cells. They live in fresh water. Their body is radially symmetric. They have a central cavity through which they take in food and expel waste.

o
1. Which criteria are used to classify amphibians into orders?

Answers

Answer:

They are classified into three orders: frogs and toads, salamanders and newts, and caecilians.

Approximately 8,100 species of living amphibians are known. First appearing about 340 million years ago during the Middle Mississippian Epoch, they were one of the earliest groups to diverge from ancestral fish-tetrapod stock during the evolution of animals from strictly aquatic forms to terrestrial types. Today amphibians are represented by frogs and toads (order Anura), newts and salamanders (order Caudata), and caecilians (order Gymnophiona). These three orders of living amphibians are thought to derive from a single radiation of ancient amphibians, and although strikingly different in body form, they are probably the closest relatives to one another.
Other Questions
Where is peters family moving What are two measures introduced by the US and local governments to reduce the consumption of gas? Last year there were 205 ducks living on the pond. This year there are 20 % more ducks living on the pond. Is this a percent increase or decrease? * What is the x-coordinate of the point that divides the directed line segment from J to K into a ratio of 2:5? m 4 m ][xz x) + x, -4 -2 2 4 Which expressions are equivalent to 16? Select each correct expression 1 to the 16th power2 to the 4th power4 to the 2nd power8 to the 2nd power16 to the power of 016 to the power of 1 I want to know how to expand x(4 - 3.4y) The general area of the atom (outside the nucleus) where the e- are located is the and Question 1You will be using what you've learned in this lesson to develop a personal wellnessplan to help protect yourself from both communicable and noncommunicablediseases. Start by identifying controllable and uncontrollable risk factors for disease.(4 points)CommunicableControllableUncontrollableCLOSEgee.iehere to search X, Y and Z are three points on a map. Y is 75km and on a bearing of 200 from X. Z is on a bearing of 150, from Y. Z is due south of X. Calculate the distance between X and Z rounded to 1 DP. Paula walked on the treadmill for 11 minutes. The machine told her she had a total of 671 strides. What was her rate in strides per minute? Challenge: Make another comparison.Earth's outer layer is like Find the inverse of function f.$() = 9x + 7OA /--) = 7x + 9OB. 1 (1) = = -1Oc. 7-1() = -98OD. () = gr - 17 A rectangular prism has a length of 10in, a height of 15in, and a width of 8in. What is its volume, in cubic in? Some reasons why the Red River Settlement was largely peaceful from 1821- 1860 PLEASE ANSWER QUICKLY Overall how did the United States change from the Election of 1800 through Thomas Jeffersons first term of President. What was going on in the U.S. when the AoC was created? Which of the following is a physical state of matter? *A massB volumeC liquid How do you find the rate of change for tables? For example (see photo above) Give the IUPAC name for each compound. Eugene wanted to make note cards by cutting pieces of paper in half. Before starting he got six more pieces to use. When he was done he had 26 half-pieces of paper. With how many pieces did hestart?