Answer and Explanation:
La informacion genetica de ensamblaje de aminoácidos durante la sitntesis proteica, se almacena en unidades llamadas codones.
Un codón es una secuencia corta de tres nucleotidos provenientes de la cadena de ADN o ARN mensajero. Cada codón representa uno de los 20 aminoácidos disponibles para sintetizar la proteina. En total hay 64 codones, de los cuales 61 codifican aminoácidos (mas de un codón puede codificar para el mismo aminoácido), de los cuales uno de ellos a parte es el codon de inicio de sintesis proteica. Los restantes tres codones corresponden a codones de finalización.
El anticodón es la secuencia de nucleótidos presentes en ARN de transferencia, que complementa a cada codón de ARN mensajero. De esta forma el ARNt reconoce el aminoácido correspondiente y lo ensambla en la nueva proteina.
ADN ⇒ 5 ` ATGAGCACCCAAACTTGCTCTTATTCTAAAAAGACT 3
Codones ATG-AGC-ACC-CAA-ACT-TGC-TCT-TAT-TCT-AAA-AAG-ACT
ARNm ⇒ UACUCGUGGGUUUGAACGAGAAUAAGAUUUUUCUGA
Codones UAC-UCG-UGG-GUU-UGA-ACG-AGA-AUA-AGA-UUU-UUC-UGA
Recordá que para ARNm, la secuencia de nucléotidos debe ser la complementaria para ADN.
Anticodones de ARNt ⇒ Complementarios a los codones de ARNm. Recordá que para los ARN, la timina se reemplaza por uracilo.
AUG-AGC-ACC-CAA-ACU-UGC-UCU-UAU-UCU-AAA-AAG-ACU
La proteina se construye en función de la información del ARNm, es decir que para la selección de aminoácidos, se consideran los codones del ARNm, y no los anticodones de ARNt.
UAC-UCG-UGG-GUU-UGA-ACG-AGA-AUA-AGA-UUU-UUC-UGA
TYR SER TRP VAL Stop THR ARG ILE ARG PHE PHE Stop
2. Mars is the closest planet to Earth. Both Mars and Earth have different orbital speeds around the sun,
but when Mars is closest to Earth it is still 55,000,000 km away. How far is this in light-years?
Answer:
5.813504587e-6 that is what I found
What could a dog living now and a cat living thousands of years ago have in common?.
Answer:
wnat could a dog living now and a cat living thousands of years ago have in common
Maintaining a healthy lifestyle though diet and exercise is important
A boxer has been jumping rope for an hour. His leg muscles are burning and
he feels weak. Which substance is the most likely
cause of the burning he
feels in his muscles?
Answer:
anaerobic respiration takes place when you demand your muscles to do vigorous work. normally, aerobic respiration takes place but when energy is needed immediately, anaerobic respiration takes place. during anaerobic respiration,the body produces lactic acid, which leads to the burning sensation. your lungs deliver oxygen to the muscles much slower than the rate you need, since you're putting your muscles through an extensive exercise, and this leads to muscle fatigue.
which of the following can lead to an increase of squirrels in a park
A.increased emigration
B.increased immigration
C.a large number of predators
D.high competition for food
Answer:
Increased immigration.
Explanation:
Immigration = moving TO and area
1
What is the most appropriate way to present the data below?
Week
Plant Mass (g)
1
22
2
61
3
87
4
123
bar graph
chart
Oline graph
pie graph
Answer:
24.4
Explanation:
the reason is that if you multiply all those as what that comes to
Be a Lunatic
What are the moon's craters caused by?
volcanic eruptions
collisions with asteroids
collisions with Earth
collisions with ultraviolet radiation
Which muscle is highlighted below?
A. Obliques
B. Biceps brachii
C. Rectus abdominus
D. Latissimus dorsi
Answer:
A. Obliques
Explanation:
Those are oblique muscles. Biceps brachii are in your upper arm, rectus abdominis are your abs, latissimus dorsi is in your upper back (very big muscle)
Answer: obliques
Explanation:
took the quiz
(trust me ignore the comments on the other answer)
Athletes require energy to move their body. What biomolecules directly supplies your muscles with quick energy, or ATP, when broken down?
Creatine phosphate directly supplies muscles with quick energy, or ATP, when broken down.
Creatine phosphate is a phosphorylated creatine molecule. Muscles use stored chemical energy from the food we eat and convert it to heat and kinetic energy. Adenosine triphosphate is the source of energy used to power the movement of contraction in working muscles. However, ATP is not stored in large amounts in cells. So once muscle contraction begins, the process of making more ATP starts quickly. The muscle has three biochemical systems to produce more ATP for muscle contraction. One such biochemical system utilizes creatine phosphate. Muscles have a little ATP in them that they can use immediately but it does not last long. So, all muscle cells have a high-energy compound called creatinine phosphate which is broken down to form ATP quickly.
To know more, refer to,
https://brainly.com/question/13386203
#SPJ2
lizard is a poikilothermic animal why
Answer:
Lizard is a poikilothermic animal because lizards are those animals that do not require a fixed body temperature, their temperatures can fluctuate with little to no adverse effects to their overall health.
Explanation:
Reptiles are cold-blooded, or ectothermic, animals. This means that they cannot produce heat in their own bodies, and have to rely on their surroundings to keep warm. By moving in and out of sunlight, reptiles can keep their body temperature at a steady level throughout the day.
funny easy biology question below first correct answer gets brainliest
Answer:
b
Explanation:
ed sheeran
what animal has the longest lifespan?
Answer:
Ans.The longest living mammal is the bowhead whale, which can live up to 200 years. Also known as the Arctic whale, this animal is big, and lives in cold waters so its metabolism is slow. The record age for bowhead is 211 years.
Some endoliths have lifespan as long as 10000years.
In translation, which of these is responsible for forming a peptide bond? Choose the correct answer.
DNA
tRNA
nucleus
ribosome
A glass of milk tips over and the milk spills out into a thin puddle. Why does the milk flow out of the glass instead of staying in its place inside the glass?
Answer:
The milk in the glass is liquid, and takes up the shape of anything that it is in. When the milk spills out of the glass, it loses the shape of the glass.
If producers were removed from the environment would this cycle be able to continue?
A. Yes
B. No
Global warning is most closely associated with
Answer:
Fossil fuel
Explanation:
Human usage of fuel
Imagine carefully weighing a metal can, leaving it out in the rain for weeks and weeks until it was very rusted, and then carefully weighing it again. Would the can be heavier or lighter after it was rusted?
Answer:
The answer would be heavier, though it depends upon the type of metal. Rusting is essentially corrosion. Rust is often caused by a piece of metal getting soaked in water and then being exposed to oxygen. The rust will add more weight to the can so it becomes heavier.
Leaving out metal can in the rain for weeks and weeks until it was very rusted, and then if we carefully weighing it again it can be found that the can weighs more because the rust deposited on the metal can adds more weight.
What is rust?
Rust is referred to as an iron oxide, and a form of corrosion which is caused by a chemical reaction which affects masses of iron and steel.
Once formed, rust starts to eat away at the metal, forming a flaky, orange red coating which weakens the iron. It occurs when the metal reacts with oxygen and water.
For more details regarding rusting, visit:
https://brainly.com/question/2289143
#SPJ2
A Lewis Dot Structure shows only valence electrons.
A. True
B. False
Answer:
A. True
Explanation:
Also, if you've ever read Romeo and Juliet, please help me in my questions tab! I only need a general answer, and I'll give brainliest.
Answer:
A. True
Explanation:
Yes, a Lewis Dot Structure shows only valence electrons.
All living organisms carry out certain activities which make them different from inanimate objects. Which one of the following lists shows three activities of all living organisms?
Movement, decay, synthesis
Respiration, nutrition, preservation
Exercise, irritability, metabolism
Reproduction, excretion, growth
Answer:
Reproduction, excretion, growth
Explanation:
if humans began hunting and driving the great barracuda to extinction how would this affect the ecosystem (answer should discuss biodiversity, food webs, and food chains)
Answer:
then it may effect the entire biodiversity as many rare animals and birds can be killed and they can be existinc from the nanture it will directly affect the ecosystem and species diversity the food chain will also be directly affected as any one animal or species will be existinc the number of other species may rapidly increases or decrease
halp its due today brainliest to best answer its really easy just put words with the correct ones. i dont know how to do it please halp
Answer: In order
Moving Water , Standing Water, Lake, Pond, River, Stream, Watershed, Marsh, Wetland Swamp.
What is a pioneer species?
A. an organism that is exploring a new land
B. the species that colonize an area first
C. a species that is last to develop
Answer:
B. the species that colonize an area first
Explanation:
Pioneer species are the species that colonize an area first.
What did the countries that signed the Kyoto Protocol agree to do?
O A. Stop using CFCs
O B. Stop depleting the ozone layer
O c. Reduce greenhouse gas emissions
O D. Ban CO2 use
Answer:
C
Explanation:
The countries that signed the Kyoto Protocol agreed to reduce greenhouse gas emissions (C) particularly carbon dioxide emissions, in an effort to combat climate change.
What is Kyoto protocol?The Kyoto Protocol is an international treaty under the United Nations Framework Convention on Climate Change that was adopted in 1997 in Kyoto, Japan (UNFCCC). The treaty seeks to address the issue of global climate change by establishing targets for reducing greenhouse gas emissions, specifically carbon dioxide emissions, from industrialized countries.
According to the Kyoto Protocol, developed countries must reduce their emissions by an average of 5.2% below 1990 levels by 2012. The protocol has been ratified by 192 countries, and signatories have implemented a variety of policies and strategies to meet their emissions reduction targets, including increased energy efficiency, increased use of renewable energy sources, and the implementation of emissions trading systems. The Kyoto Protocol is a significant step forward in terms of international cooperation and action on the critical issue of climate change.
Learn more about Kyoto protocol, here:
https://brainly.com/question/12217621?referrer=searchResults
#SPJ7
A student wanted to determine the evaporation rates of three liquids. She placed 50 mL of each
liquid outside for an hour on the same day and then measured how much liquid evaporated. Which
would improve the validity of this investigation?
A. Put all three liquids outside at the same time
B. Have 2 students work
Ctogether on the investigation
Change the time for Liquid 3 to 7:00–8:00 PM
he amount of liquids used
Answer: I believe its C
Explanation: 2 and 3 are the same times
Its better to change the time to get different results.
SERE
Explain how using non-local resources has affected the United States both environmentally and economically.
Answer: Possible economic consequences of using non-local resources include increased costs of resources, loss of jobs, increased security risks, and a trade deficit.
Explanation:
Hope it helps you if not sorry
Sample Answer:
Possible environmental consequences of using non-local resources include the risk of oil spills as oil is transported over waterways, increased air pollution from water and land transportation of resources, and habitat loss that comes from pipeline construction and other infrastructures. Possible economic consequences of using non-local resources include increased costs of resources, loss of jobs, increased security risks, and a trade deficit.
Explanation:
HOW DOES THE PROCESS OF TRANSLATION CONVERT INFORMATION
Answer: Translation is the process of translating the sequence of a messenger RNA (mRNA) molecule to a sequence of amino acids during protein synthesis. The genetic code describes the relationship between the sequence of base pairs in a gene and the corresponding amino acid sequence that it encodes.
Explanation:
Hope it helps you if not sorry
Answer:from a nucleic acid code to an amino acid code
Explanation:
NOT from a DNA code to an RNA code
Answers to question 10 pretext organ system
Answer:
So what is the question you didn't put a photo
Explanation:
Which is a characteristic of an agonistic interaction?
cooperation
aggression
acceptance
submission
Answer:
aggression
Explanation:
hope that helps
Name one of the people who's work contributed to Darwin's Theory of Natural Selection. In 2-4 sentences discuss that individuals work. In another 1-2 sentences who did that individuals work contribute/ relate to Darwin's Theory.
Explanation:
everything can be found in the picture
What effect do biological washing powders have on the skin?
Answer:
Biological washing powder and liquids contain enzymes. These help to break down fat, grease and proteins to get clothes clean. While enzymes are great for getting rid of stains, they can damage wool, silk and other materials. Many people also find that they aggravate eczema and other sensitive skin conditions.
Explanation:
Answer:
The hysteria surrounding biological detergents in the UK led to claims that it can lead to or exacerbate such conditions as “erythema, pruritus and eczema.” Despite this, the review finds no evidence of any harmful effects to skin from bio washing powders and detergents