Find the area of the polygon

Find The Area Of The Polygon

Answers

Answer 1

Answer:

[tex]it \: is \: a \: polygon \: having \: \: \: \: \: \: \: \: \: \: \: \: \: \: \: \: \: \: \\ \\ base = 5cm \: \: \: \: \: \: \: \: \: \: \: \: \: \: \: \: \: \: \: \: \: \: \: \: \: \: \: \: \: \: \: \: \: \: \: \: \: \: \\ \\ height = 3cm \: \: \: \: \: \: \: \: \: \: \: \: \: \: \: \: \: \: \: \: \: \: \: \: \: \: \: \: \: \: \: \: \: \: \: \: \: \: \: \: \: \: \: \\ \\ area \: of \: polygon \: = base \times height \\ \\ area \: of \: polygon \: = (5 \times 3)cm \\ \\ area \: of \: polygon = 15cm ^{2} [/tex]

Answer 2
The answer is 15cmsquared

Related Questions

Jacob buys 8 copies of a book for presents for friends. It costs her a total of $119.60. Write an equation that can be used to find out how much each book, b, was sold for.

Answers

Answer:

8b=119.60

Step-by-step explanation:

8b=119.60

B=14.95

Ciara is naking a new outfit she needs 2 1/2 yards of the fabric for the shawl and 1 3/4 yards of fabric for the dress. If she has 3 yards of fabric,how much more does she needs?If the dance outfit is charged at $16 per yard how much will the dance outfit cost

Answers

Answer:

1 1/4 yards

$20

Step-by-step explanation:

The amount of fabric more that she needs can be determined by subtracting the sum of the yards needed for the shawl and the dress from the fabric she has

sum of the yards needed for the shawl and the dress =

[tex]2\frac{1}{2} + 1\frac{3}{4}[/tex]

[tex]3\frac{2 + 3}{4}[/tex] = [tex]3\frac{5}{4}[/tex] = [tex]4\frac{1}{4}[/tex]

Yards needed

[tex]4\frac{1}{4} - 3[/tex] = [tex]1\frac{1}{4}[/tex]

cost of dance outfit = $16 x [tex]1\frac{1}{4}[/tex]

[tex]\frac{5}{4}[/tex] × $16  = $20

Please hurry

Find the value of cos P rounded to the nearest hundredth, if necessary

Answers

Answer:

cosP = 4/5

Step-by-step explanation:

cosP= b/h = b/√(b²+p²) = 24(√(24²+18²)= 24/30= 4/5

Which decimal does NOT represent the amount shaded in the grid? M

Answers

Answer:

B.

Step-by-step explanation:

B. 0.078 is your answer

BERE
Which function represents exponential decay?
o
f(x) = {
f(x) = (-)
o pux) = 4(-3)
Of(x) = 4

Answers

Step-by-step explanation:

Sorry I don't kNkw the amswer

First, Diana scores 12 points in total with three arrows. On her second turn, she scores 15 points. How many points does she score on her third turn?

Answers

Answer:

Third turn point = 21 points

Step-by-step explanation:

Given:

First turn point = 12

Second turn point = 15

Find;

Third turn point

Computation:

First turn point = 12

Assume;

Point for outer circle = a

Point for inner circle = b

So,

3a = 12

Point for outer circle = 4 point

Second turn point = 15

So,

2a + b = 15

2(4) + b = 15

Point for inner circle = 7

Third turn point = 3 x 7

Third turn point = 21 points

Is this right? ASAP PLS HURRY!

Answers

no it isn’t u have to swap them out. is this right? asap pls hurry

Factor the expression completely

8x2-18

A. 2(2x - 3)(2x + 3)

B. 2(2x+3)(2x - 3)

C. 2(4x2 – 9)

D. 2(4x+3)(x - 3)​

Answers

Answer:

2 ( 2x+3) (2x-3)

Step-by-step explanation:

8x^2-18Factor out the greatest common factor of 2

2( 4x^2 -9)

2 ( (2x)^2 - 3^2)

What is inside the parentheses is the difference of squares

a^2 - b^2 = (a+b)(a-b)  

2 ( 2x+3) (2x-3)

Answer:

B. 2( 2 x + 2 ) ( 2x - 3 )

Step-by-step explanation:

8 x² - 18

2 ( 4 x ² - 9 )

2 ( ( 2x ) ² - ( 3 )²)

2 ( 2 x + 3 ) ( 2x - 3 )

Evaluate the expression when x=48 and y=3 x/8-y

Answers

Answer:

[tex]9\frac{3}{5}[/tex]

Step-by-step explanation:

[tex]\frac{x}{8-y}=\frac{48}{8-3}=\frac{48}{5}=9\frac{3}{5}[/tex]

Answer:

9.6

Step-by-step explanation:

x=48

y=3

=>x/8-y

=>48/(8-3)

=>48/5

=>9.6

[tex]\text{Solve for x:}\\\\3x + 65 = 523\\\\\text{Thank you.}[/tex]

Answers

Hi there!  

»»————- ★ ————-««

I believe your answer is:  

[tex]{x=152.666....[/tex]

»»————- ★ ————-««  

Here’s why:

⸻⸻⸻⸻

[tex]\boxed{\text{Solving for x...}}\\\\3x+ 65= 523\\----------\\\rightarrow 3x + 65 - 65=523-65\\\\\rightarrow 3x = 458\\\\\rightarrow\frac{3x = 458}{3}\\\\\rightarrow \boxed{x=152.666....}[/tex]

⸻⸻⸻⸻

»»————- ★ ————-««  

Hope this helps you. I apologize if it’s incorrect.  

[tex]\boxed{\large{\bold{\blue{ANSWER~:) }}}}[/tex]

3x+65=523

3x=523-65

3x=458

x=458/3

x=152.66...

[tex]\text{ Thank ~you!! }[/tex]

Jalen says that the height, radius, and diameter of a cone lie entirely on the base of the cone. What is Jalen’s error?
The height does not lie on the base because it is perpendicular to the base.
The radius does not lie on the base because it contains the center of the base.
The diameter does not lie on the base because it contains a radius of the circle.
The base does not contain the height, the radius, or the diameter because it is a circle.

Answers

Answer:

A, or "The height does not lie on the base because it's perpendicular to the base."

Step-by-step explanation:

EDGE 2021

Option A is correct, the height does not lie on the base because it is perpendicular to the base.

What is Three dimensional shape?

a three dimensional shape can be defined as a solid figure or an object or shape that has three dimensions—length, width, and height.

Given that Jalen says that the height, radius, and diameter of a cone lie entirely on the base of the cone.

We have to find the Jalen’s error.

As we know that height does not lies on the base because it is perpendicular to the base.

The Jalens error is that height does not lie on the base because it is perpendicular to the base is a error statement.

Hence, option A is correct, the height does not lie on the base because it is perpendicular to the base.

To learn more on Three dimensional figure click:

https://brainly.com/question/2400003

#SPJ7

According to the graph, what is the factorization of x2 - 6x + 5?

A. (x + 5)(x+1)

B. (x - 5)(x+ 1)

C. (x - 5)(x - 1)

D. (x + 5)(x - 1)​

Answers

The factorization of x2 - 6x + 5 is (x - 1)(x -5)

How to determine the factorization?

From the graph, the zeros of the function are:

x = 1 and x = 5

Set the zeros to 0

x - 1 = 0 and x - 5 = 0

Multiply the zeros

(x - 1)(x -5) = 0

Hence, the factorization of x2 - 6x + 5 is (x - 1)(x -5)

Read more about factorization at:

https://brainly.com/question/11579257

#SPJ1

How long does daily skips take

Answers

About 30 minutes a day

What is the value of x?

Answers

Answer:

x = [tex]29^{o}[/tex]

Step-by-step explanation:

Looking at the right triangle we see two congruent sides, which means that we can find the angles:

180 - 64 = 116° for both bottom angles of the right triangle, so 58° (116°/2).

Looking at the middle angle we know that left corner from the left triangle is 58° so the angle in the middle would be 180 - 58 = 122°.

Since the right triangle equals to 180° then we can find the missing values including x:

180 - 122 = 58° is the total angle for each corner of the right triangle. So x would be 58/ 2 = 29°.

Therefore x = 29°.


not sure how to do this one! will mark brainliest

Answers

Answer:

[tex]\frac{1}{6}[/tex]

Step-by-step explanation:

[tex]-\frac{12}{16} + \frac{11}{12}[/tex]

take lcm of the denominator

lcm=48

[tex]\frac{-12*3 + 11*4}{48}[/tex]

[tex]\frac{-36 + 44}{48}[/tex]

[tex]\frac{8}{48}[/tex]

[tex]\frac{1}{6}[/tex]

Answer:

[tex]=\frac{1}{6}[/tex]

Step-by-step explanation:

[tex]-\frac{12}{16}+\frac{11}{12}[/tex]

the lcm of 16 and 12 is 48

[tex]-\frac{12}{16} =-\frac{36}{48}[/tex]

[tex]\frac{11}{12} =\frac{44}{48}[/tex]

[tex]-\frac{36}{48} +\frac{44}{48}=\frac{8}{48}[/tex]

[tex]=\frac{1}{6}[/tex]

Hope this helps

can someone please help me!!!! ​

Answers

Answer:

10 * 9 = 90

90/2 = 45

45 cm^2

45 cm :) forgive me if I’m incorrect

PLEASE ANSWER ASAP!!!

Answers

Answer:

1/a^2 is the answer to this question

The answer will be B.

The probability the Sam sleeps for less than 6 hours is 0.25 work out the probability that Sam sleeps for 6 hours or more

Answers

Step-by-step explanation:

h na jwhwwhwhwhwhwhwhwhwjjwjwjwjje i don't know thrle answer

pls check screenshot 50 points

Answers

Answer:

See below

Step-by-step explanation:

Part (a)

f(x - 1) is the translation of f(x) one unit right.

So the graph is exactly same shape but shifted right one unit.

Part (b)

f(x) has vertex (-1, 2)

The function y = f(-x) + 2 will have the vertex changed as per rule:

(x, y) → (-x, y + 2)

So the new vertex is:

(-1, 2) → (-(-1), 2 + 2) = (1, 4)

find the number whose product with 2/211 gives 8/11​

Answers

Answer:

1688/22

Step-by-step explanation:

keep, change, flip

Select the best answer to complete the sentence. A Rigid Motion or Isometry ______________________.

A. preserves length, angle measures and distance between points
B. preserves length and angle measures but not distance between points
C. is a transformation that changes the size of the figure
is a transformation with its image and pre-image not being congruent

Answers

Answer: A. preserves length, angle measures and distance between points

Rigid motions or isometries are any of the three transformations below

translation (aka shifting)rotationreflection

Any of those three transformations will keep the figure the same size and shape. That means distances between any two points are kept the same, and angle measures are kept the same as well. Everything is kept the same. The only difference is that the figure is in a different location, is rotated somehow, or it is reflected some way. You can use a series of transformations to undo everything to get the original figure back.

If you wanted to change the size of the figure, then you would apply dilation, which isn't an isometry.

Which value of a in the exponential function below would cause the function to stretch? (one-third) Superscript x

Answers

Answer:

1.5

Step-by-step explanation:

Given

[tex]f(x) = \frac{1}{3}^x[/tex]

[tex]Options: 0.3\ 0.9\ 1.0\ 1.5[/tex]

Required

What value cause a stretch

For the function to stretch, then the scale factor must be greater than 1.

From the list of options.

Only 1.5 is greater than 1 i.e. [tex]1.5 > 1[/tex]

Hence, 1.5 will cause a stretch.

Answer:

ITS D. 1.5

Step-by-step explanation:

Suppose that 3 balls will be randomly put into 3 buckets, with each ball being equally likely to be put into each of the buckets, independently of which buckets are chosen for any of the other balls. (E.g., the first ball is equally likely to be put into any of the 3 buckets, and then regardless of which bucket the first ball is placed in, the second ball is equally likely to be put into any of the 3 buckets.) What is the probability that all of the balls will be put into the same bucket

Answers

Answer:

[tex]\frac{1}{27}[/tex]

Step-by-step explanation:

Since there are a total of three buckets and only one can be chosen at a time, this would mean that the probability of a ball being placed in a bucket is 1/3. Since each ball has the same probability of being placed into any bucket regardless of the where the previous ball landed, it means that each ball has the same 1/3 probability of a bucket. In order to find the probability that all three land in the same bucket, we need to multiply this probability together for each one of the balls like so...

[tex]\frac{1}{3} * \frac{1}{3} * \frac{1}{3} = \frac{1}{27}[/tex]

Finally, we see that the probability of all three balls landing in the same bucket is [tex]\frac{1}{27}[/tex]

Un vehículo se mueve en línea recta a una velocidad de 144 km/h durante 45 minutos. ¿Qué distancia recorre? Dar la respuesta en metros.
Ayudaaaaaa

Answers

Answer:

I can't understand.

Step-by-step explanation:

Sorry

Can i plz get some help been stuck for while
What is the volume of the shape shown

Answers

Answer:

Yea sure its 102.5meters squared

2. You are standing 15 feet from a tree. You want to get an apple from the tree using a ladder that is 25 feet long. What is the height of the tree? What is the angle of elevation?

Answers

Answer:

h = 20 ft

theta =53.13010235

Step-by-step explanation:

First we can find the height by the Pythagorean theorem

a^2 + b^2 = c^2  where a and b are the legs

15^2 + h^2 = 25^2

225 + h^2 = 625

h^2 = 625 - 225

h^2 = 400

Taking the square root of each side

h = 20 ft

Now using trig functions

cos theta = adj side / hyp

cos theta = 15/25

Taking the inverse cos of each side

cos^-1 ( cos theta) = cos^-1 ( 15/25)

theta =53.13010235


Three people build a wall in 10 days. How long would it take five people?

Answers

Answer:

6 days for 5 people

Step-by-step explanation:

3 x 10 = 3030/5 - 66 days


The difference of two positive numbers is 14. The larger is twice the smaller decreased by 4. Find the two numbers.
X (smaller value)
X (larger value)

Answers

Answer:

the answer is given on the picture

Help:( me please I don’t know what to do I completely for got it

Answers

Answer:

x=1

y=-2

point form- (1,-2)

PLS ANSWER FAST 60 PTS

Answers

Answer:

72 sqrt(3) ft^2

Step-by-step explanation:

Since this is a right triangle, we can use trig functions

We can find the height by

tan theta = opp /adj

tan 60 = h /12

12 tan 60 = h

12 sqrt(3) = h

Then we can find the area

A = 1/2 bh  where b is the length of the base and h is the height

A = 1/2 ( 12) ( 12 sqrt(3))

A  = 72 sqrt(3) ft^2

Other Questions
Qu funcin cumple la poltica en los conflictos sociales Say you had the following DNA sequence: ATGCTGCGAAACTTTGGCTGA Let's say there was a mutation that removed one letter (the first C): ATGCTGCGAAACTTTGGCTGA Provide the 6 DNA codons that would be read following the mutation. Are they the same as the original 6 DNA codons that would have been read 1.Name the canan that connects the Red sea to the Mediterranean Sea2.Name the country where coffee was discovered3.Name the system of racial segregation seen in South Africa4What is the term given to the peninsula that forms the easternmost projection of the African continent5Name the precious gem that is the major natural resource of Africa6Name the Savannah region that is the site of the largest mammal migration on Earth A digital signal differs from an analog signal because it a.consists of a current that changes smoothly. b. consists of a current that changes in pulses. c.carries information. d. is used in electronic devices. Write an equation for the line that is parallel to the given line and that passes through the given point. y = 1/2x - 8; (-6, -17). Find the equation of the line that passes through the points A (2, 3) and B (5, -7) how did advancements in technologry help bring a quick end to conflict in the pacific during world war II My School in vanacola Write 8 as a percentage of 32Plssss helppp A senator introduces a bill by taking it to the president pro tempore, the majority leader, and the minority leader.TrueFalse****If a bill cannot be voted on due to the lack of members present, it is unlikely that the bill will make it to the House floor.True***False por qu se termina el bombardeo de Hiroshima y nagasaki Explain how the slow recovery of the bald eagle population likely affected the recovery of the salmon population Last month, the Tecumseh Corporation supplied 400 units of three-ring binders at $6 per unit. This month, the company supplied the same quantity of binders at $4 per unit. Based on this evidence, Tecumseh has experienced:_________.a. a decrease in supplyb. an increase in supplyc. an increase in the quantity suppliedd. a decrease in the quantity supplied. the average of three numbers is 25. two of the numbers are 18 and 40. what is the third number James Polk believed in which of the following ideas?A) The United States should not expand west of the Mississippi River.B) The United States should negotiate with native tribes in the western territories in order to acquire land.C) The United States should extend from the Atlantic Ocean to the Pacific Ocean.D) The United States should acquire land only through peaceful compromise. Two-thirds of a number is 5 more than half of it . What is the number ? What is the delta H when 72.0 grams H2O condenses at 100.00C?Here are some constants that you MAY need. specific heats heat of fusion heat of vaporization H2O(s) = 2.1 J/g0C 6.01 kJ/mole 40.7 kJ/mole H2O(L) = 4.18 J/g0C H2O(g) = 1.7 J/g0C 2930 kJ163 kJ-163 kJ-2930 kJ Which of the following Oklahomans is known for his plan in support of alternative energy sources such as wind and solar power?A.T. Boone PickensB.William CroweC.Walter CronkiteD.Bill Moyers On a coordinate plane, a curved line with minimum values of (negative 1.5, negative 2) and (1.5, 2), and a maximum value of (0, 4), crosses the x-axis at (negative 2, 0), (negative 1, 0), (1, 0), and (2, 0), and crosses the y-axis at (0, 4).Which is an x-intercept of the graphed function?(0, 4)(1, 0)(4, 0)(0, 1) Phenols do not exhibit the same pka values as other alcohols; they are generally more acidic. Using the knowledge that hydrogen acidity is directly related to the stability of the anion formed, explain why phenol is more acidic than cyclohexane