Find The Circumference Of A Circle With D =22.1

Answers

Answer 1

Answer:

138.86

Step-by-step explanation:

Multiply the radius by 2 to get the diameter.

Multiply the result by π, or 3.14 for an estimation.

That's it; you found the circumference of the circle.


Related Questions

the square of a negative number increased by 6 times the number is 72. Find the number.

Answers

Answer:

y = 6

Step-by-step explanation:

(y + 6) × y = 72

y = negative number²

When negative numbers are squared they become positive.

y = 6

Check

(6 + 6) × 6 = 72

12 × 6 = 72

Please help me I dont really understand
(this is 12 year old math)

Answers

Answer:

S represents sasha and B represents brother.

Equation is s = b + 4

11

13

16

24

Step-by-step explanation:

Let s represent Sasha

Let b represent brother

Answer:

When B is 7, S is 3.

When B is 9, S is 5.

When S is 20, B is 24.

When S is 28, B is 32.

Mhanifa or Anyone Answer this PLZ

Answers

Answer:

C) (3, 4)B) (-1, 9)

Step-by-step explanation:

Use midpoint formula

x = (x₁ + x₂)/2y = (y₁ + y₂)/2

#3

Endpoints (0, 0) and (6, 8)

Midpoint has coordinates:

x = 6/2 = 3, y = 8/2 = 4Point is (3, 4)

Correct choice is C

#4

Endpoints (-5, 3) and (3, 15)

Midpoint has coordinates:

x = (-5 + 3)/2 = -1, y = (3 + 15)/2 = 9Point is (-1, 9)

Correct choice is B

The simple interest on a certain sum for 5years at 8% per annum is Rs200 less than the simple interest on the same sum for 3years and 4months at 18% per annum.Find the sum​

Answers

Answer:

Step-by-step explanation:

The simple interest on a certain sum for 5years at 8% per annum is Rs200 less than the simple interest on the same sum for 3years and 4months at 18% per annum.Find the sum​

The formula for Simple Interest = PRT

From above question, we have to find the Principal

The simple interest on a certain sum for 5years at 8% per annum is Rs200

Hence,

R = 8%

T = 5 years

Rs 200 = P × 8% × 5

P = 200/8% × 5

P = Rs500

The principal = Rs 500

The simple interest on the same sum for 3years and 4months at 18% per annum.

Simple Interest = PRT

R = 18%

T = 3 years and 4 months

Converted to years

T = 3 + (4 months/12 months)

T = 3.33 years

Hence,

Simple Interest = Rs 500 × 18% × 3.33 years

= Rs 299.7

Jose wants to pay off his credit card balances within 18 months. He is trying to decide if he should use his $1,750 in
savings to pay off part of the balances or if he should transfer the balances to a new card with a low introductory
rate. The new credit card has an introductory rate of 8% but charges a balance transfer fee of $60 for each balance
transfer. Jose decides to pay off Credit Card B using his savings and then transfer the balance of Card A to the new
card. Which of the following options shows the amount of Jose's new monthly payment?
Credit Card A: $1,154
Credit Card B $1,469
A. $90.43
B. $68.25
C. $71 80
D. $75.34

Answers

Answer:

ANSWER IS C: 71.80

Step-by-step explanation:

hope this helps :D you got this!!

The amount that corresponds to the new monthly payment of Jose is approximately $75.34. Hence, option D is correct.

What is use of credit card ?

Credit cards are a widely used financial tool that allow individuals to make purchases on credit. The main use of a credit card is to allow the cardholder to borrow money from the card issuer

If Jose decides to pay off Credit Card B using his savings of $1,750, he will have a remaining balance of $1,154 on Credit Card A.

If he transfers the balance of Credit Card A to the new card with a low introductory rate of 8%, he will incur a balance transfer fee of $60.

The total balance transferred =  $1,154 + $60 = $1,214.

To determine his new monthly payment, we need to calculate the monthly interest rate on the new card.

At an annual interest rate of 8%, the monthly interest rate is :

8% / 12 = 0.67%.

Using an online loan calculator or spreadsheet, we can calculate that the monthly payment required to pay off a balance of $1,214 in 18 months at a monthly interest rate of 0.67% is $75.34 (rounded to the nearest cent).

Therefore, the answer is D. $75.34, which represents Jose's new monthly payment.

Find more on introductory rate :

https://brainly.com/question/14184570

#SPJ7

Please help!! Area!!

Answers

Answer:

5*8*4

Step-by-step explanation:

Multipy them together lol

(C) A bakery sells 9 types of sandwiches. Here are their calorie amounts: 562.568. 590. 599. 611.621. 623. 641, 938. Which measure should be used to summarize the data? A-Mean B-Median C-Mode​

Answers

Answer:

611

Step-by-step explanation:

The mean is 632.9 which is a lot higher than 611, and is actually higher than the penultimate value 632, and if presented as a general single value, it may mislead customers into thinking that the sandwiches have a high calorific value. We don’t know how many sandwiches of different types there are, and there may only be a few with high values. So I would use the median 611 as a typical value for the number of calories.

10. Jacque is adding a rectangular room on the back of his house. The length will be 5 meters

longer than the width. If the area of the room will be 150 square meters, what are the

dimensions?

Answers

Answer:

L = 15 m, b = 10 m

Step-by-step explanation:

Let width of the rectangle be b.

Length = 5+b

The area of the rectangle is 150 sq meters.

The area of rectangle is given by :

A = lb

So,

[tex]150=b(5+b)[/tex]

It is a quadratic equation. The solution of this equation is :

b = -15 m and 10 m

Neglecting -15, the width of the rectangle is 10 m.

Length = 5+10

= 15 m

So, the dimensions of the room are 10 m and 15 m.

Find k so that x + 2 is a factor of x ^ 3 - k * x ^ 2 + 2x + 7k. (If anyone could help me out with this that would be amazing!!)

Answers

Answer:

k = 4

Step-by-step explanation:

If x + 2 is a factor of the polynomial;

By the factor theorem, if we set x + 2 = 0, then make x the subject of the formula; if we substitute the value into the polynomial, the result we should have after calculating should be zero

So, we have it that;

x + 2 = 0

x = -2

Substitute into the polynomial and equate to zero

(-2)^3 - k (-2)^2 + 2(-2) + 7k = 0

-8 -4k -4 + 7k = 0

-12 -4k + 7k = 0

-12 + 3k = 0

-3k = -12

k = -12/-3

k = 4

The volume of the sphere is about (blank) ft.​

Answers

Answer:

[tex]14.13[/tex]

Step-by-step explanation:

V=[tex]\frac{4}{3}[/tex][tex]\pi r^{3}[/tex]

Answer:

[tex] \displaystyle V_{ \text{sphere}} =14.13 \: \rm ft^{3} [/tex]

Step-by-step explanation:

we are given the redious of a sphere

we want to figure out the volume

remember that,

[tex] \displaystyle V_{ \text{sphere}} = \frac{4}{3} \pi {r}^{3} [/tex]

since we are given the redious we can substitute

[tex] \displaystyle V_{ \text{sphere}} = \frac{4}{3} \pi { \times 1.5}^{3} [/tex]

as the approximate value of π is given

substitute:

[tex] \displaystyle V_{ \text{sphere}} = \frac{4}{3} \times 3.14 { \times 1.5}^{3} [/tex]

we know the order of PEMDAS. Parentheses, Exponent, Multiplication or Division, Addition or substraction

so

simplify square:

[tex] \displaystyle V_{ \text{sphere}} = \frac{4}{3} \times 3.14 { \times 3.375}[/tex]

reduce fraction:

[tex] \rm\displaystyle V_{ \text{sphere}} = \frac{4}{ \cancel{ 3 \: }} \times 3.14 { \times \cancel{ 3.375}} \: ^{1.125} [/tex]

[tex] \displaystyle V_{ \text{sphere}} = 4\times 3.14 \times 1.125[/tex]

simplify multiplication:

[tex] \displaystyle V_{ \text{sphere}} =14.13[/tex]

since we cubed the redious and the redious is in feet, we of course use cubic feet

[tex] \displaystyle V_{ \text{sphere}} =14.13 \: \rm ft^{3} [/tex]

HELP
PLEASEEEEEEEEeeeee

Answers

Answer:

A

Step-by-step explanation:

1/2f

Draw a line representing the "rise " and a line representing the "run" of the line. State the slope of the line in simplest form .

Answers

Answer:

4/5

Step-by-step explanation:

you rise up from the line where it is exactly going throw another line. (like it would make a point) fine another time where it happens and rise count up or down and count up and run count left or right. then you'll have a fraction

12-6.5 also i need help with a scenario and with a word problem the scenario is the photo i put and with two word problems ramona sees that her cat hasn"t been eating and wants him to gain more weight. If the cat weighs 6.78 pounds and the goal weight is 10.5 lbs, how much weight does Ramona want her cat to gain? these are two separate problems. Jessica is running a 5k which is about 3.1 miles at a charity event. She starts slowing down around 1.75 miles into the race. How much farther does Jessica have before reaching the finish line?

Answers

Answer:

The cat needs to earn 3.72 pounds

Jessica has 1.35 miles to earn in the race.

Step-by-step explanation:

I need help wit math​

Answers

Answer:

1/2

Step-by-step explanation:

Even numbers on the dice:

2, 4, 6

Probability of getting even:

3/6

1/2

Please help I can’t figure it out NO LINKS
LINKS= REPORT

Answers

The line for y = -x + 3 is suppose to be negative slope. It’s -x so it goes down 1 right 1. Not up 1 right 1.

GIVE ME A SOLID ANSWER

I gain: These 2 pages answers

You gain: 25 points brainliest

Answers

Answer:

Sorry but it is really difficult to see the questions... :(

Can you zoom up on them?

Step-by-step explanation:

-3(7x-5)
Please I need an answer ASAP

Answers

Answer:

-21x + 15!

Step-by-step explanation:

Multiply using the distributive property. Hope this helps!

-Lei

Math.... Can you help

Answers

Answer: -42 7/8

Step-by-step explanation: Hope this help:D

What is the value of x?

Answers

Answer:

-115?

Step-by-step explanation:

i have no idea but try anyways

Please answer correctly!! I’ll mark as brainliest!

No links no fake answers

Answers

Answer:

Option 3: cos A=15/17

Step-by-step explanation:

Sine is the opposite side over the hypotenuse,

Cosine is the adjacent side over the hypotenuse, and

Tangent is opposite side over the adjacent side

You can remember this with the acronym SOHCAHTOA (sine, opposite, hypotenuse, cosine, adjacent, hypotenuse, tangent, opposite, adjacent)

Option 3 uses cosine, so the adjacent angle to angle A would be 15 and the hypotenuse would be 17, so 15/17

mariah and isaiah each deposited $7000 into accounts that earn 6% interest the graph shows the amount of interest each account earns in the 1st three years whose account earns annual simple interest and whose account earns annual compound interest explain your choice
Please help me

Answers

Answer:

its Isaiah he's the most financially stable

Answer:

Compound is Isaiah and Simple is Maria.

Step-by-step explanation:

The price of an item has been reduced by 70%. The original price was 70$. What is the price of the item now?

Answers

Answer:

21

Step-by-step explanation:

original price-reduced price

100%-70%=30%

100%=70

30%

30%/100%*70=21

=21$

BRAINLY TO WHOEVER CAN HELP PLS OMG ASAP

Answers

Answer:

1: C

2:A

Step-by-step explanation:

Dialation is just the multiplucation of the size. If the original point is 2, 4 dialated to 2 is would be 4, 8. Basiccly just multiply by 2 in this example.

PLEASE HELP!!! Given PQ. Find the measure of arc PQ, if the radius is 30 and chord PQ = 36. Round to nearest degree.

Answers

Answer:

I think the answer is 30.

A group of people are fundraising, and each person raises a certain amount of money for every mile they walk. Each person's fundraising is
represented below using d for the dollars that person raises and w for the miles that person walks

Answers

Answer:

lk

Step-by-step explanation:

on

Kirti bookstore sold books worth Rs.285891 in the first week of june and books worth Rs.400768 in the second week of the month .How much was the sale for two weeks together ? In which week was the sale greater and by how much?

Answers

Answer: A)Sale for two weeks =Rs. 686,659.  b)\Kriti books had greater sales in the second week than the first by Rs.114877

Step-by-step explanation:

Price of books sold in the first week=Rs.285891

Price of books sold in the second  week=Rs.400768

Total Amount of books sold in the two weeks=Rs.285891 +Rs.400768 =

Rs. 686,659.

Fro the question, we can see that Kriti books store has more sales in the second week.

Which is greater than in the first week by Rs.114877

Rs.400768 -Rs.285891 =Rs.114,877

I’ll give Brainly est help. B

Answers

Answer:

C) 99 + 3x

Step-by-step explanation:

Since it's always going to cost 99, it'll stay like that since it's a constant

Since it's 3 PER person, that means 3 will have a variable: 3x

Which is shown below?
12 > 11
A. An operation
B. An inequality
C. An expression
D. An equation
SUBMIT

Answers

Answer:

B Inequality

Step-by-step explanation:

since 12 is greater than 11 they are not equal

> this sign is the greater than sign

HELLO!! I NEED HELP! Please show full Solutions. I will mark brainliest for the best answer. Thank you and god bless.

Answers

((x+2)(x+2))-((x-5)(1))=A

x^2+4x+4-x+5=A

x^2+3x+9=A

If the temperature is -3 degrees F at 10:00 p.M., and the temperature falls four degrees overnight, what is the resulting temperature?

Answers

Answer:

-7

Step-by-step explanation:

Answer:

-7

Step-by-step explanation:

Other Questions
Delta math question - EXERCISE 1 IMAGINE YOU ARE A CHILD AT SCHOOL .WRITE A DIARY ENTRY IN ABOUT 150-200 WORDS ABOUT YOUR EMOTIONS THE DAY BEFORE YOUR SCHOOL TAKES YOU TO A THEME PARK Help me pls!! (I will give brainliest) Please answer these questions and I swear I will give you brainlist I promise I will answer this question part a and part b please What is the length of the missing leg?45 and 36 [tex]\sqrt[3]{11}[/tex] Which statement best describes a difference between a molecule of DNA and a molecule of RNA? A)DNA contains genetic informationwhile RNA does not B)RNA contains the letter in place of the letter T in DNA C)DNA has 1 strand, while RNA has 2 D)RNA uses the letter C. while DNA does not Why should police be able to use peoples DNA without consent? NEED HELP WITH THESE f(x)=x^2-x+1g(x) = 5 - 3xEvaluate the following.1) f(-1)2)g( -8)3)f( 1)4) g(5)5) f(3)6) g(-3) What is Isolated system Read the sentences.I want to be in London right now. I really want to see Big Ben and Buckingham Palace.Which sentence uses the subjunctive mood to express the ideas in the sentences?Going to London to see Big Ben and Buckingham Palace is a dream of mine.Going to London to see Big Ben and Buckingham Palace is a dream of mine. , ,I will go to London right now, and I will see Big Ben and Buckingham Palace.I will go to London right now, and I will see Big Ben and Buckingham Palace. , ,If I can get to London, I will see Big Ben and Buckingham Palace.If I can get to London, I will see Big Ben and Buckingham Palace. , ,If I were in London right now, I would go see Big Ben and Buckingham Palace.If I were in London right now, I would go see Big Ben and Buckingham Palace. , , How many repeats are there for this STR? Refer to the following DNA sequence to answer the questions: CTAGAAGCTTAAAGCTTCATCATCATCATCATCATCATTTAAGCTTCAAAGCTT At one time, dinosaurs were rulers of the earth. What are the nouns? Hello, I need help in this part of chemistry, I need the chemical names of the following four:1) B and F32) Se and I23) As2 and Se3ASAP! Please,,, 25 ft 8 yd 11 in.Which is greater? NO SCAM LINKS. please reply ASAP PLEASEEEE I'LL GIVE YOU BRAINLIEST!!Which is the best definition of air pressure? *1 pointthe weight of the air pressing on everything in the environmentthe amount of precipitation in a certain areathe type of clouds in the atmospherethe amount of water vapor in the air Can I have some help with this math? Pls hurry, I will mark brainliest Evaluate the expression 4 25 . A human resources manager selected a random sample of 200 workers who donate to charity. The following table shows the distribution of the 200 workers. Count Type of worker Management Other white collar 96 50 S Blue collar 54 The manager conducts a goodness-of-fit test to determine whether the proportions of workers of these types are identical to the population proportions of workers donating to charity, which are 50 percent for management, 30 percent for other white-collar workers, and 20 percent for blue-collar workers. Which of the following statements must be true about the sample?A. The expected number of blue-collar workers donating to charity is less than 30. B. The expected number of management workers donating to charity is 100. C. The expected numbers of other white collar and blue-collar workers donating to charity are the same. D. The expected number of other white-collar workers donating to charity is 50 E. The combined expected numbers of other white collar and blue-collar workers donating to charity is greater than the expected number of management workers donating to charity. I have to find the missing angles