Answer:
neon bc neon is it PEriot and don't forget to round the atomic mass to the nearest whole number in assuming this is one ur assignments
Answer:
here are your answers :)
Explanation:
there is a decreased in the production of
Answer:
Espero sirva mi respuesta
Explanation:
Suerte
Why do animals that are active at night tend to have trouble seeing in color?
DNA is a
A. lipid
B. nucleic acid
C. carbohydrate
D. protein
Answer:
B
Explanation:
Answer:
B. nucleic acid
Explanation:
DNA is a type of Nucleic acid.
Explain the difference in How the tree and the fox get carbohydrates to use for energy
Hey Hey!
Hmm... This seems to be a simple questions. Plants/trees actually make their own carbohydrates through photosynthesis. A fox simply eats food and that is their carbohydrate source. Please mark brianliest<3!
What is the microscopic nature of a cell ?
Why nucleus is said to be the controller of cellular activities ?
How is a cell adapted to its small size?
Answer:
No 1 answer They require sophiscated tools. The microscopes help in the study of cells. The molecular study of the cells are performed by the help of electron microscope. So, we can say that cells are microscopic in nature.
Explanation:
No 2 answer The nucleus is the largest and most prominent of a cell's organelles (Figure 3.7). The nucleus is generally considered the control center of the cell because it stores all of the genetic instructions for manufacturing proteins.
No 3 answer Smaller single-celled organisms have a high surface area to volume ratio, which allows them to rely on oxygen and material diffusing into the cell (and wastes diffusing out) in order to survive. The higher the surface area to volume ratio they have, the more effective this process can be.
NO LINKS PLEASE
Why are there always more producers than consumers in an ecosystem?
O A. Plants do not carry out enough photosynthesis to supply the needed oxygen to primary consumers.
O B. The Sun cannot supply enough energy to support many predators.
O C. Energy is lost in food chains so many secondary consumers cannot be supported.
OD. Many consumers would contribute too much carbon dioxide to the carbon cycle.
Answer:
energy is lost in the food chains so many secondary consumers cannot be supported
Which molecule do mammals use to store extra glucose?
O starch
O cellulose
O myosin
O glycogen
A student lifted weights after
from school and felt his muscles
they began to burn. He couldn't continue
lifting weights after doing
exercise for a long time. Is
muscle fatigue is most likely
due to:
(1) the acceleration of the heartbeat and
exhaustion of the heart
(2) the accumulation of oxygen in the
lungs
(3) the lack of oxygen and the accumulation of
waste in muscles
(4) the lack of carbon dioxide in the
muscles
(1) the acceleration of the heartbeat and
exhaustion of the heart
(2) the accumulation of oxygen in the
lungs
(3) the lack of oxygen and the accumulation of
waste in muscles
(4) the lack of carbon dioxide in the
muscles
Answer:
lack of oxygen and accumulation of waste in the muscle
Blood type A person marries a blood type B person, both are heterozygous for the trait, what could their offspring be?
AB
B
A
O
all of the above
Answer:
All of the above
Explanation:
plant store _____ and other essential nutrients in the vacuole
Answer:
Plant store water and other essential nutrients in the vacuole.
Explanation:
Plant store water and other essential nutrients in the vacuole.
What is herbal medicine?
Herbal medicine is defined as the medicine which is acquired from the various parts of the plants such as flowers, roots, shoots, and leaves. Herbal medicine are costly in compare to normal medicine and because there production is limited and there will be no side effect of herbal medicine in compare to allopathic medicine.
The main difference between herbal medicine and allopathic medicine is that the allopathic medicine is formed from the active or particular part of the plant but in herbal medicine whole plant parts are utilised.Herbal medicine are costly in compare to normal medicine and because there production is limited and there will be no side effect of herbal medicine in compare to allopathic medicine.
Therefore,Plant store water and other essential nutrients in the vacuole.
Learn more about plant here:
https://brainly.com/question/22167412
#SPJ2
Small changes can add up over MULTIPLE GENERATIONS to make
A. the same species
B. new species
Answer:
b: new species
Explanation:
These changes are genetic mutations to their biological "code" meaning creating a new species would be possible.
Answer:
B. new species
Explanation:
Biological evolution is any change in the heritable traits within a population across generations.
which of these animals did NOT benefit from the reintroduction of wolves into Yellowstone?
a. rabbits
2. bears
3. elk
4. beavers
What are three benefits of vertical farming that provide an advantage over horizontal farming.
Answer:
Minimise water usage
Weather doesn't affect the crops
There is less exposure to chemicals and disease
Explanation:
Why do many water animals not have a well developed blood system?
The simplest animals, such as the sponges (Porifera) and rotifers (Rotifera), do not need a circulatory system because diffusion allows adequate exchange of water, nutrients, and waste, as well as dissolved gases. Instead, gases, nutrients, and wastes are exchanged by diffusion.
Answer:
Explanation:
The simplest animals, such as the sponges (Porifera) and rotifers (Rotifera), do not need a circulatory system because diffusion allows adequate exchange of water, nutrients, and waste, as well as dissolved gases. ... Instead, gases, nutrients, and wastes are exchanged by diffusion.
The Montreal Protocol of 1987 provided a global framework to phase out chlorofluorocarbon (CFC) production and use. A though the Montreal Protocol has led to a dramatic decrease in CFCs released into the atmosphere, stratospheric ozone destruction has decreased only slightly.
Answer:
True
Explanation:
Which of the following shows the stage of mitosis in the correct order?
Prophase, prometaphase, metaphase, anaphase, telophase, cytokinesis is the correct order of mitosis. Therefore, option (B) is correct.
Mitosis is a cellular process that ensures the accurate division of a cell's genetic material into two identical daughter cells. It consists of several distinct phases that occur in a specific order.
Interphase: The cell prepares for division by growing, duplicating its DNA, and synthesizing necessary proteins.
Prophase: Chromatin condenses into visible chromosomes, the nuclear membrane disintegrates, and spindle fibers form.
Metaphase: Chromosomes align at the center of the cell, known as the metaphase plate, and attach to spindle fibers at their centromeres.
Anaphase: Sister chromatids separate and are pulled to opposite ends of the cell by the spindle fibers.
Telophase: Chromosomes reach the opposite poles of the cell, and new nuclear membranes form around them. The chromosomes begin to decondense.
Cytokinesis: The cytoplasm divides, leading to the formation of two distinct daughter cells, each containing a complete set of chromosomes.
Learn more about mitosis, here:
https://brainly.com/question/31626745
#SPJ2
Anyone know the answer?
3.gender:male
disorder name:non-disjunction(when the chromosomes fail to seperate or having extra number of chromosomes)
4.gender:female
disorder:down syndrome
The
store(s) more carbon than the atmosphere.
trees
soil
Oceans
rock
The oceans store more carbon than the atmosphere. Thus, the correct option is C.
What is Atmosphere?An atmosphere may be defined as an area that is surrounded by layers of gases across a planet or other celestial body.
The oceans are a gigantic carbon sink, and the domain of the positive authorization of the greenhouse gas cycle is that, as the oceans become warmer, they tend to discharge more carbon dioxide disbanded in the water.
Therefore, the correct option for this question is C.
To learn more about Oceans, refer to the link:
https://brainly.com/question/25154137
#SPJ1
what happens to the energy that is not converted to usable energy in a muscle Cell?
Answer:
The process is called oxidative phosphorylation and it happens inside mitochondria. In the matrix of mitochondria the reactions known as the citric acid or Krebs cycle produce a chemical called NADH. NADH is then used by enzymes embedded in the mitochondrial inner membrane to generate adenosine triphosphate (ATP).
Explanation:
3) In order for an ecosystem to thrive, it needs to exist in a form of harmony and balance between its biotic and abiotic factors. Describe how small changes to both biotic and abiotic components can have major effects on an ecosystem.
Answer:
Changing temperature causes extinction or removal of organism from that place.
Explanation:
Small changes to both biotic and abiotic components can have major effects on an ecosystem because these are the factors on which the ecosystem depends. For example, if the temperature of the ecosystem increases from its limit, it makes the environment unfavourable for the organism so due to this change, the organism migrated to other location otherwise they will die due to unfavourable environment.
what is the mosquito average life's span
How does the skin regulate body temperature?
Group of answer choices
by increasing sweat production
by producing vitamin D
by retaining water
by regulating fat content in the epidermis
How does the skin regulate body temperature?
[tex]\circ \: \: { \underline{ \boxed{ \sf{ \color{green}{Answer.}}}}}∘[/tex]
A. by increasing sweat production. ✔
Explanation:-
The sweat glands present in the skin helps to cool the skin as it produces sweat.Sweat glands keeps the body temperature at approximately 37° C by releasing sweat in a hot environment or during physical exertion.[tex]\bold{ \green{ \star{ \orange{Mystique35}}}}⋆[/tex]
Does anyone know this?
Answer: The correct answer is zygote...blastocyst...embryo...fetus.
Explanation:
The zygote is the single cell that was the result of fertilization.
The blastocyst is the big ball of cells that was the result of differentiation and mitosis.
Then comes the embryo, and then finally, the fetus.
Good Luck <3
We don't know what the first life form was or how it came to be, but the process of reproduction with VARIATION over billions of years is responsible for the diversity of life on Earth today.
A. True
B. False
Answer:
A. True
Explanation:
Yeah, we don't know what the first life form was or how it came to be, but the process of reproduction with VARIATION over billions of years is responsible for the diversity of life on Earth today.
The arrows in a food chain show: a Who eats who b Heat energy being lost c The movement of energy between organisms d The route of food to the shops
Answer:
c The movement of energy between organisms
Explanation:
Pyramid of energy is a model used to depict the flow of energy from one trophic level or feeding level to the next in an ecosystem. It's a diagram that compares the energy used by organisms at each trophic level of the food chain. The pyramid of energy must never be inverted or turned upside down.
The units used in the construction of pyramids of energy is kilocalories (kcal) or energy per area per time (Jm-²year-¹).
This ultimately implies that, the arrows in a food chain show the movement of energy between organisms such as from producers which are autotrophs or self-feeders such as plants to the tertiary consumers.
Furthermore, a list of the types of organisms in an eco pyramid are;
I. Producers: these are autotrophs or self-feeders such as plants.
II. Primary consumers: these are herbivores that typically feed on plants such as a goat or deer.
III. Secondary consumers: these consists of carnivores that typically feed or eat flesh such as lion, tiger, cheetah, etc.
IV. Tertiary consumers: these are higher predators such as humans that aren't normally fed on by other organisms in the ecosystem.
Answer: The arrows in a food chain show (The movement of energy between organisms). The correct option is C.
Explanation:
In an ecosystem, a food chain shows the transfer of energy and nutrients ( food) from organisms to organisms in a feeding pathway. Instead of giving functional group names such as primary producer, primary consumer and so on, in a good chain, the organism at each step is identified. Thus,
Grass-------> Zebra ---------> lion
(Primary (Primary ( secondary
producer). consumer) consumer)
this is an example of a simple food chain in a grassland ecosystem. This ARROWS represented above shows the direction of energy flow through an ecosystem.
Furthermore, the grass traps solar energy and stores it as chemical energy in the food made during photosynthesis. When eaten by Zebra, which is the primary consumer, the energy stored in the grass is transferred to the consumer. This transfer is inefficient as some of the stored chemical energy is lost as heat. When the zebra is eaten by a Lion,which is the secondary consumer.
what scientific term is used to describe all the genes of one organism?
Answer:
The scientific term used to describe all of the genes in an organsim is the genome.
Genome term is used to describe all the genes of one organism, it forms the genotype of an organism.
What is a genome?the entirety of an organism's genetic makeup, or DNA. Nearly every cell in a person's body has a complete copy of its genome. Everything a person needs to grow and develop is encoded in their genome.
Each and every one of the body's cells, such as the skin cell or the liver cell, carries the following set of instructions: DNA makes up the instructions in our genome.
The genome's main job is to preserve, express, and store the genetic material that gives rise to a cell's structural and functional machinery. The genome is a significant part of the cell's structural makeup, nevertheless. Hence, the Genome term is used to describe all the genes of one organism.
Learn more about the genome, here:
https://brainly.com/question/29362762
#SPJ6
(a) Describe why DNA replication is said to be a semiconservative process. Explain how random mutations such as those in pathogens with a mutator phenotype may arise in the DNA of an organism.
Explanation:
yan po sana makatulong po
sainyo
if the mass extinction event that had wiped out the dinosaurs had not occurred, could dinosaurs rather than mammals have evolved into an intelligent organism resembling modern day humans ?
Answer:
If the mass extinction even that had wiped out the dinosaurs had not occurred, dinosaurs would've evolved. Though maybe not into organisms that resemble modern-day humans, they would've become better versions of themself. However, some of them might've died out naturally due to climate change and other natural disasters.
If the mass extinction event had wiped out the dinosaurs and not occurred. The dinosaurs would not have been converted into an intelligent organism like humans, because evolution may be bad or good, nothing is always evolution that results in good traits.
What are dinosaurs?Dinosaurs are extinct reptiles, that were very big, and they were both herbivorous and carnivorous. These animals were present 56 million years ago. They got extinct because of an unknown reason, but scientists say that they got extinct due to the falling of meteorites.
If dinosaurs had not been extinct, they would be evolved according to the changes in the environment. They would not be converted into human intelligence.
Therefore, since evolution can be either positive or negative, there is no guarantee that it will always produce positive features in organisms, the dinosaurs would not have evolved into sophisticated beings like humans.
To learn more about dinosaurs, refer to the link:
https://brainly.com/question/15973044
#SPJ5
11. When cold temperatures are produced in a chemical reaction, the reaction is
known as
a. exothermic.
b. endothermic.
c. suspension
Answer:
it's known as endothermic reaction
the tRNA for GUCAUCGAUCGAUCGGAUGCC
Answer:
CAGUAGCUGCUAGCCUACGG
Explanation:
A and U are opposites
C and G are opposites
so you would do the opposite that would correspond.
