Four students simplify the expression below: 6 + 4 x 10 ÷ 2 Anshu's solution is 25 , David's solution is 46 , Jimmy's solution is 26 and Lahari's solution is 16 . Show who simplified the expression correctly?

Answers

Answer 1

Answer:

Jimmy; 26

Step-by-step explanation:

PEMDAS

Parentheses Exponents Multiplication Division Addition Subtraction

6 + 4 * 10 / 2 = 6 + 40 / 2

6 + 40 / 2 = 6 + 20

6 + 20 = 26

26


Related Questions

help me to do this please ​

Answers

Answer:

a)  (10×13) + 55 b) 185 Nu c)-75 or -205 (unsure of instruction)

Step-by-step explanation:

a) He spends 10 Nu a day for 13 days, meaning he has spent 10×13 Nu. He originally had this amount, plus the 55 he ends up with. This means he began with (10×13) + 55.

b) This can then be solved using BODMAS (or PEMDAS, whatever you call the order of operations).

We begin with the multiplication, which turns the expression to 130+55. We then move to addition, giving a final result of 185.

c) For this one, I'm not sure if it is if he did that from the beginning or from now, so I've done both.

If it's from the beginning, you would use 185-(20×13) to solve this. This gives 185-260, which solves to -75.

If it's from the point of 55 Nu, you would use 55-(20×13), which gives 55-260. This solves to -205.

**You may wish to revise writing integer expressions. I'm always happy to help!

A line has a slope of -8 and includes the points (-10, 0) and (-9, z). What is the value of Z?

Answers

Answer:

Step-by-step explanation:

Let L be the given line, then, with a slope of -8

L :  y = -8x + b

where b is to be determined from the included point A(-10,0).

Substitute point A in L to get

0 = -8 (-10) + b

solve to get

b = -80

therefore

L : y = -8x -80

Now substitute B(-9,z) in L

z = -8(-9) - 80 = -8

two thirds take away one half

Answers

Answer:

0.16666666666 is the answer of two thirds take away one half.

1/1 because your taking away 2/3-1/2

Hey, could you help me? Thank you

Answers

Answer:

Step-by-step explanation:

you see 12=12 (side)

6=6 (side)

116°=116°(angle between sides)

now what can be the answer?

two sides and one angle equal

so SAS

ANSWER PLZ WILL MARK BRAINLIEST!!!!!!

Answers

Answer:

3x^2

Step-by-step explanation:

What is the radius of a sphere with a volume of 28526 in 3 , 28526 in 3 , to the nearest tenth of an inch?

Answers

Answer:

19.0 in

Step-by-step explanation:

From the question given above, the following data were:

Volume (V) of sphere = 28526 in³

Pi (π) = 3.14

Radius (r) =?

The radius of the sphere can be obtained as follow:

V = 4/3 πr³

28526 = 4/3 × 3.14 r³

28526 = 12.56r³ / 3

Cross multiply

12.56r³ = 28526 × 3

12.56r³ = 85578

Divide both side by 12.56

r³ = 85578 / 12.56

Take the cube root of both side

r = ³√(85578 / 12.56)

r = 19.0 in

Thus, the radius of the sphere is 19.0 in

On George's block, the ratio of cars to houses is 8 to 5. There are 32 cars, how many houses are there?

Answers

Answer:

Step-by-step explanation:

20 houses

Answer:

20

Step-by-step explanation:

You would set it up as 8:5=32:x. Since you are multiplying the number of cars by 4, you should do the same with houses. This gives 32:20, meaning there are 20 houses on the block.

**You may want to revise multiplying and dividing with ratios. I'm always happy to help!

ILL GIVE YOU BRAINLIEST IF ANSWERED RIGHT!!!! If the quadratic equation has the form y = ax ^2and y = ax ^2+ c, then their axis of symmetry must always be?

Answers

Answer:

x = 0

Step-by-step explanation:

The axis of the symmetry has the same x coordinate of the vertex

V (x) = -b/2a

in both equations b is equal to 0 and a 0/a number different from 0 gives always 0 as a result

What is the square unit of this figure?

Answers

Answer:

58

Step-by-step explanation:

Area = Area of entire recangle - area of cut out

a = (10 * 7) - (6 * 2)

a = 70 - 12

a = 58

Please help find the diagonal distance thank you

Answers

Answer:

[tex]\huge\boxed{c=17\ ft}[/tex]

Step-by-step explanation:

Use the Pythagorean theorem:

[tex]leg^2+leg^2=hypotenuse^2[/tex]

We have:

[tex]leg=15ft\\leg=8ft\\hypotenuse=c[/tex]

Substitute:

[tex]c^2=15^2+8^2\\\\c^2=225+64\\\\c^2=289\to c=\sqrt{289}\to c=17(ft)[/tex]

What is the length of leg s of the triangle below?
45
3
1072
90°
45
$

Answers

Can you please repost with the image?

The length of the leg is 9.

What is the Pythagorean theorem?

Pythagorean theorem states that for a right triangle, the square of the hypotenuse is equal to the sum of the squares of the other two sides.

We can apply this theorem only in a right triangle.

Example:

The hypotenuse side of a triangle with the two sides as 4 cm and 3 cm.

Hypotenuse side = √(4² + 3²) = √(16 + 9) = √25 = 5 cm

We have,

From the triangle,

S = length of the leg.

Now,

Applying the Pythagorean theorem.

√18² = 3² + s²

18 = 9 + s²

s² = 18 - 9

s² = 9

s = 9

Thus,

The length of the leg is 9.

Learn more about the Pythagorean theorem here:

https://brainly.com/question/14930619

#SPJ7

A rectangular football field is 64 meters wide and 100 maters long. A player runs from one corner of the field in a diagonal line to the opposite corner. How far did the player run?

Answers

Answer:

119 or 118.726577

Step-by-step explanation:

We should use the Pythagorean Theorem to solve this problem.

a^2+ b^2=c^2

64^2+100^2=c^2

4096+10000=14096

c^2=14096

c=\sqrt{14096}14096

And the root of 14096 is 118.726577.

So the Answer is About 119 meters, or 118.726577

hope this helps!

A bag contains 4 red marbles, 8 blue marbles and 2 green marbles. If two marbles are drawn out of the bag, what is the exact probability that both marbles drawn will be red?

Answers

1/7 is the answer to your question

Please help me ASAP tysm

Answers

C. Mandy made 4 bows with 2/3 yard left

Tina has a greenhouse in which she grows strawberries. The sprinkler system in the greenhouse sprays a fine mist to ensure the strawberries get enough water. The strawberries are watered for a total of 2 hours and 45 minutes every day and the temperature in the greenhouse is kept constant at 25 °C. The clock below shows the time each morning when the sprinkler system is switched off

Answers

Answer:

a) 9:11 am

b) 77°F

Step-by-step explanation:

a) From the clock shown in the image attached, we can see that the time that the sprinkler system is switched off is at 11:56 am. Since the strawberries are watered for a total of 2 hours and 45 minutes every day, the time that the sprinkler is switched on can be gotten by subtracting 2 hours 45 minutes from 11:56 am. Hence:

Time sprinkler system is switched on = 11:56 am - 2 hours 45 minutes = 9:11 am

b) Temperature in °Farenheit = (1.8 * temperature in degree Celsius) + 32°

Temperature in °Farenheit = (1.8 * 25°) + 32° = 45° + 32°

Temperature in °Farenheit = 77°F

Which set of numbers is included as part of the solution set of the compound inequality
x < 6 orx > 10?

Answers

Complete question is;

Which set of numbers is included as part of the solution set of the compound inequality

x < 6 or x > 10?

A) {–7, –1.7, 6.1, 10}

B) {–3, 4.5, 13.6, 19}

C) {0, 6, 9.8, 14}

D) {8.5, 9.1}

Answer:

B) {–3, 4.5, 13.6, 19}

Step-by-step explanation:

The given compound inequality x < 6 or x > 10 means that x must be less than 6 and greater than 10. And also that x cannot fall between 6 and 10.

Looking at the given options, the only set of values that fall into this compound inequality range is option B.

please may I get help please
whish way should I use ​

Answers

Answer: B.

Step-by-step explanation:

Data: Estimate of 7.21x3.86/10.09=x

Only step, Find the estimate for each number(7.21=7, 3.86=4, 10.09=10)

Explanation: How estimation work is that it numbers below 5 stays the same and numbers 5 and above round up so a number like 7.21 which has 2 and 1 as it's rounding numbers will stay the same however a number like 3.86 which has 8 and 6 as it's rounding numbers will round up

That's how we arrive at the answer of B.

I hope this helps(Mark brainliest if you'd like)

7X^2+20x=24
X=?
Please answer to 2 d.p

Answers

Answer:

0.76

or

-0.76

hope this helps

what percentage of this 100 square grid is shaded. PLease i will mark your brainlist

Answers

I may think is 18. Hope this helps.

Mario can eat 21 hot dogs in 6 minutes. At the same place, how many minutes would it take him to eat 35 hot dogs? ​

Answers

Answer:

10 minutes

Step-by-step explanation:

Mario can eat e21 hot dog in 6 minutes

Let 35 hot dog  eats in x minutes :

[tex]\frac{35}{x} =\frac{21}{6} \\x=\frac{35(6)}{21} \\x=10 min[/tex]

Therefore, mario would eat 35 dogs in 10 min.

Informal settlers who live nearby coastal areas and river side throw away about 4 million disposable diapers per year. how many diapers are thrown away each month??.


need help ༼ つ ◕_◕ ༽つ

Answers

Answer:

333,333 Three hundred and thirty-three thousand , three hundred and thirty-three

Step-by-step explanation:

4000000/12

A Jar contains five red marbles and three green marble. A marble is drawn at random and not replaced. A second marble is
then drawn form the jar

find the probability that both marbles are red

Answers

Answer:

20/56 or 5/14

Step-by-step explanation:

Prob of red = 5/8

Second red prob = 4/7

multiply those = 20/56

simplify if needed = 5/14

The value of the expression StartFraction 2 x squared Over x EndFraction plus x (100 minus 15 x) when x = 5 is.

Answers

Answer:

C. 135

Step-by-step explanation:

The value of the expression when x = 5 is 135.To find the value of the expression when x = 5, substitute the value of x into the expression and perform the calculations:

Expression: [tex](2x^2 / x) + x(100 - 15x)[/tex]

Now, replace x with 5:

[tex](2 * 5^2 / 5) + 5(100 - 15 * 5)[/tex]

Calculate the values within the parentheses first:

[tex](2 * 25 / 5) + 5(100 - 75)[/tex]

Now, perform the arithmetic inside each set of parentheses:

[tex](50 / 5) + 5(25)\\50 / 5 = 10[/tex]

Now, continue:

10 + 5 * 25 = 10 + 125 = 135

So, the value of the expression when x = 5 is 135.

To know more about expression :

https://brainly.com/question/34132400

#SPJ2

Simplify n - {1 - [n - (1 - n) - 1]}

Answers

Answer:

3n - 3

Step-by-step explanation:

Answer:

3n-3

Step-by-step explanation:

n-1(1-n)-1 = n- 1 + n - 1 = 2n-2

1 - (2n-2) = 1 - 2n + 2

n - (1 - 2n + 2) = n - 1 + 2n -2 which equals 3n - 3

If f(x) = x2 – 1, and
g(x) = x + 2, then
f(g(x)) = [ ? ]x2+[ ]x+]

Answers

Answer:

f(g(x)) = x^2+4x+3

Step-by-step explanation:

f(x) = x^2 – 1

g(x) = x + 2

f(g(x))=g(x)^2-1=(x+2)^2-1=x^2+4x+4-1=x^2+4x+3

how to get the interval?

Answers

Step-by-step explanation:

Decide on the number of classes.

Determine the range, i.e., the difference between the highest and lowest observations in the data.

Divide range by the number of classes to estimate approximate size of the interval

hope it helps.

stay safe healthy and happy...

Which describes 9 and -9?

Answers

What error!!!!! Bbbbbbb

Answer:

opposite of each other

Hope this helps!

if x=8 and y=-3 evaluate 7(2x-3y)

Answers

Answer:

175

Step-by-step explanation:

7(2x-3y)

Let x = 8 and y = -3

7(2*8-3 (-3))

Inside parentheses first

7(16+9)

Add inside the parentheses

7(25)

Multiply

175

Given tan t = 2/3 and that pi <= t <= 3pi/2. Find exact value for each of the following:

a) sec t
b) cos t
c) sin t
d) csc t
e) cot t

Answers

well, first off let's notice something about angle "t", is between π and 3π/2, or namely the III Quadrant, where both "x" or adjacent side as well as "y" or opposite side are negative.

something else noteworthy is that, the hypotenuse is just a radius length and thus is never negative.

[tex]tan(t)=\cfrac{2}{3}\implies tan(t)=\cfrac{\stackrel{opposite}{-2}}{\underset{adjacent}{-3}}\qquad \textit{let's find the hypotenuse} \\\\\\ \textit{using the pythagorean theorem} \\\\ c^2=a^2+b^2\implies c =\sqrt{a^2+b^2} \qquad \begin{cases} c=hypotenuse\\ a=adjacent\\ b=opposite\\ \end{cases} \\\\\\ c=\sqrt{(-3)^2+(-2)^2}\implies c = \sqrt{9+4}\implies c = \sqrt{13}[/tex]

[tex]\rule{34em}{0.25pt}\\\\ sec(t)=\cfrac{\stackrel{hypotenuse}{\sqrt{13}}}{\underset{adjacent}{-3}}~\hfill cos(t)=\cfrac{\stackrel{adjacent}{-3}}{\underset{hypotenuse}{\sqrt{13}}}\implies \cfrac{-3\cdot \sqrt{13}}{\sqrt{13}\cdot \sqrt{13}}\implies \cfrac{-3\sqrt{3}}{13}[/tex]

[tex]sin(t)=\cfrac{\stackrel{opposite}{-2}}{\underset{hypotenuse}{\sqrt{13}}}\implies \cfrac{-2\cdot \sqrt{13}}{\sqrt{13}\cdot \sqrt{13}}\implies \cfrac{-2\sqrt{13}}{13} \\\\\\ csc(t)=\cfrac{\stackrel{hypotenuse}{\sqrt{13}}}{\underset{opposite}{-2}}~\hfill cot=\cfrac{\stackrel{adjacent}{-3}}{\underset{opposite}{-2}}\implies \cfrac{3}{2}[/tex]

C sin bc I just know it

A household aquarium tank in the shape of a rectangular prism has a base length of 242424 inches (\text{in})(in)(, start text, i, n, end text, )and a base width of 15\,\text{in}15in15, start text, i, n, end text. The height of the water is 12\,\text{in}12in12, start text, i, n, end text above the base. During cleaning, 900900900 cubic inches of water is removed. What is the absolute value of the change in the height of the water in inches

Answers

Answer:

The absolute change in the height of the water is 9.5 inches

Step-by-step explanation:

Given

[tex]l =24in[/tex] --- length

[tex]w = 15in[/tex] --- width

[tex]h =12in[/tex] --- height

[tex]V_1 = 900in^3[/tex] --- the volume removed

Required

The absolute change in the height of the water

First, calculate the base area (b):

[tex]b = l * w[/tex]

[tex]b =24in * 15in[/tex]

[tex]b =360in^2[/tex]

The height of the water that was removed is:

[tex]H = \frac{V_1}{b}[/tex] i.e. the volume of the water removed divided by the base area

[tex]H = \frac{900in^3}{360in^2}[/tex]

[tex]H = \frac{900in}{360}[/tex]

[tex]H = 2.5in[/tex]

The absolute change in height is:

[tex]\triangle H = |h - H|[/tex]

[tex]\triangle H = |12in - 2.5in|[/tex]

[tex]\triangle H = |9.5in|[/tex]

[tex]\triangle H = 9.5in[/tex]

Other Questions
The use of symbols such as charts, graphs, and signs are best classified as* 1 point oral communication written communication visual communication audio visual communication how to solve the chemical formula for Calcium Chlorate Joelle is a manager at a construction company, and she is interested in the chemistry behind the materials they use. She has begun studying the materials used to fill walls. She knows that to keep the temperature inside a room steady the material must be a thermal insulator, and she predicts that materials should not be acidic or else they would dissolve too easily in water.Which of these is a molecular ingredient that could be used in a wall-filling material ?C27H36N2O10Na6Ba6NeNaHCl Please help me with this I need it bad Which line from "I'm Nobody! Who Are You? by Emily Dickinson contains a sime?"Then there's a pair of usdon't tell"They d banish us you know.""How public. like a frogTo tell your name the livelong day" In young Goodmans Brown hawthornes reveals his feelings about his Puritan ancestors when Which is the definition of chronology? Please help, only a couple of days left!!! Translate and solve: twenty-three greater than b is at least 276. Solve the inequality.1x+5 < 62Help me please Qu funcin cumple la poltica en los conflictos sociales Say you had the following DNA sequence: ATGCTGCGAAACTTTGGCTGA Let's say there was a mutation that removed one letter (the first C): ATGCTGCGAAACTTTGGCTGA Provide the 6 DNA codons that would be read following the mutation. Are they the same as the original 6 DNA codons that would have been read 1.Name the canan that connects the Red sea to the Mediterranean Sea2.Name the country where coffee was discovered3.Name the system of racial segregation seen in South Africa4What is the term given to the peninsula that forms the easternmost projection of the African continent5Name the precious gem that is the major natural resource of Africa6Name the Savannah region that is the site of the largest mammal migration on Earth A digital signal differs from an analog signal because it a.consists of a current that changes smoothly. b. consists of a current that changes in pulses. c.carries information. d. is used in electronic devices. Write an equation for the line that is parallel to the given line and that passes through the given point. y = 1/2x - 8; (-6, -17). Find the equation of the line that passes through the points A (2, 3) and B (5, -7) how did advancements in technologry help bring a quick end to conflict in the pacific during world war II My School in vanacola Write 8 as a percentage of 32Plssss helppp A senator introduces a bill by taking it to the president pro tempore, the majority leader, and the minority leader.TrueFalse****If a bill cannot be voted on due to the lack of members present, it is unlikely that the bill will make it to the House floor.True***False