HELP ASAP WILL GIVE BRAINLIEST

how much money does the united states lose each year due to the non-local resource trade deficit?

A.) 10 million
B.) 500 million
C.) 1 billion
D.) 300 billion
E.) 1 trillion

Answers

Answer 1

Answer: D

Explanation: A trade deficit occurs when a nation imports more than it exports. For instance, in 2018 the United States exported $2.500 trillion in goods and services while it imported $3.121 trillion, leaving a trade deficit of $621 billion. Services, such as tourism, intellectual property, and finance, make up roughly one-third of exports, while major goods exported include aircraft, medical equipment, refined petroleum, and agricultural commodities.

Answer 2

The United States of America looses this amount of money annually due to the non-local resource trade deficit: D. 300 billion.

What is trade deficit?

Trade deficit canbe defined as the amount of money by which the cost of a imports in a particular country exceeds the value of its exports. This ultimately implies that, a trade deficit occurs when the imports in a country is greater than exports within a given time period.

In the United States of America, 300 billion dollars are lost on a yearly basis or annually due to the non-local resource trade deficit.

Read more on trade deficit here: https://brainly.com/question/24473707


Related Questions

How has the introduction of the automobile and, subsequently, the highway begun to fundamentally change the way cities are designed and function?

Answers

Answer:

The introduction of the automobile and, subsequently, the highway begun to fundamentally change the way cities are designed and function because these technological advances have allowed citizens to travel greater distances in less time: before the automobile, the horse was used to get around, which travels distances at about 30 kilometers per hour on average, and needs to rest after long stretches. Today, the car travels at average speeds of about 60 kilometers per hour and does not need breaks, other than the logical routine mechanical conditioning.

Thus, cities have been able to begin to expand horizontally, enlarging their contours because people no longer necessarily need to live near their centers, thanks to the mobility facilities that exist today.

The firm's total cost after the rent increase is $2,000, and its new total fixed cost is $1,600. It is producing 20 units of output. Calculate the firm's average variable cost. Show your work.

Answers

Answer:

its adding 400 to 1600

Explanation:

how have social categories, roles, and practices have changed since 1900?

Answers

Answer:There have been many different social hierarchies over the ages. In India there was the caste system which came from traditional Hindu beliefs. They believed that it was impossible to change your caste and you job and role in society was based off of your caste and Jati which was a section within the caste. In Sparta, the soldiers were at the top right under the generals and elders. This was because of the importance and value placed on the military and fighting men. At the beginning of the founding of Sparta, there was a slave revolt and the Spartans vowed it would never happen again, so they took their military to the next level so that the slaves could never revolt again.

Explanation:

why does victor frankenstein decide to make the monster so big? “eight feet high and proportionately large"

Answers

Answer:

Because it is easier to work at a larger scale

Explanation:

Which of the following perspectives emphasizes that social class is based on
authority?

Answers

Answer:

These three theoretical orientations are: Structural Functionalism, Symbolic Interactionism, and Conflict Perspective.

Explanation:

Is force the same as power

Answers

Answer:

depends on what you mean by force and power, they both have multiple definitions

Identify the type of genre:

Sunlight had sneaked in through the window and was creeping toward the chair where my pants dangled. I was lying in
bed, rubbing some gunk from the corner of my eye. It must have collected while I was sleeping, and to just let it stay there
seemed inappropriate.

A.)Fiction
B.)Mystery
C.)Poetry
D.)Nonfiction

Answers

Answer:

A.) Fiction

Explanation:

The correct option is - A.) Fiction

Why are animals in agriculture more vulnerable to outbreaks of disease than
animals in the wild?
A
Animals in captivity are generally not as healthy.
B
Farmers often do not take proper precautions to keep livestock safe.
Animals in agriculture are concentrated in a small space.
D
Animals in agriculture are deliberately bred.

B

Answers

Answer:

Traditional food systems such as bushmeat and backyard farming increase the risks of disease transmission from wild animals, while intensive farming amplifies the impact of the disease due to the high density, genetic proximity, increased immunodeficiency, and live transport of farmed animals.

EXPLAIN how the variety of where your food and items come from reflect the concept of international division of labor?

Answers

Answer In economics, the new international division of labour (NIDL) is an outcome of globalization. The term was coined by theorists seeking to explain the spatial shift of manufacturing industries from advanced capitalist countries to developing countries—an ongoing geographic reorganisation of production, which finds its origins in ideas about a global division of labor. It is a spatial division of labor which occurs when the process of production is no longer confined to national economies. Under the "old" international division of labor, until around 1970, underdeveloped areas were incorporated into the world economy principally as suppliers of minerals and agricultural commodities. However, as developing economies are merged into the world economy, more production takes place in these economies.

Write a summary of the following excerpt from “Why I Wrote 'The Yellow Wallpaper" by Charlotte Perkins
Gilman.
For many years I suffered from a severe and continuous nervous breakdown tending to melancholia--and beyond
During about the third year of this trouble I went, in devout faith and some faint stir of hope, to a noted specialist in
nervous diseases, the best known in the country. This wise man put me to bed and applied the rest cure, to which
a still-good physique responded so promptly that he concluded there was nothing much the matter with me, and
sent me home with solemn advice to "live as domestic a life as far as possible," to "have but two hours' intellectual
life a day," and "never to touch pen, brush, or pencil again" as long as I lived. This was in 1887

Answers

Answer:

Gilman felt very melancholy and was having a severe nervous breakdown. This mental state was maintained for three years, which made her look for a specialist in nervous diseases, who would examine her and help her to heal. The specialist stated that she did not have any serious illness, but that she needed to rest as long as she lived to be cured.

Explanation:

To make a summary of a text, you must rewrite the text in a reduced form, pointing out only the most important elements of the story. Therefore, anyone who reads the summary is able to understand the most important and relevant parts of the original text, even if they do not have many details of how it happened, since the details are presented only in the original text.

In a different experiment, NH 3gas and HCl gas are introduced into an empty 1.00 L vessel at 25°C. The initial partial pressure of each gas is 0.500 atm. Calculate the number of moles of solid NH 4 C that is present when equilibrium is established.

Answers

https://reimerapchem.weebly.com/uploads/9/5/2/8/9528809/ch15_frqs_2012.pdf

that’s the whole page of answer please don’t report me until you look it up and see it’s real

EASY 100 PTS! THIS IS A TWO PART PROBLEM NOT MULTIPLE CHOICE

The distribution of the number of children per family in the United States is strongly skewed right with a mean of 2.5 children per family and a standard deviation of 1.3 children per family.

a) Without doing any calculations, which event is more likely? Explain.
Event A: Randomly selecting a family from the United States that has 3 or more children.
Event B: Randomly selecting 40 families from the United States and finding an average of 3 or more children.

b) The probability of one of the two events listed in part (a) can be calculated even though the distribution of the population is strongly skewed right. For which event can the probability be calculated? Explain.

c) Calculate the probability of the event that you selected in part (b).

Answers

Answer:

a) Event B

b) Event B

c) 0.649733

Explanation:

why do people have a problem with people having sex

Answers

Answer:

it can be irasoponsible if there not safe

Explanation:

they could end up with an std or an inwanted baby

Answer:

Thats one of the top few mysteries we never know

Explanation:

1) Bermuda Triangle

2) Y..o.u.Tube recommendations  

3) Amelia Earheart missing

4) How the earth was made

5) Problem with people having sex

ECONOMICS

The graph shows the price of a good compared to the quantity demanded.

A graph titled Demand for Microwave Ovens has quantity demanded on the x-axis, from 0 to 50 in increments of 5, and price in dollars on the y-axis, from 0 to 70 in increments of 10. A line with negative slope contains 2 points. Point (D 1, P 1) is at (15, 50), and point (D 2, P 2) is at (20, 30).

This graph demonstrates how

the amount produced slightly changes with the price.
the amount produced greatly changes with the price.
the quantity demanded changes slightly with the price.
the quantity demanded changes greatly with the price.

Answers

Answer:

the quantity demanded changes slightly with the price.

Explanation:

As was shown in the chart title, we can see that the chart will present the demand for microwave oven and what is the relationship between this demand and the price of the product, since the amount of demand is in the x axis and the amount of the price is on the axis y. As we can see, the graph has a negative slope, which links the values of demand and price in an inversely proportional way. This shows that the amount of demand changes slightly with the price, and as the price increases, demand decreases.

From the graph, we can see that the quantity demanded changes slightly with the price.

What is demand and supply?

Demand and supply is the relationship in economics that shows the connection between the quantity of goods to be sold and the consumer's willingness to buy. This relationship is expressed in this graph.

From the graph, we can see that the quantity demanded changes slightly with the price.

Learn more about demand and supply: https://brainly.com/question/13353440

Some people in an office building are experiencing nausea and vomiting,
Which of these strategies would not help reduce the pollutants that may be responsible for these symptoms?
A) providing smoking workers with an area where they can smoke
B) cleaning the ventilation system of the building
C) cleaning areas in the building that may have biological irritants
D) changing the insulation material used in the building
E) finding sources of heavy-metals pollution and developing a plan to decrease their effect

Answers

Answer:

I think it would be A but I am not 100% sure

In the workplace, it is important to listen to others’ opinions, communicate effectively, and lend a helping hand when needed. These are
.

Answers


-teamwork skills
-leadership skills
-goal-setting skills

Answer:

teamwork skills

Explanation:

The United States emerged as the world's sole superpower at the end of the Cold War. TrueFalse

Answers

the answer is true

could i get brainiest?

WILL GIVE BRAINLIEST!

the global energy policy aims to _______.

A.) reduce the cost of using fossil fuels
B.) minimize dependence on fossil fuels
C.) increase domestic consumption of fossil fuels
D.) shift focus to the use of fossil fuels
E.) shift focus from the use of sustainable energy sources

Answers

Answer:

reduce the cost of using fossil fuels

Answer:

B

Explanation:

 

minimize dependence on fossil fuels

A form of behavior therapy that is generally done in three steps as a way to reduce fear and anxiety is referred to as _________.
A.
aversion therapy
B.
systematic desensitization
C.
cognitive therapy
D.
rational-emotive behavior therapy

Answers

Answer:

C. cognitive therapy

Explanation:

A form of behavior therapy that is generally done in three steps as a way to reduce fear and anxiety is referred to as cognitive therapy .

The part of the behavior therapy that has been involved in dealing with fear and anxiety is systematic desensitization. Thus, option B is correct.

What is a behavior therapy?

The physiological therapy that has been used to treat the mental disorder such as fear, stress, anxiety, depression, and others is termed as the behavioral therapy.

The therapy can be performed in three steps, with the step that has been involved in the dealing with fear by exposure to the stimulus that leads to the reduction in the anxiety is termed as systematic desensitization. Thus, option B is correct.

Learn more about behavior therapy, here:

https://brainly.com/question/13756734

#SPJ2

The writer wants to reduce ambiguity in sentence 6 (reproduced below) by changing the placement of the underlined text, adjusting punctuation and capitalization as needed.

Perhaps not surprisingly, when they resemble humans or animals, people readily bond with robots.

Which of the following is the most logical placement for the underlined text?

A. Before “Perhaps”

B. After “people”

C. After “readily”

D. After “bond”

E. After “robots”

Answers

Answer:

E. After “robots”

Explanation:

Answer E

Correct. The underlined text is a modifying phrase that describes the word “robots.” By placing the phrase directly after the word it modifies, the writer can reduce ambiguity in the sentence. This choice makes it clear that the modifying phrase refers to robots, not people.

Answer:

E

Explanation:

After "robots" because it makes complete sense.

Hazel schedules the work of several different departments in a factory and makes sure they stay on schedule. Her job
title is best described as
Renita hand packages delicate items for shipping. Her job title is best described as
Prince buys materials for a plant that manufactures cars. His job title is best described as
Mason operates equipment to package products for shipping. His job title is best described as
5) Intro
Done

Answers

Answer:

Production and planning clerk

Packer or package, hand

Purchasing agent

Packaging machine operator

Explanation:

Answer:

A, C, A, C

Explanation:

on edge 2021

In sentence 15 (reproduced below), the writer wants to maintain credibility with the audience by using unbiased language.

Children are incredibly gullible when it comes to robots, as a recent study demonstrates.

Which of the following versions of the underlined text best accomplishes this goal?

A. (as it is now)

B. often the victims of robotic deception

C. particularly susceptible to robotic influence

D. so naive that they believe whatever robots tell them

E. not clever enough to outsmart robots

Answers

Answer:

C. particularly susceptible to robotic influence

Explanation:

Answer C

Correct. This version of the underlined text allows the writer to maintain credibility with the audience by using unbiased language. The writer effectively replaces the biased language in the original text with neutral, objective language that still conveys the writer’s message about children’s susceptibility to robotic influence.

Answer:

C

Explanation:

got it correct on progress check MCQ

An attitude that is considered strong is likely to _______

A. have a great effect on behavior
B. be easily subject to change
C. come to mind with difficulty
D. have been caused by peripheral persuasion

its a

Answers

Answer:

★  An attitude that is considered strong is likely to have a great effect on behavior

Explanation:

Hope you have a great day :)

An attitude that is considered strong is most likely to: A. have a great effect on behavior.

What is behavior?

A behavior simply refers to the unique characteristics or qualities that typically describes (depicts) how an individual conduct himself or herself, especially towards others and in certain circumstances.

In Psychology, a strong attitude which is exhibited by an individual is most likely to have a great effect on his or her behavior.

Read more on behavior here: brainly.com/question/988424

#SPJ2

The side of a cube is decreasing at a rate of 9 millimeters per minute.
At a certain instant, the side is 19 millimeters.
What is the rate of change of the volume of the cube at that instant (in cubic millimeters per minute)?

Answers

Answer:

the  rate of change of the volume of the cube is  -9747 cubic millimeters per minute

Explanation:

The computation of the rate of change of the volume of the cube is given below:

As we know that

The volume of the cube is x^3

Now differentiate it with time t

So

dV÷ dt = 3x^2 dx ÷ dt

Now put the values

= 3(19)^2  (-9)

= -9747 cubic millimeters per minute

hence, the  rate of change of the volume of the cube is  -9747 cubic millimeters per minute

Did we invent math or did we discover it?
Have an Amazing Day!!

Answers

Answer: oh um i think we invented it but also we discovered it too because it the early days people had to count something so i think we discovered it and like made it better

_DD

Explanation:

have an awesome day

Any tips on how to stay focused and get your homework done on time? I have been struggling with it lately.

Answers

Answer:

Factors that can help you get your homework done on time include;

1. Time Management

2. Avoiding procrastination

Explanation:

To remain focused and get school activities done on time, it is vital that a student develops certain skills that will not just prove useful in school, but when he begins working as an employee in an organization. Some of these skills include;

1. Time management: This entails proper usage of the limited time we have in a day. A student should know that it may not be possible to complete both school and personal work within a short time. Therefore, only what is very important must be done first before the others follow. Activities must be scheduled in their order of importance.

2. Avoiding procrastination: Some people have the habit of postponing important matters to a later time. This is wrong. To avoid having a pile of school work, they must be attended to as they come to avoid a buildup of materials that will be more difficult and tiring to work on.

If you apply these tips, you will get better at your studies. I wish you success with that.

he 13th, 14th, and 15th Amendments can best be seen as effects of the Civil War because they
A
granted rights to African Americans.
B
increased hourly wages for all workers.
C
opened up free lands in the West for settlers.
D
granted women the right to vote.

Answers

Answer:

A

Explanation:

13th abolishes slavery

14th grants citizenship to all born or naturalized in the US; including former slaves

15th prohibits disenfranchising voters based on race, color, or previous condition of servitude

so the answer is A . granted rights to African Americans

The writer is considering deleting the underlined portion of sentence 1 (reproduced below), adjusting the punctuation as needed.

Robots are no longer just the stuff of science fiction: increasingly intelligent and humanlike, they interact with people in new and surprising ways.

Should the writer keep or delete the underlined text?

A. Keep it, because it uses descriptive language to convey the writer’s perspective on advances in robotics and set up the topic of the passage.

B. Keep it, because it establishes an optimistic tone about robot intelligence that the writer will go on to undermine using irony.

C. Delete it, because it makes a claim about advances in technology that is not supported by evidence in the body of the passage.

D. Delete it, because it adds details that do not follow logically from the claim about robots that is made in the first part of the sentence.

E. Delete it, because it undermines the writer’s credibility by giving the impression that the writer is biased in favor of treating robots like humans.

Answers

Answer:

A. Keep it, because it uses descriptive language to convey the writer’s perspective on advances in robotics and set up the topic of the passage.

Explanation:

Answer A

Correct. The underlined text uses descriptive adjectives and adverbs to describe today’s robots and the way they interact with humans. This descriptive language helps to convey the writer’s perspective on advances in robotics and also sets up the topic of the passage, which is how humans and robots interact. Therefore, the writer should keep the underlined text.

The writer should keep it, because it uses descriptive language to convey the writer’s perspective on advances in robotics and set up the topic of the passage.

What are descriptive languages?

Descriptive language is known to be a method that is often employed in the act of speaking and writing that entails a vivid description of a place, thing or person.

Note that option A is correct because the  descriptive language by the writer helps to pass the the writer’s view point on advances in robotics and set up the topic of the passage.

Learn more about descriptive language from

https://brainly.com/question/948087

Other Questions
Why should police be able to use peoples DNA without consent? NEED HELP WITH THESE f(x)=x^2-x+1g(x) = 5 - 3xEvaluate the following.1) f(-1)2)g( -8)3)f( 1)4) g(5)5) f(3)6) g(-3) What is Isolated system Which describes the translation of ABCD to A'B'C'D'.A)translation 3 units right and 6 units uptranslation 6 units right and 3 units uptranslation 3 units left and 6 units downD)translation 6 units left and 3 units down Read the sentences.I want to be in London right now. I really want to see Big Ben and Buckingham Palace.Which sentence uses the subjunctive mood to express the ideas in the sentences?Going to London to see Big Ben and Buckingham Palace is a dream of mine.Going to London to see Big Ben and Buckingham Palace is a dream of mine. , ,I will go to London right now, and I will see Big Ben and Buckingham Palace.I will go to London right now, and I will see Big Ben and Buckingham Palace. , ,If I can get to London, I will see Big Ben and Buckingham Palace.If I can get to London, I will see Big Ben and Buckingham Palace. , ,If I were in London right now, I would go see Big Ben and Buckingham Palace.If I were in London right now, I would go see Big Ben and Buckingham Palace. , , Find the x and y intercept of this equation: -2x + 8y =4 write your solutions as a point in the form (x,y) How many repeats are there for this STR? Refer to the following DNA sequence to answer the questions: CTAGAAGCTTAAAGCTTCATCATCATCATCATCATCATTTAAGCTTCAAAGCTT At one time, dinosaurs were rulers of the earth. What are the nouns? Hello, I need help in this part of chemistry, I need the chemical names of the following four:1) B and F32) Se and I23) As2 and Se3ASAP! Please,,, 25 ft 8 yd 11 in.Which is greater? NO SCAM LINKS. please reply ASAP PLEASEEEE I'LL GIVE YOU BRAINLIEST!!Which is the best definition of air pressure? *1 pointthe weight of the air pressing on everything in the environmentthe amount of precipitation in a certain areathe type of clouds in the atmospherethe amount of water vapor in the air Can I have some help with this math? Pls hurry, I will mark brainliest Evaluate the expression 4 25 . A human resources manager selected a random sample of 200 workers who donate to charity. The following table shows the distribution of the 200 workers. Count Type of worker Management Other white collar 96 50 S Blue collar 54 The manager conducts a goodness-of-fit test to determine whether the proportions of workers of these types are identical to the population proportions of workers donating to charity, which are 50 percent for management, 30 percent for other white-collar workers, and 20 percent for blue-collar workers. Which of the following statements must be true about the sample?A. The expected number of blue-collar workers donating to charity is less than 30. B. The expected number of management workers donating to charity is 100. C. The expected numbers of other white collar and blue-collar workers donating to charity are the same. D. The expected number of other white-collar workers donating to charity is 50 E. The combined expected numbers of other white collar and blue-collar workers donating to charity is greater than the expected number of management workers donating to charity. I have to find the missing angles In what Century did people learn how traits pass from one living being to itsdescendants? Find the sum or typeimpossible"Help Resources[1 -2 1] + [4 -5 -6]Skip[[?]Enter Texas Roadhouse opened a new restaurant in October. During its first three months of operation, the restaurant sold gift cards in various amounts totaling $1,800. The cards are redeemable for meals within one year of the purchase date. Gift cards totaling $728 were presented for redemption during the first three months of operation prior to year-end on December 31. The sales tax rate on restaurant sales is 4%, assessed at the time meals (not gift cards) are purchased. Texas Roadhouse will remit sales taxes in January.Required:a. Record (in summary form) the S3,500 in gift cards sold (keeping in mind that, in actuality, the firm would record each sale of a gift card individually). b. Record the S728 in gift cards redeemed. c. Determine the balance in the Deferred Revenue account (remaining liability for gift cards). HEY CAN SOMEONE HELP ME WITH MY LASTEST MATH QUESTION I WILL GIVE BRAINLIST PLEASE :))) Mongar Corporation applies manufacturing overhead to products on the basis of standard machine-hours. Budgeted and actual overhead costs for the most recent month appear below: Original Budget Actual Costs Variable overhead costs: Supplies $7,980 $8,230 Indirect labor 29,820 29,610 Total variable manufacturing overhead cost $37,800 $37,840The original budget was based on 4,200 machine-hours. The company actually worked 4,350 machine-hours during the month and the standard hours allowed for the actual output were 4,190 machine-hours. What was the overall variable overhead efficiency variance for the month?a. $130 Unfavorableb. $950 Favorablec. $1,440 Unfavorabled. $1,310 Favorable