Help! Help!

Alcohol abuse has...
A. only physiological aspects.
B. only psychological aspects.
C. physiological and psychological aspects.

Answers

Answer 1

Answer

I feel the answer is C because it could cause mental and physical trauma

Explanation:


Related Questions

What is the relationship between force and momentum?

A. A force will always increase momentum
B. A force acting for a certain time results in a change in momentum
C. There is no relationship
D. It depends on the kind of force​

Answers

Answer:

Explanation:

B

5) Choose the best revision of the following statement: "All the isotopes of a particular element decay radioactively by
emitting electrons."
A. All the isotopes of a particular element are stable and do not decay.
B. Some isotopes are stable and others are unstable. Unstable isotopes decay by emitting various subatomic
particles and radiation
C. Some isotopes are stable and others are unstable. Unstable isotopes decay by emitting protons or
electrons.
D. The statement is correct as it is currently written.

Answers

Answer:

B. some isotopes are stable and others are unstable. unstable isotopes decay by emitting various subatomic particles and radiation.

Explanation:

test gave me the answer so yeah :/ XD

Need help y’all ASAP please...physics

Answers

Answer:

t = 3/8 seconds

Explanation:

h=-16t^2 - 10t+6

h= 0 when it hits the ground

0=-16t^2 - 10t+6

factor out a -2

0= -2(8t^2 +5t -3)

divide by -2

0 = (8t^2 +5t -3)

factor

0=(8t-3) (t+1)

using the zero product property

8t-3 = 0    t+1 =0

8t = 3         t= -1

t = 3/8     t= -1

t cannot be negative  ( no negative time)

t = 3/8 seconds

A bullet has a mass of 0.06 kg. Starting from rest, after the gun's trigger is pulled, a constant force acts on the bullet for the next 0.025 seconds until the bullet leaves the barrel of the gun with a speed of 992 m/s.

What is the change in momentum of the bullet?

Answers

The change in momentum of the bullet : 59.52 kg m/s

Further explanation

Given

m=0.06 kg

Δt=0.025 s

vo=0(from rest)

vt= 992 m/s

Required

The change in momentum

Solution

The change in momentum  = ΔP

ΔP  =m(vt-vo)

ΔP =0.06(992-0)

ΔP =59.52 kg m/s

a string attached to a 60.0 Hz vibr.ator creates a standing wave with 5 loops. What frequency would make 7 loops? (Unit = Hz)

Answers

Answer:

F=84.0 Hz

Explanation:

Using the equation f= n (v/2L),  frequency equals number of loops times velocity over 2 times the length, in order to get 60.0 Hz of frequency from 5 loops, v/2L would have to equal 12. (12*5=60) v/2L is constant, so to find the frequency of 7 loops you would times 7 by 12 to get 84.0.

Hope this helped! :)

The weight of a 0.5 kg object on the surface of Planet X is 20 N. If the radius of the planet is 4 X 106 m, what is its mass?

Answers

Answer:

The mass of the Planet X is 9.595 x 10²⁴ kg.

Explanation:

mass of the object, m = 0.5 kg

radius of the Planet X, r = 4 x 10⁶ m

weight of the object, W = F = 20 N

let the mass of the Planet  X = mₓ

Apply Newton's gravitational law;

[tex]F = \frac{Gmm_x}{r^2} \\\\m_x = \frac{Fr^2}{Gm} \\\\m_x = \frac{(20)(4\times 10^6)^2}{6.67 \times 10^{-11} \ \times \ 0.5} \\\\m_x = 9.595 \times 10^{24} \ kg[/tex]

Therefore, the mass of the Planet X is 9.595 x 10²⁴ kg.

Water is found as a solid, liquid, and gas on ____.

Answers

If this question is about planets, Earth is your answer

please help thank you ​

Answers

YOUR QUERY :

which of the following statements BEST describes the difference between an atom and an ion ?

Answer:

well the correct answer is

d. An atom contains equal numbers of protons and electrons whereas an ion contains unequal numbers of protons and electrons .

Explanation:

A charged atom is known as an ion, well it can be negative as well as positive charge.

if atom has more protons than electrons then it get positively charged and known as cation

if the atom has more electrons that the number of protons then the atom get negatively charged and known as anion

Determine the absolute pressure on the bottom of a swimming pool 30.0 mm by 8.4 mm whose uniform depth is 1.9 mm .

Answers

Answer:

=101343.62N/m^2

Explanation:

absolute pressure on the bottom of a swimming pool= atmospheric pressure +( 2 ×ρ ×g)

( 2 ×ρ ×g)= guage pressure

atmospheric pressure= 101325pa

h= height= 1.9 mm = 1.9×10^-3m

ρ = density of water

= 1000kg/m^3

g= acceleration due to gravity= 9.8m/s^2

Then substitute, we have

absolute pressure on the bottom of a swimming pool= 101325+ [0.0019 ×1000 × 9.8)]

=101343.62N/m^2

Hence, the absolute pressure on the bottom of a swimming pool is =101343.62N/m^2

Victor covers 210 km by car at a speed of 70 km/hr. find the time taken to cover this distance.

Answers

Answer:

3 hrs

Explanation:

the distance covered by victor= 210 km

speed= 70 km/hrs

so, 70×3= 210

so the answer is 3 hrs

BTW im a small kid so don't just right away say the explanation sucks and the subject physics is not yet started in my grade.

edit: don't give me brainless answer plz.

HELP ASAP!
Everything on screenshot.

Answers

Answer:

11. D

12. A

13. B

Explanation:

Hello! I hope this helps!


1. The surface where they slip is called the fault or fault plane.

2. identifying minerals. Hardness is determined by the ability of one mineral to scratch another. ... Each higher-numbered (harder) mineral will scratch any mineral with a lower number (softer).

3. The crust, the outermost layer, is rigid and very thin compared with the other two.The mantle, which contains more iron, magnesium, and calcium than the crust, is hotter and denser because temperature and pressure inside the Earth increase with depth.

Which of these is another name for Newton's
first law?
A. the law of action-reaction
B. the law of force and acceleration
C. the law of gravity
D. the law of inertia

Answers

Newton's first law states that every object will remain at rest or in uniform motion in a straight line unless compelled to change its state by the action of an external force.
D. The law of inertia

which is true about the way air flows

A. high pressure to low pressure

B. low pressure to high pressure

C. cold air to hot air

D. hot air to cold air

Answers

Answer:

A High-to-Low

Explanation:

its like water running down a hill.

1. Determine the kinetic energy of a 625-kg roller coaster car that is moving with a speed of 18.3 m/s,​

Answers

Answer:

104653.13J

Explanation:

Given parameters:

Mass of roller coaster  = 625kg

Speed  = 18.3m/s

Unknown:

Kinetic energy  = ?

Solution:

The kinetic energy is the energy due to the motion of a body.

     Kinetic energy  = [tex]\frac{1}{2}[/tex] x m x v²  

m is the mass

v is the speed

    Kinetic energy  =  [tex]\frac{1}{2}[/tex]  x 625  x  18.3²   = 104653.13J

(BRAINLIEST)
Which is an example of the force of attraction between two objects that have mass?

Magnetism
Gravity
Solar energy
Electricity
(BRAINLIEST)

Answers

Answer:

Gravity

because it's factorised by mass of a body.

For other forces, they deal with charges of negligible mass and weights

Answer:

Gravity

Explanation:

Please answer the questions... I will surely mark you as the brainliest according to me :)

Answers

Answer:

(a) You can tell that have the same strength because they have attracted the same amount of paper clips.

(b) Iron is used in electromagnets because steel retained magnetic properties after the power was turned off, but in the iron, the paper clips dropped off right away.

A 0.41kg football that is initially at rest acquires a velocity of 35m/s when it is kicked. If the kicker's boot remains in contact with the ball for 0.08s, what is the average force of the kick?

Answers

Answer:

F = 318.88[N]

Explanation:

This problem can be solved by the principle of momentum conservation, which tells us that momentum is preserved before and after kicking the ball.

In this way, we can construct the following equation.

[tex]F*t=m*v[/tex]

where:

F = force [N]

t = time = 0.08 [s]

m = mass = 0.41 [kg]

v = velocity [m/s]

[tex]F*0.045=0.41*35\\F=318.88[N][/tex]

A 4 kg bowling bowl is sitting on a table 1 meter off the ground. How much potential energy does it have?

Answers

Answer:

[tex]\huge\boxed{\sf P.E. = 39.2\ Joules}[/tex]

Explanation:

Given Data:

Mass = m = 4 kg

Acceleration due to gravity = g = 9.8 m/s²

Height = h = 1 m

Required:

Potential Energy = P.E. = ?

Formula:

P.E. = mgh

Solution:

P.E. = (4)(9.8)(1)

P.E. = 39.2 Joules

[tex]\rule[225]{225}{2}[/tex]

Hope this helped!

~AH1807

An inductor with an inductance of .5 henrys (H) is to be connected to a 60 Hz circuit. What will the inductive reactance (X L) be

Answers

Answer:

1885.2 ohms

Explanation:

Step one:

given data

L=5H

f=60Hz

Required

The inductive reactance of the inductor

Step two:

Applying the expression

XL= 2πfL

substitute

XL=2*3.142*60*5

XL=1885.2 ohms

A block of mass m is hung from the ceiling by the system of massless springs consisting of two layers. The upper layer consists of 3 strings in paralle, and the lower layer consists of 2 strings in parallel. The horizontal bar between the two layers has negligible mass. The force constants of all springs are k. Calculate the period of the vertical oscillations of the block.

Answers

Answer:

  T₀ = 2π [tex]\sqrt{\frac{m}{k} }[/tex]           T = [tex]\sqrt{\frac{5}{6} }[/tex] T₀

Explanation:

When the block is oscillating it forms a simple harmonic motion, which in the case of a spring and a mass has an angular velocity

        w = [tex]\sqrt{k/m}[/tex]

To apply this formula to our case, let's look for the equivalent constant of the springs.

Let's start with the springs in parallels.

* the three springs in the upper part, when stretched, lengthen the same distance, therefore the total force is

       F_total = F₁ + F₂ + F₃

the springs fulfill Hooke's law and indicate that the spring constant is the same for all three,

       F_total = - k x - k x - kx = -3k x

         

therefore the equivalent constant for the combination of the springs at the top is

      k₁ = 3 k

* the two springs at the bottom

following the same reasoning the force at the bottom is

        F_total2 = - 2 k x

the equivalent constant at the bottom is

         k₂ = 2 k

now let's work the two springs are equivalent that are in series

the top spring is stretched by an amount x₁ and the bottom spring is stretched x₂

            x₂ = x -x₁

            x₂ + x₁ = x

if we consider that the springs have no masses we can use Hooke's law

            [tex]-\frac{F_{1} }{k_{1} } - \frac{F_{2}}{k_{2} } = \frac{F}{k_{eq} }[/tex]

therefore the equivalent constant is the series combination is

             [tex]\frac{1}{k_{eq} } = \frac{1}{k_{1} } + \frac{1}{k_{2} }[/tex]

we substitute the values

             \frac{1}{k_{eq} }  = \frac{1}{3k } + \frac{1}{2k }  

             \frac{1}{k_{eq} }  = \frac{5}{6k} }  

              k_eq = [tex]\frac{6k}{5}[/tex]  

therefore the angular velocity is

             w = [tex]\sqrt{\frac{6k}{5m} }[/tex]  

           

angular velocity, frequency, and period are related

           w = 2π f = 2π / T

           T = 2π / w

            T = 2π [tex]\sqrt{\frac{5m}{6k} }[/tex]

           T₀ = 2π [tex]\sqrt{\frac{m}{k} }[/tex]

           T = [tex]\sqrt{\frac{5}{6} }[/tex] T₀

what causes sound to have low pitch
A.Sound Wave with high frequency.
B.sound wave with low frequency.
C.sound wave with large amplitude
D.sound wave with small amplitude

Answers

C sound wave with large amplitude

Help pleaseeee need the answers ASAP

Answers

Answer:

- 670 kg.m/s

Explanation:

Newton's third law states that to every action, there is equal and opposite reaction force. Since the force will be same but different in direction and acted in the same time then the impulses ( force multiply by time) of the two car be same in magnitude but different in direction - 670 kg.m/s

-670 kg.m/s i know this because the first person is right and ik it
Other Questions
can you please help me:) Please help 4 questions for 10 points!!!------------------------------------------------------------1) Which expression is equivalent to 4(23)?4(20+3)4(2+3)4(2+13)4(20+30)..................................................................................................2. Which expressions are equivalent to 4(42)?Select each correct answer.4(20+22)4(40+2)4(4+20)4(4+2).......................................................................................................3.Which expression shows how 645 can be rewritten using the distributive property?640+6206+205640+6564+65...............................................................................4.Tori uses the greatest common factor and the distributive property to rewrite this sum:24 + 84What expression does Tori write?2(24+42)12(2+7)24(1+4)4(6+21).....................................................................my last one got deleted.... paid rent of Rs.25000 by cheque. make journal entry write the code for RNA from this DNA STRAND :AAAAAATTTTTTCCCGGGGTTTATATATC RIP grandsonhow does earths crust change earths surface y32c-4-3 -2 -1-1+1 2 3 4-2+-3+-4+41What is the slope of the line? Explain why the Hitler youth had only mixed success among the young German people. You may use the following in your answer comradeship (friendship), compulsory membership. hi...need help....thank you.. A restaurant customer left $1.35 as a tip...Plz help me DIRECTIONS: Use this information to answer Parts A, B, and C.A traffic cone has a diameter of 10 inches and a height of 27 inches.Part AFind the volume of the cone. Need answers for #3 please hep Identify the number of solutions for the equation below: A game store owner buys a Nintendo Switch game for $22.50 and sells it with a 40% mark up. What is the retail price? What is (-3,4) (5,-2) in slope intercept form? How did the use of paper help contribute to the spread of Islam? Which action best explainsthe differences shown inthese photographs? Chooseyour answerand explainwhy you chose itA The United States gaveeconomic assistancethrough the Marshall PlanB The United States and theSoviet Union created analliance after World War IIC The United Nations wascreated after World War ILD The Soviet Unioncreated the Iron Curtainafter World War II The charged particles in the beams that Thomson studied came from atoms. As these particles moved away from their original atoms, they formed a visible beam. The current model of the atom includes protons, neutrons, and electrons.What is the best use of an atomic model to explain the charge of the particles in Thomsons beams?An atoms negative particles are surrounded by positive matter, so the positive particles are easier to remove.An atoms positive particles are surrounded by negative matter, so the negative particles are easier to remove.An atoms smaller negative particles are at a distance from the central positive particles, so the negative particles are easier to remove.An atoms larger positive particles are at a distance from the central negative particles, so the positive particles are easier to remove. PLS HURRY!!Can you tell how many different notes are played at a particular time (chords)? for manic by conan gray What is the common ratio of the sequence?-2, 6, -18, 54....-3-238 Tina Jones is a dancer specializing in Latin dance styles. She always wanted to have her own dance studio where she could teach dancing to young and old alike. In 2006, she opened her first dance studio, Electric Diva, in Madison Triangle. It was a great choice as a business location because its well-connected by highways to most places in the city. She leased the space for three years. Her initial investment included a good sound system, cheerful interior design, and strong flooring. To raise capital for the business, Tina turned to her brother-in-law, Philip. Philip made half the financial investment. He manages the accounts and social media needs of the business. He has a 30% share in Trishas business. Together, they expanded the business to three dance studios in the city and plan to open franchises in other cities.