Answer:
The answer is the last one, skeletal remains
Answer: Skeletal remains
what does the respritory system do?
Answer:
The respiratory system's main job is to move fresh air into your body while also removing waste gases.
Explanation:
Your lungs are part of the respiratory system, a group of organs and tissues that work together to help you breathe.
What is the relationship between the rock cycle and the plate tectonics?
Answer: The metamorphic rocks can erode into sedimentary rocks which can turn into igneous rock. Metamorphic rocks in the rock cycle is driven by tectonic plates.
Explanation:
¿Con que otro nombre se le conoce a las placas de espuma de poliuretano altamente contaminante?
Answer:
La espluma de poliuretano (espluma PU) ye un material plásticu porosu formáu por un agregamientu de burbuyes, conocíu tamién polos nomes coloquiales de gomaespuma n'España o gomapluma en dellos países suramericanos. Contienen sustances d'escasu poder canceríxenu que si representen dalgún peligru, namái sería tres esposiciones intenses y teniendo contautu direutu.Tamién ye denomináu Poliuretano proxectáu, por cuenta de la forma na que se suel aplicar sobre superficies. Explanation:
tRNA uses (anticodons/codons) to match to the mRNA.
Answer:
anticodons
Explanation:
codons are for mRNA
tRNA uses anticodons to match to the mRNA.
Which one does tRNA uses?tRNA (transfer RNA) molecules are responsible for carrying specific amino acids to the ribosomes during protein synthesis.
They have an anticodon region that consists of three nucleotides that are complementary to the codons on the mRNA (messenger RNA). The codons on the mRNA determine the sequence of amino acids in the growing polypeptide chain.
The anticodon on the tRNA base pairs with the complementary codon on the mRNA, ensuring that the correct amino acid is incorporated into the growing protein chain. The matching between the anticodon and codon is essential for the accurate translation of genetic information into protein synthesis.
Learn more about tRNA at:
https://brainly.com/question/4089622
#SPJ6
Explain the lifecycle of mosquito in short
Answer:
Mosquitoes have 4 life stages: egg, larva, pupa and adult. Mosquitoes can live and reproduce inside and outside the home. The entire life cycle, from an egg to an adult, takes approximately 8-10 days. Hope this helps! :)
Which statement below is NOT a statement within the Cell Theory?
A. all cells come from other cells
B. all organisms are composed of cells
C. the cell is the basic unit or organization of organisms
D. all cells contain DNA (genetic information)
How is energy produced by respiration stored
Answer:
Explanation:
Cellular respiration converts the chemical energy stored in glucose into chemical energy stored in the ATP molecule. The cells break glucose down into carbon dioxide and water while producing energy that they store in ATP molecules.
Answered by the ONE & Only #QUEEN aka #DRIPPQUEENMO
Hope this helped!!!
As a result of the experiment scientists did with Mexican tetras, it seems likely that their first hypothesis about blindness in the tetras is right. Explain how the result of the experiment supports their first hypothesis.
The scientists' first hypothesis is that blindness gives the fish some sort of evolutionary advantage, but not directly.
The experiment was: The scientists transplanted a lens from the eye of a surface tetra embryo into the eye of a cave tetra embryo. The result was striking—the surface tetra lens into the cave tetra caused all of the surrounding tissues to develop into a healthy eye.
A result that supports the hypothesis 'blindness gives the fish some evolutionary advantage, but not directly' may be a higher fitness in close relatives of fish.
What is a hypothesis?An scientific hypothesis is a given explanation to a scientific observation from the real world.
A hypothesis must be verifiable, which means that it can be confirmed or rejected by using the scientific method.
In conclusion, a result that supports the hypothesis 'blindness gives the fish some evolutionary advantage, but not directly' may be a higher fitness in close relatives of fish.
Learn more about hypotheses here:
https://brainly.com/question/11555274
#SPJ1
This is a question that has been confusing - In addition to carbon dioxide, what other two ingredients does a plant need for photosynthesis?
Answer:
Carbon dioxide, water and sunlight
Answer:
water and sunlight
Explanation:
When a person loses consciousness due to a head injury from a car crash, the ______ keeps the body functioning by regulating the flow of information between the brain and the rest of the body
Answer:
Brain stem
Explanation:
I hope this helps
If a population is evolving, the allele frequency ________
Which of the following represents the correct order of the phases of the
Moon?
A. new moon, full moon, last quarter, first quarter, and then new moon again
B. full moon, new moon, last quarter, first quarter, and then full moon again
C. full moon, last quarter, new moon, first quarter, and then full moon again
D. last quarter, full moon, new moon, first quarter, and then last quarter again
Answer:
c
Explanation:
full and new moons aren't back to baxk
help................
The top left, would be light energy from the sun, while the top of the circle would be living beings. Think about it just like plants that that gain energy from the sun through photosynthesis. Then the bottom of the circle would be nonliving beings, either decomposed plants or animals that bring nutrients to soil, or dead ones that we eat. This cycles through until the energy is rereleased through heat. Therefore the top right would be heat energy, every living thing on earth creates gradual amounts of heat. Imagine going for a run, you'll probably be hotter afterwards right? I know it's not the most scientific answer but its 100% right.
Hope this helps!
explain how at least three pieces of evidence support the theory of evolution.
Dont put any link or else I won’t give brainlist, just answer.
Answer:
1. Fossil evidence
2. Homologous similarities.
3. Molecular evidence
Carbon dioxide enters a plant through pores (openings) called the
A. stomata.
B. cuticle.
C. veins.
I will mark Brainliest for frist answer
Answer:C, to contain the information
Explanation:
why is it important to save energy in our daily lives
Answer:
So you can be more active and do different things that need energy
Explanation:
Having energy is an important part of daily life. Without energy, the human body would not be able to go throughout the day without being tired and without their muscles and bones hurting.
what process causes stem cells to become immune system cells,then some immune system cells to become antibodies?
The energy that powers photosynthesis comes from
A. oxygen.
B. water.
C. the sun.
D. chemicals.
Answer:
sun but am not so sure about it
Which process begins the formation of sedimentary rock?
This moray eel has a small fish cleaning between its teeth. The eel gets a
clean mouth while the cleaner fish gets a nice meal.
A.Mutualism
B.Commensalism
C.Parasitism
Answer:
A. Mutualism
Explanation:
The moray eel and the small fish are both getting something out of it. Meaning they both benefit from each other.
Which organelle of a cell functions similarly to the envelope of a virus and why?
Answer: linear or circular. include genes encoding viral proteins: capsid, envelope proteins, any polymerase not found in the host cell. viruses may have a lipid envelope.
3 examples of radioactive dating?
Answer:
Uranium 238
Potassium 40
Rubidium 87
Explanation:
Cell differentiation causes embryonic
cells to become which of these cells? A) prokaryotic cells B) specialized cells C) stem cells
Answer c
Explanation:
Bill Nye Earth's crust
Answer:
1. rock
2. on
3. mantle
4. volcanoes
5. active
6. lava
7. hot
8. coolest
9. geyser
10. resistant
11. tectonic
12. tectonic/pangea
13. caves
14. earthquake
15. crust
Explanation:
Earth science question. Please help
Answer:
answer choice 4, more rain and a steeper slope cause it to flow faster
Explanation:
what is the mRNA in TACCGGATGCCAGATCAAATC?
Answer:
AUGGCCUACGGUCUAGUUUAG
plz no bit.yl stuff, just answers
Sickle cell anemia is a disease that affects the circulatory system.It can be passed from parent to child. Which of the following indicates the significance of this disease?
A.It shows that a disease can cause genetic changes.
B.It is a reflection of how genetic factors affect health.
C.It shows how public health is affected by environmental factors.
D.It indicates how a toxin can play a role in the development of disease.
Can someone please help me on this plz I beg u :(
Answer:
Coleoptera is correct! Hope this helps.
Number the steps from when a stimulus is received to when the body reacts.
_____ The stimulus is received by sensory receptors.
_____ Motor neurons cause muscles to contract so the body can react to the stimulus.
_____ The brain processes the information through interneurons.
_____ Interneurons transfer response information to motor neurons.
_____ Sensory neurons carry stimulus information to the brain or spinal cord.
Answer:
The correct answer is -
1 - The stimulus is received by sensory receptors.
2 - Sensory neurons carry stimulus information to the brain or spinal cord.
3 - The brain processes the information through interneurons.
4 - Interneurons transfer response information to motor neurons.
5 - Motor neurons cause muscles to contract so the body can react to the stimulus.
Explanation:
In most of the organism including humans body response according to the stimulus it receives. The stimulus is received by the sensory receptors to the sensory neurons or afferent neurons that are present on the skin, nose tongue ears, or eyes. Many other receptors and pain receptors present on various internal organs as well.
These sensory neurons carry the stimulus to the spinal cord or brain where this information received by the stimulus process through interneurons and transfer the response of the particular stimulus to the motor neurons. These motor neurons result in muscles contracts so the body can react.
