Here is a easy question summary the Interphase, prophase metaphase, anaphase and telophase step by step for each of the phase

Answers

Answer 1

Answer:

Interphase:

The DNA is present as uncondensed chromatin, which is not visible under a microscope. The DNA is contained within a clearly defined nucleus . Centrosomes and other organelles have been duplicated , and the cell is enlarged in preparation for division .

Prophase:

The DNA supercoils and chromosomes condense, becoming visible under a microscope). The chromosomes are comprised of genetically identical sister chromatids, which are joined at a centromere). Paired centrosomes then move to the opposite poles of the cell and form microtubule spindle fibers , the nuclear membrane breaks down, and the nucleus dissolves .

Metaphase:

The microtubule spindle fibers from both centrosomes connect to the centromere of each chromosome , microtubule depolymerisation causes spindle fibers to shorten in length and contract , causing chromosomes to align along the center of the cell.

Anaphase:

The continued contraction of the spindle fibers cause genetically identical sister chromatids to separate . Once the chromatids separate, they are individual chromosomes. The genetically identical chromosomes move to the opposite poles of the cell .

Telophase:

Once the two chromosome sets arrive at the poles, spindle fibers dissolve  and chromosomes decondense, becoming invisible under light microscopes.  Nuclear membranes reform around each chromosome set , and cytokinesis occurs concurrently, splitting the cell into two separate cells.


Related Questions

what are some non examples of hydroshere

Answers

Oceans, lakes, seas, and clouds are examples.

The hydrosphere is made up of all the water on the planet, including the water found below the surface and in the atmosphere. A planet's hydrosphere may be liquid, vaporous, or composed of ice. The three surface water bodies on Earth are oceans, lakes, and rivers.

What are some non examples of hydrosphere?

It comprises all surface waters that are liquid or frozen, groundwater that is contained in soil or rock, and atmospheric water vapor. The hydrologic cycle continuously circulates almost all of these waters. In wells and aquifers, it can also be found underground as groundwater.

Within the hydrosphere, water circulates in a cycle. Clouds contain water that eventually falls to Earth as rain or snow.

Therefore, Rivers, lakes, and seas are where this water gathers. The cycle is then restarted by its evaporation into the atmosphere. The water cycle refers to this.

Learn more about hydrosphere here:

https://brainly.com/question/14686427

#SPJ2

Natural selection can, through common descent, produce closely related species that have similarities due to their shared ancestry. Natural selection can also, through convergent evolution, lead to distantly related species appearing very similar. Identify which examples reflect common descent and which reflect convergence.

Answers

Complete Question:

Natural selection can, through common descent, produce closely related species that have similarities due to their shared ancestry. Natural selection can also, through convergent evolution, lead to distantly related species appearing very similar. Identify which examples reflect common descent and which reflect convergence.      

Tree-dwelling primates have prehensile tails for gripping branches. Tree-dwelling opossums also have prehensile tails.  Many birds and some kinds of bats that feed on plant nectar all have long flexible tongues.    Primates use opposable thumbs to help climb. New World monkeys also have prehensile tails, but Old World monkeys do not.  Marsupial mammals throughout Australia show a wide diversity of forms that reflect the habitats in which they live. Hawaiian honeycreepers, with their elongated, nectar-sipping bills, all evolved from a finch-like ancestor.

Answer and Explanation:

Tree-dwelling primates have prehensile tails for gripping branches.  Considering recent ancestors, the prehensile tail trait can be considered as a convergence example that occurred among different groups. But we can also think about it as a common descent if we consider the farthest primates ancestor. Although still controversial, Plesidiapsi might be considered a common ancestor of primates, that evolved from a ree-dwelling mammal with a long tail. It is believed that this animal used to live in trees.   Tree-dwelling opossums also have prehensile tails.   Convergence. Many birds and some kinds of bats that feed on plant nectar all have long flexible tongues. Convergence. These are two groups that are very separated from each other, and they developed different traits according to their needs separately. Some of the species of these two groups adapted to feed on the same plant so they needed to develop the same characteristic to obtain nectar.Primates use opposable thumbs to help climb. New World monkeys also have prehensile tails, but Old World monkeys do not.   Common descent . The common ancestor had a prehensile tail, some of the descendants developed the tail but some others did not.Marsupial mammals throughout Australia show a wide diversity of forms that reflect the habitats in which they live.  Common descent . Hawaiian honeycreepers, with their elongated, nectar-sipping bills, all evolved from a finch-like ancestor.  Common descent . They all look like the finch-like ancestor.

a) dry apricots are left transferred to sugar solution?

Answers

When dry apricots are left for sometime in pure water, they will swell. Because, water will enter into them through the process of osmosis. Later,when these apricots will be transferred to sugar solution, they will again shrink.

Which structure is located between the trachea and a bronchiole? A. epiglottis B. pharynx C. alveolus D. bronchus

Answers

the correct answer is the bronchus

If a force of 90 N is applied to each cart, which cart has the greatest
acceleration? *
1 point​

Answers

Answer: Cart 1 would have the greatest acceleration. It weights less and if you apply force it will go faster than other carts.

Explanation:

(at least so I think, don't shame me if I am wrong)

Use the image to answer the question below: Using the model presented, what process is being depicted? A) An electrical signal being converted to a chemical signal B) Salutatory conduction C) The transfer of neurotransmitters between axons D) The path of a steroid hormone

Answers

Answer:

option A is correct because of it is undergoing a convertion

The narrative point of view in this excerpt allows the
reader to experience
O Rainsford's feelings as he enters the room.
Rainsford's feelings about his host.
Rainsford's impression of the dining room.
O Rainsford's impression of the island.

Answers

Answer:

O Rainsford's impression of the dining room.

Explanation:

Richard Connell's short story "The Most Dangerous Game" revolves around the famed hunter Sanger Rainsford and his change of fortune when he was left stranded in an island famed for hunting humans as a game by the island's barbaric owner General Zaroff.

In the given excerpt, the narrator reveals the "dining room to which Ivan conducted (Rainsford)". The impression that the hall was "of feudal times with its oaken panels, its high ceiling, its vast refectory table where twoscore men could sit down to eat" reveals the outline of the enormous dining hall where Rainsford was conducted to eat with Zaroff. This narrative point of view allows the reader to experience the impression of the dining room.

Answer:

C

Explanation:I took the quick on Ed (:

Which of the following items was Darwin able to use to study the structures of
extinct organisms?
A. Fossils
O B. Species
O C. Amino acids
O D. Adaptations

Answers

Answer:

a

Explanation:

because that is all he had left of extinct animal's.

Answer:

A

Explanation:ithink not sure

marasmus is caused due to diet insufficient in (a) proteins (b) carbohydrates (c) fats (d) all of these

Answers

The Appropriate answer:

[tex] \large{ \boxed{ \bf{ \color{red}{Carbohydrates(B)}}}}[/tex]

Explanation:-Bread and cereal group includes food made from grains auch as rice, wheat and corn. They are rich in carbohydrates and theh give energy to our body to work and play.Our body needs certain nutritional needs, and jf they aren't fulfilled, then chances of deficiency diseases increases. Deficiency of Carbohydrates causes Marasmus. The body losses activeness, bodyaches are frequent.

Explore more:-Carbohydrates are made up of three elements: Carbon, Hydrogen and oxygen.There are simple or complex polysaccharides which also determines the simplicity of carbohydrates.

━━━━━━━━━━━━━━━━━━━━

Use this list of technical steps for the following question: 1. Two cells were fused using a small electrical current. 2. An embryo was implanted into a "surrogate mother". 3. All nuclear DNA was removed from a sperm. 4. A cell was taken from an adult sheep. 5. All nuclear DNA was removed from an egg. What is the order of events in producing a cloned animal

Answers

Answer:

The correct order of events would be - 4, 5, 1 and 2.

Explanation:

In the process of producing the cloned there are various steps are involved. Carrying out these steps in order is essential to produce the cloned animal. These steps are in correct order are given as follows-

4. A cell was taken from an adult sheep or the animal that is desired to be cloned.

5. All nuclear DNA was removed from an egg of the sheep.

1. two distinct cells of the animal were fused together with the help of electrical current.

2. the embryo formed by fusing the cells now implanted into a surrogate mother.

Beyond changes in relationships described above, explain what other characteristics of man changed after the Fall.

Answers

Answer:

The consequences of the fall was man and woman will die man turned to mortal and will turn back into dust. woman would bring children in pain. relationships between husband and wife would be difficult. The ground was cursed labor would be very hard. human was banned from the paradise and the garden. no longer would they enjoy the holiness and justice they had in paradise.

Explanation:

why do solids have a fixed shape

Answers

Answer: solids have fixed shape because they are rigid and is high dense. The particles are way too close to each other that even force applied to it doesn’t change it shape

Name four breeds of cattle

Answers

Answer:

Black Angus, Red Angus, Holstein, Gelbvieh

Hope this helps!

explain the gaseous exchange in lungs

Answers

Answer:

Gas exchange is the delivery of oxygen from the lungs to the bloodstream, and the elimination of carbon dioxide from the bloodstream to the lungs. It occurs in the lungs between the alveoli and a network of tiny blood vessels called capillaries, which are located in the walls of the alveoli.

Hope it helped u if yes mark me BRAINLIEST!

Tysm!

Answer:

breathing allows the exchange between 2 gases: oxygen and carbon dioxide. Gas exchange occurs in millions of lung alveoli and the capillaries that surround them

Explanation:

SIOM CSserials
What has a greater influence on protein levels?
(1 point)
Protein degradation has a greater influence because outside factors like antibiotics can
cause it, and it is difficult to recover from.
O
Protein degradation has a greater influence because they are denatured faster than the cell
can produce them.
mRNA destroyer concentration has a greater influence because it is destroying mRNA before
proteins can even be produced.
mRNA destroyer concentration has a greater influence because mRNA is destroyed right
after the proteins are produced.

Answers

Answer:

mRNA destroyer concentration has a greater influence because it is destroying mRNA before  proteins can even be produced.

Explanation:

Proteins are synthesized from mRNA through the process of translation. mRNAs are first synthesized from a coding DNA template through the process of transcription. Hence, if mRNAs are destroyed, it means proteins will not be synthesized at all.

Protein not being synthesized at all means that mRNA destroyer concentration has a greater influence on protein levels than protein degradation. With protein degradation, not all the protein is degraded at once and some quantity of the protein can still be found, but with mRNA destroyer concentration, no protein can be found at all because it was not synthesized in the first place.

Predict which of the following can impact an ecosystem's available resources?

Answers

Answer:Long term drought, change of season from winter to summer, forest fire are unfavorable environmental factors which can deplete the amount of resources already available with the ecosystem. The long term drought will be a condition in which the ecosystem will suffer from non-availability of water.

Explanation:

Metals are useful in industry because they can be shaped without breaking. What is this property of metals called?

Answers

Answer:

malleable ................

Answer:

versatility ductility conductivity malleability

any 3 communicable diseases,its symptoms,prevention and source.

Answers

Answer:

1) Flu

2) Hantavirus

3)HIV/AIDS

hope it helps you

Explanation:

In which form do plants store energy?
starch
glycogen
chitin
cellulose

Answers

Answer:

starch

Explanation:

plant store energy in the form of starch and animal store energy in the form of  glycogen these starch and glycogen are converted into glucose whenever body needs energy

Answer:

The answer is Starch

Explanation:

Hopefully this helps you

pls mark brainlest

It is right on Edge2020

do foxes hunt alone yes or no.

Answers

yes. but occasionally they meet up with their packs during the night

Answer:

yes they hardley ever travel in packs

Please I need help with this

Answers

TAAGCCGATAAATGCTAACGGTA

A garden has a length of 1.5 x102 m and a width of 0.5 x 102 m. what is the area of the garden?

Answers

Answer:

7.5 × 10^3 m^2

Explanation:

The garden described in this question takes the shape of a rectangle, which has a length of 1.5 x102 m and width/breadth of 0.5 x 102 m.

To calculate the area, we use the formula for calculating the area of a rectangle, which is;

Area = length (L) × width (w)

Area = 1.5 x102 m × 0.5 x 102 m

Area = 150 × 50

Area = 7500

This, the area of the garden is 7500m^2 or 7.5 × 10^3 m^2

How are the molecules in photosynthesis and cellular respiration similar? Please include descriptions of the molecules

Answers

Answer:

They are similar because they both produce energy but in two different forms.

Photosynthesis- It produces oxygen and G3P, simple carbohydrate molecules that are high in energy and can be converted into glucose, sucrose, or other sugar molecules.

cellular respiration-During cellular respiration, a glucose molecule is gradually broken down into carbon dioxide and water.

They exhibit the same responses, but they do so in reverse. Carbon dioxide and water are converted during photosynthesis into glucose and oxygen. Carbon dioxide and water are produced during respiration in exchange for glucose and oxygen.

What similarity in photosynthesis and cellular respiration?

Energy transformations from one form to another are a part of both respiration and photosynthesis through a sequence of metabolic reactions.

The reactions that are carried out by both processes—which both use and produce ATP—are carried out on membranes and are managed by enzymes.

Light energy is converted by photosynthesis into chemical energy that is stored in glucose, which is then released by cellular respiration to create ATP, the life-sustaining compound.

Therefore, They are similar because they both produce energy, but in two different forms.

Learn more about cellular respiration here:

https://brainly.com/question/28532054

#SPJ2

Afferent neurones connect?

A the brain and spinal cord to muscles
B sense organs to muscles.
C one sense organ to another sense organ
D sense organs to brain and spinal cord

Can someone explain to me the answer because I'm confused.

Answers

Answer:

These neurons are located in the central nervous system (the brain and spinal cord). Afferent and efferent neurons have to work together in order to sense and respond to stimulus, but they don't directly connect. Association neurons bridge the gap to relay information between sensory and motor neurons.

What is another name of molecular biology????

Answers

Answer:

biotechnology

Explanation:

hope it help you

Answer:

biotechnology biotech

biological engineering biological science

what is the SI unit of focal length
,​

Answers

Answer:

dioptre is si unit of focal length

where 1 dioptre = 1 m^-1

Explain how scientific knowledge develops through making observations about the natural world.

Answers

Answer:

Scientific knowledge develops through making observations about the natural world. An observation may generate a scientific question, which may lead to a hypothesis. The hypothesis can be tested through experimentation. The results of experimentation lead to changes in scientific knowledge.

Explanation:

Explain how scientific knowledge develops through making observations about the natural world.  my answers are never wrong trust me

what is the defination of matter?​

Answers

Answer:

matter is a kind of substance

Answer:

any thing that has a mass and occupies space is called matter

Explanation:

for example

a book is a matter because it has a mass and it also occupies some space

2. What happens in
terms of energy
when you hold a
craft stick and bend
it slightly?

Answers

Answer:

In a similar way a wooden tongue-depressor stick (like the kind used at the doctor's office) stores elastic potential energy when you bend it (though not if you break it). ... The elastic potential energy that was stored in the stick is transformed into movement, called kinetic energy.

Explanation:

Shivering and vasoconstriction would be signaled to cause a: A. increase in pH. B. decrease in temperature. C. decrease in pH. D. increase in temperature.

Answers

Answer:D

Explanation: shivering occurs when someone is cold and vasoconstriction is when the blood vessels close to the skin and the veins closer to the skin surface constrict as a result of dat air doesn’t enter the body

Vasoconstriction is the narrowing of the blood vessels that hinders blood flow. Vasoconstriction and shivering will lead to an increase in the temperature through thermoregulation. Thus, option d is correct.

What is thermoregulation?

Thermoregulation is the maintenance and balancing of the temperature and heat in the body. They are regulated by many factors including shivering and vasoconstriction.

During the vasoconstriction, the blood vessels close to the skin surface close and the body shivers as a result of cold or decreased temperature. This signals the body to increase the temperature so that shivering can be stopped.

Therefore, vasoconstriction and shivering signal the body to increase the temperature.

Learn more about thermoregulation here:

https://brainly.com/question/7450241

#SPJ2

Other Questions
Pens cost 15 pence each. Rulers cost 20 pence each. Write down an expression for the cost of x pens and x rulers. Communities and States are controlled by the ______________. Yellowstone Corporation has just announced the repurchase of $125,000 of its stock. The company has 39,000 shares outstanding and earnings per share of $3.29. The company stock is currently selling for $76.09 per share. What is the priceearnings ratio after the repurchase? What is the reason: if a+c=b+c then a=b 3.03 times 10^-3 in scientific nation What does it mean to be a good citizen? Why is this important? "Dot painting" is seen today as a unique artistic attribute of Australian Pintupi culture, and has become quite revered on the global art scene. When do anthropologists believe that this art form originated within the Australian settlement of Papunya?a. 1970b. 1972c. 1980d. 1969 Cuntos adjetivos calificativos hay? Los esteroides oculares estn indicados en condiciones inflamatorias de la conjuntiva palpebral, cuando se acepta el riesgo inherente al uso de esteroides en determinadas conjuntivitis infecciosas a)cuatro b)seis c)dos d)ocho e)uno Buckson Framing's cost formula for its supplies cost is $1,350 per month plus $18 per frame. For the month of June, the company planned for activity of 716 frames, but the actual level of activity was 713 frames. The actual supplies cost for the month was $14,820. The supplies cost in the flexible budget for June would be closest to: L Corporation produces and sells 15,100 units of Product X each month. The selling price of Product X is $21 per unit, and variable expenses are $15 per unit. A study has been made concerning whether Product X should be discontinued. The study shows that $72,000 of the $101,000 in monthly fixed expenses charged to Product X would not be avoidable even if the product was discontinued. If Product X is discontinued, the annual financial advantage (disadvantage) for the company of eliminating this product should be: Multiple Choice $10,400 ($61,600) ($39,400) $39,400 Pls help! If you know the answer How can the miller's daughter be described based on the excerpt below? Then she grieved sorely at her misfortune, and said she would give him all the wealth of the kingdom if he would let her off, but in vain; till at last her tears softened him, and he said, 'I will give you three days' grace, and if during that time you tell me my name, you shall keep your child.' unselfish wise spiteful Solve the system of equations algebraically. 5x-3y=6 and 6x-4y=2 a. many solutions c. no solution b. (8,14) d. (9,13) Find the Value of X 1. Solve for X algebraically. 2. Using complete sentences, describe your method for finding X. Answer Both Questions Karmen returned a bicycle to Earl's Bike Shop. The sales receipt showed a total paid price of $211.86, including the 7% sales tax. What was the cost of the bicycle without the sales tax? Any help would be very appreciated! Thank you very much! please solution this question now .thank you very much factor of x^3+x^2y+xy^2 What was the impact of the political and legal ideas found in Hammurabis Code? The Code served as a model for government organization and the separation of powers. The Code established ideas about democracy and the rights of citizens. The Code served as a model for justice and influenced law-making in other societies. The Code established ideas about equality and justice within a diverse society. Jiminys Cricket Farm issued a bond with 30 years to maturity and a semiannual coupon rate of 4 percent 2 years ago. The bond currently sells for 107 percent of its face value. The companys tax rate is 21 percent. The book value of the debt issue is $60 million. In addition, the company has a second debt issue on the market, a zero coupon bond with 10 years left to maturity; the book value of this issue is $35 million, and the bonds sell for 76 percent of par.Required:a. What is the companys total book value of debt? b. What is the companys total market value of debt?c. What is your best estimate of the aftertax cost of debt?