How are fractals developed

Answers

Answer 1

Answer:

Fractals are infinitely complex patterns that are self-similar across different scales. They are created by repeating a simple process over and over in an ongoing feedback loop. ... Abstract fractals – such as the Mandelbrot Set – can be generated by a computer calculating a simple equation over and over.

Step-by-step explanation:


Related Questions

A laundry basket has 24 t-shirts in it. Four are navy, twelve are red and the remaining are white. What is the probability of not selecting a red shirt? *

Answers

Answer:

50%

Step-by-step explanation:

Identify the population of shirts that are *NOT red.* In this case 12 are red. This means that 12 shirts are *not red.* 12/24 = .5 or 50% probability.

I neeeeeed help please

Answers

Answer:

(3x+21)(x-5)

Step-by-step explanation:

To solve this let's create an equation that has intercepts at -7 and 5

To do this we get the following

(x+7)(x-5)

Now we need to make sure that the line passes through (4,-33) To do so we will plug in 4 to see how far off we are

If you plug in 4 into x you should get -11

To make y= -33 we simply need to put a three in the front and then distribute it to the first bracket

So we have

3(x+7)(x-5)

then distribute the 3 to get

(3x+21)(x-5)

I doubled checked this answer on desmos and my math is correct

One-third of Olivia age , increased by 12 , is equal to twice her age , decrease by 3. How old is Olivia

Answers

Answer:

she would be 9

Step-by-step explanation:

Answer:9

Step-by-step explanation:

A store is having a 20%-off sale on its video games. What is the amount of the discount on a game that regularly costs $25?

Answers

Answer:$20

Step-by-step explanation:

$25x.20=5

$25-5=20


The changes in the depth of snow, in inches, at a ski resort for four days are shown below.
-1/8, 3/4, 3/4, -1/2

What is the average change in the depth of the snow during the 4-day period?
A. 2 1/8
B.3 1/2
C. 7/32
D. 17/32

Answers

Step-by-step explanation:

Total change = (-1/8) + (3/4) + (3/4) + (-1/2) = 7/8.

Average change = Total change / 4 days

= (7/8) / 4

= 7/32. (C)

Need help finding x.

Answers

Answer:

Step-by-step explanation:

SOH CAH TOA  to help remember how the trig functions fit on the triangle

use  SOH since we know the angle and the hypotenuse and want to find the opposite side

Sin(x)= Opp/ Hyp

Hyp* sin(38) = Opp

12* 0.6156614753 = Opp

7.3879377...

7.4  is the answer  

Write an algebraic expression or equation to represent each word phrase.
Five times the sum of a number n and eleven

Answers

Answer:

{ N+11 }x5

Step-by-step explanation: First you have to add <n> plus eleven. In order to get a sum, you must multiply by five.

What is greater than 4.026

Answers

Answer/Step-by-step explanation:

The number 5 is greater than 4.026

Hope this helps!

Answer:

4.027

Step-by-step explanation:

Just add a number to the problem

plz help me out with this

Answers

Answer:

B and a great deal on a spring break and a good time to get answer for the spread of Islam in the Horn of the following elements has your examination and your

which equation represents this graph?

Answers

Answer:

It would be the 1st answer, y= 3/2x + 2.

Step-by-step explanation:

The intersection on the Y axis determins the "+2". To find the slope, it is always x/y. It rises 3, and runs 2. Hope this helps

NEED HELP FAST PLEASEEE!!

Answers

Answer:

y=2x+0

Slope:  

2

y-intercept:  

( 0, 0 )

Step-by-step explanation:

Slope intercept form: y=mx+b

Use the slope formula and the slope-intercept form to find the slope  m  and y-intercept  b .

Please helppppppppppp

Answers

Answer:

21.92

Step-by-step explanation:

division

87.68 ÷ 4

Answer:

The answer is 21.92

Step-by-step explanation:

87.68 divided by 4

There is 4 people and the total is $87.68

Given the table, how can you use a graph to find additional equivalent ratios? x y 2 3 4 6 Plot the ordered pairs (2, 3) and (4, 6). Start at (4, 6). Move right 3 and up 2, and then plot a point. Keep this same rate to get other points. Draw a line through the two given points. Any point below the line represents an equivalent ratio. Plot the ordered pairs (2, 4) and (3, 6). Start at (3, 6). Move right 2 and up 3, and then plot a point. Keep this same rate to get other points. Draw a line through the two given points. Any point on the line represents an equivalent ratio.

Answers

Answer:

i know im late but i think the answer is A.

Step-by-step explanation:

im sorry if im wrong but its the most reasonable answer.

Answer:

A

Step-by-step explanation:

Rajan had 30 dollars to spend on 3 gifts. He spent 9 1 4 dollars on gift A and 5 4 5 dollars on gift B. How much money did he have left for gift C?

Answers

Answer:

$15 1/10

Step-by-step explanation:

Given that :

Total amount to spend = $30

Amount spent on Gift A = $9 1/4

Amount spent on Gift B = $5 4/5

Amount left to spend on gift C ;

$30 - (9 1/4 + 5 4/5)

$30 - (37/4 + 29/5)

$30 - (185 + 116)/20

$30 - 298/20

30/1 - 298/20

$(600 - 298) / 20

$302/20

$15 2/20

= $15 1/10

HELP WITH MATH PLSSSSSSSSSSSSS

Answers

Answer:

Undefined

Step-by-step explanation:

Whenever there's a perfectly straight vertical line, its classifies as undefined

what is the meaning of the slope in this situation?

Answers

Answer:

add a photo please do we can help you better

Answer:

The picture is non-existent

The mean and standard deviation of the sample data collected on continuous variable are -0.25 and 0.03, respectively. The following table shows the
relative frequencies of the data in the given intervals.
Interval
Relative Frequency
0.02
0.15
0.33
-0.34 < x < -0.31
-0.31 <<< -0.28
-0.28 << -0.25
-0.25 < 3 < -0.22
-0.22 <3 < -0.19
-0.19 <<< -0.16
0.36
0.11
0.03
Based on the table, do the data support the use of a normal model to approximate population characteristics?
A Yes, because the sum of the relative frequencies is 1.00.
B
Yes, because the distribution of relative frequencies is very close to the empirical rule for normal models.
с
No, because the values are negative and normal models are used for positive values.
D
No, because the distribution of relative frequencies is very far from the empirical rule for normal models.
E
No, because the sample size and the population parameters are not known.

Answers

Answer:

B

Step-by-step explanation:

I know because I know that how

The correct answer is D. No, because the distribution of relative frequencies is very far from the empirical rule for normal models.

What is Mean?

The sum of all values divided by the total number of values determines the mean (also known as the arithmetic mean, which differs from the geometric mean) of a dataset. The term "average" is frequently used to describe this measure of central tendency.

To determine if the data supports the use of a normal model to approximate population characteristics, we need to examine the relative frequencies and see if they exhibit a bell-shaped or normal distribution.

Looking at the table, we see that the relative frequencies are not symmetrical and do not follow the empirical rule for normal models.

The largest relative frequency is in the interval from -0.28 to -0.25, and the frequencies decrease as we move away from this interval. Additionally, there are negative values in the data, which is not a characteristic of normal models.

Therefore, the correct answer is D. No, because the distribution of relative frequencies is very far from the empirical rule for normal models.

Learn more about Mean here:

https://brainly.com/question/521501

#SPJ7

plz help me with this

Answers

Answer:

its green so you got it right

and if thats not the case you are correct

Step-by-step explanation:

Order the sides of each triangle from shortest to longest.

Answers

Answer:

A.

Step-by-step explanation:

the line that's PR is longer than OR

wut anime do u guys watch comment down below and you'll get brainliest as well 2x2 just in case it would deleted i will also put math equations 2x3x4x5

Answers

I feel like the answer to this complex equation would have to be naruto . It’s an older one that everyone knows but still such a good show

If the following data were transformed, and points with the coordinates (x.log()) were plotted, what points would be plotted? Round log() to threedecimal places

Answers

I think it’s A because I think it’s multiplying each number

Answer: It’s D

Step-by-step explanation:

What is the lcm of 6/8 and 4/32?

Answers

Answer:

Step-by-step explanation:

The LCM is 416. What is the least common multiple of 4 6 and 8? 4, 6 and 8 are small numbers and their LCM can be found out by writing their multiples:4: 4, 8, 12, 16, 20, 24, 28, 32,...6: 6, 12,...

What is $27.00 in cents

Answers

2,700!!!!!!!!!!!!!!!!!!!!

Answer:

2700

cents

Step-by-step explanation:

Aisha wants to paint the four walls of her living room.
Each wall is 2.4 m high and 3.7 m long.
One wall has a door of 2 m by 0.7 m.
Tins of paint cost £12 per 1.5 L tin.
Each litre of paint can cover 8 m2 of wall.
There is an offer of: Buy 2 tins get the 3rd at half price.
How much will Aisha pay to paint her living room?

Answers

9514 1404 393

Answer:

  £30

Step-by-step explanation:

The total area of the four walls is ...

  A = 4 × LW

  A = 4 × (2.4 m)(3.7 m) = 35.52 m²

Subtracting the area of the door, we find the painted area to be ...

  35.52 m² -(2 m)(0.7 m) = 34.12 m²

Painting this area will require ...

  (34.12 m²)/(8 m²/L × 1.5 L/tin) = 2.8433... tins

Aisha will need to buy 3 tins of paint, for which she pays 2.5 times the price of 1 tin:

  2.5 × £12 = £30 . . . . Aisha's cost to paint her living room

£25 or £20.10

Step-by-step explanation:

calculate the area to be painted:

2.1x4.5= 9.45m^2 for each wall

x4= 37.8m^2

area of door= 1.8x0.9= 1.62m^2

subtract the area of the door from the wall area

37.8-1.62= 36.18m^2 to be painted

divide the area by the area that 1L of paint can cover

16.18/12= 3.015 L needed

if 1.5L= £10 then, 3L= £20. she needs 2 cans + an extra 0.015 L- so another can (3 cans total) add price up.

£30- but buy 2 get 3rd 1/2 price, so take £5 off. price is £25

or

calculate price for 0.015L

1.5=£10

divide both sides by 100

0.015= £ 0.10

if 1.5L= £10 then, 3L= £20. she needs 2 cans + an extra 0.015 L

£20+£0.10= £20.10

I DONT KNOW IF THIS IS RIGHT but hope it helps :)

Simplify:
3x (x^2 + 5x – 4)

Answers

The answer is 3x^3+15x^2-12x.

Lydia made 3 pounds of trail mix. One portion of trail mix is 19 pound. How many portions of trail mix did Lydia make?

Answers

Answer:

I have the same question but no one will help me

Step-by-step explanation:

rectangle
rhombus
square
isosceles trapezoid

Answers

Answer:

Rhombus

Step-by-step explanation:

It does not have congruent diagonals

DETERMINE THE MISSING SIDE

Answers

Answer:

21 in

Step-by-step explanation:

by the Pythagorean theorem we have

[tex]841=400+x^2\\\\x^2=441\\\\x=21[/tex]

notice that the 841 and the 400 don't go squared because they already squared!

Fill in the blanks!!

(Will be given brainliest for the correct answers)

Answers

Answer:↓↓↓

Step-by-step explanation:

We are given that side AB is congruent to BD. We are also given that side AC is congruent to CD.

We know that side BC and side CB are congruent because of the Reflexive property.

Therefore, ΔABC and ΔDBC are congruent because of SSS Postulate.

Hope this helped!

How to solve and the answer

Answers

Answer:

x = 10; y = 10

Step-by-step explanation:

[tex] \sin(theta) = \frac{opposite}{hypotenuse} [/tex]

[tex] \cos( {theta} ) = \frac{adjacent}{hypotenuse} [/tex]

[tex] \tan( {theta} ) = \frac{opposite}{adjacent} [/tex]

theta = 45°

opposite = x

hypotenuse = 10√2

adjacent = y

1) find x using sin formula

[tex] \sin(theta) = \frac{opposite}{hypotenuse} [/tex]

[tex] \sin(45) = \frac{x}{10 \sqrt{2} } [/tex]

[tex] \sin(45) \times 10 \sqrt{2} = x[/tex]

[tex]10 = x[/tex]

[tex]x = 10[/tex]

2) find y using cos formula

[tex] \cos( {theta} ) = \frac{adjacent}{hypotenuse} [/tex]

[tex] \cos(45) = \frac{y}{10 \sqrt{2} } [/tex]

[tex] \cos(45) \times 10 \sqrt{2} = y[/tex]

[tex]10 = y[/tex]

[tex]y = 10[/tex]

Other Questions
need helps pls will give thanks How are modern maps and ancient maps similar?a.They both feature three-dimensional drawings.b.They both rely on art and science for mapmaking.c.They both rely on paper-based drawings of an area.d.They both focus on the physical features of an area. 3(2(8-2x4)+25divided by 5 )-(2(8 divided by 4x2)-7(7-2x3) Calculate the volume of 1280 kilograms of aluminium if the density is 2700kg/m3 can you please help me:) What is a central idea in the Newsela article "Washed-Up Plastics Become Art with a Vital Message"?Children enjoy the art displays of sea creatures.Many people now look for trash to pick up when they are visiting the beach.Creating artwork can be both beautiful and horrifying.Increased awareness of the dangers of ocean pollution are creating interest in Pozzi's art.Question 2Part BWhich detail from the text best conveys the answer in Part A?"'It's the only thing he's liked all day,' his grandmother said.""An army of about 10,000 volunteers in Oregon help her collect, prepare and assemble the beach trash into art.""All of the art is made from plastic trash that washed ashore, including a great white shark""She now has more than 70 pieces in three exhibitions currently traveling throughout the United States. She also has requests from overseas." Please help 4 questions for 10 points!!!------------------------------------------------------------1) Which expression is equivalent to 4(23)?4(20+3)4(2+3)4(2+13)4(20+30)..................................................................................................2. Which expressions are equivalent to 4(42)?Select each correct answer.4(20+22)4(40+2)4(4+20)4(4+2).......................................................................................................3.Which expression shows how 645 can be rewritten using the distributive property?640+6206+205640+6564+65...............................................................................4.Tori uses the greatest common factor and the distributive property to rewrite this sum:24 + 84What expression does Tori write?2(24+42)12(2+7)24(1+4)4(6+21).....................................................................my last one got deleted.... paid rent of Rs.25000 by cheque. make journal entry Use a number line to order the numbers from least to greatest. HELLLPPPP!!!!! Three hundred cars drove over a bridge in 23 minutes. At that rate, howmany cars would drive over the bridge in 138 minutes? write the code for RNA from this DNA STRAND :AAAAAATTTTTTCCCGGGGTTTATATATC Only________ can declare war! RIP grandsonhow does earths crust change earths surface [2.1 + (9.2 x 3.3)] x 0.8 PLEASE HELPPFill in the blanks in the following sentences with the logical word(s). Pay attention to the pronunciation.Spell out the following numbers in french: 1. 200:2. 256:3. 987:4. 875:5. 435:Based on the context, fill in the blanks in the following sentences with either the logical word or the appropriate forms of voir or croire. Say the whole sentence aloud.6. Est-ce que tu crois________Paul va aller au cinma ce soir?7. Elles_________les pommes sur la table.8.________vous aux fantmes?Oui! Vous_________ce fantme, l! Mais non, je ne le___________pas! Name the factors in each of the following problems i need help lol i forgot how to do this Q.Ankit said to Rita, " It is your last chance." 1.Ankit said Rita it is your last chance. 2.Ankit told Rita that it is her last chance. 3.Ankit told Rita that it was her last chance. 4.Ankit told Rita that it was their last chance. what is the circumference of this circle? (Use C = [tex]\pi[/tex]d; [tex]\pi[/tex] = 3.14.)giving 20 points to the person who answers! no need to show your work, thank you. y32c-4-3 -2 -1-1+1 2 3 4-2+-3+-4+41What is the slope of the line?