To avoid the problem of groupthink always choosing a group leader to direct the group.
What is the roles of group leader?A group leader is responsible for overseeing and distributing fair tasks to the members, ensuring clear instructions and procedures. Group leaders are mainly the ones leading the team towards their success.
Group leaders supervise, coordinate, instruct, and manage groups in a variety of settings. Depending on their field, group leaders may require specific qualifications and additional skills. Group leaders can work in education, finance, engineering, human resources, healthcare, and more.
A good leader must stay attuned to what is going on with their team and company to make informed decisions. To be a great leader is to be a great communicator – and great communicators listen. Good leaders are proactive and intuitive listeners.
Learn more about group leaders:
https://brainly.com/question/29838184
#SPJ1
The nucleoid occlusion mechanism is critical for the timing of chromosome partitioning. This mechanism ensures that _____. A. the Z ring forms before chromosome segregation B. the Z ring forms after the cell wall synthesizing machinery is assembled C. the Z ring forms after chromosome segregation D. the Z ring forms after the divisome is assembled
Answer:
C. The Z ring forms after chromosome segregation
Explanation:
Nucleoid occlusion, NO, is a mechanism in which the nucleoid prevents the the division of the chromosome in the cell's cylindrical part before segregation of the chromosome around the middle of the cell
NO is achieved by not allowing the formation of Z ring formation close to the nucleoid, (before the chromosome is segregated) thereby aiding the specification of the septation location
Therefore, the Z ring is formed after the chromosome is segregated
3x + 2y = 6 is an equation in standard form.
Answer:
3x+2y=6xy because we have to add
PLZ HELP ASAP I NEED THIS NOW
reproductive system brain pop Worksheet
Help please?
Durante el 2° período académico, los estudiantes de 7° de un colegio de Armenia estudiaron los diferentes tejidos vegetales e hicieron un experimento con una planta de fríjol. Para el experimento, regaron con agua únicamente las hojas superiores de la planta, impidiendo por completo la caída de agua a la tierra en la maceta. Al cabo de 1 mes arrancaron la planta de raíz para estudiar esta zona y se dieron cuenta de que, si bien la tierra estuvo completamente seca durante todo el mes, las raíces se habían mantenido bien hidratadas. ¿Qué tejido podría explicar los resultados observados por los estudiantes de 7°?
Explica qué son los codones y los anticodones La siguiente secuencia de nucleótidos de ADN codifica para una secuencia de aminoácidos que forman una proteína hipotética, encuentre la secuencia de codones, anticodones y aminoácidos que se forman 5 ` A T G A G C A C C C A A A C T T G C TC T T A T T C T A A A A A G A C T 3
Answer and Explanation:
La informacion genetica de ensamblaje de aminoácidos durante la sitntesis proteica, se almacena en unidades llamadas codones.
Un codón es una secuencia corta de tres nucleotidos provenientes de la cadena de ADN o ARN mensajero. Cada codón representa uno de los 20 aminoácidos disponibles para sintetizar la proteina. En total hay 64 codones, de los cuales 61 codifican aminoácidos (mas de un codón puede codificar para el mismo aminoácido), de los cuales uno de ellos a parte es el codon de inicio de sintesis proteica. Los restantes tres codones corresponden a codones de finalización.
El anticodón es la secuencia de nucleótidos presentes en ARN de transferencia, que complementa a cada codón de ARN mensajero. De esta forma el ARNt reconoce el aminoácido correspondiente y lo ensambla en la nueva proteina.
ADN ⇒ 5 ` ATGAGCACCCAAACTTGCTCTTATTCTAAAAAGACT 3
Codones ATG-AGC-ACC-CAA-ACT-TGC-TCT-TAT-TCT-AAA-AAG-ACT
ARNm ⇒ UACUCGUGGGUUUGAACGAGAAUAAGAUUUUUCUGA
Codones UAC-UCG-UGG-GUU-UGA-ACG-AGA-AUA-AGA-UUU-UUC-UGA
Recordá que para ARNm, la secuencia de nucléotidos debe ser la complementaria para ADN.
Anticodones de ARNt ⇒ Complementarios a los codones de ARNm. Recordá que para los ARN, la timina se reemplaza por uracilo.
AUG-AGC-ACC-CAA-ACU-UGC-UCU-UAU-UCU-AAA-AAG-ACU
La proteina se construye en función de la información del ARNm, es decir que para la selección de aminoácidos, se consideran los codones del ARNm, y no los anticodones de ARNt.
UAC-UCG-UGG-GUU-UGA-ACG-AGA-AUA-AGA-UUU-UUC-UGA
TYR SER TRP VAL Stop THR ARG ILE ARG PHE PHE Stop
The huge U.S. Army base at Fort Bragg, North Carolina is home to a number of butterflies, plus other endangered animals and plants. Howitzers used during artillery training kill some of the butterflies, but fires started by the howitzer blasts also produce conditions in the base’s forests and wetlands that the butterflies need to survive. This is an example of which characteristic of military bases that makes them useful for conservation?
Answer: Because they cause a disturbed ecosystems.
Explanation: It is evident that the military base provided both survival and elimination platforms for the butterflies species, translating that the butterflies are living in a disturbed ecosystem.
Hence, this provides a good template to understudy conservation for the purpose of maintaining and making wise-use of important wildlife resources and most importantly, the endangered species. Butterflies species dynamics had been used as an important tool for conservation for years now.
A Canyon landscape is of economic importance to an area. Explain
how this landscape can be utilized to secure economic sustainability
to the inhabitants.
Answer:
.
Explanation:
............................
The financial advantages of a canyon landscape are contingent on careful management and long-term use. Careful preparation and oversight can ensure that the canyon's natural resources and attractiveness are conserved while also benefiting the local community's economic well-being.
What is Canyon landscape?A canyon landscape is a form of topography characterised by deep and narrow valleys with sides that are steep, which are frequently created over time by a river or other water sources. Canyons varies in size spanning small gorges to enormous networks of interconnected valleys and can be found all over the world, from barren deserts to lush forests.
Canyons are primarily formed by erosive processes that include water, wind, and ice, that erode away the soil and rock gradually over time. The canyon walls get steeper and more prominent as the surrounding ground erodes, creating a distinct environment that is frequently physically attractive and ecologically varied.
Therefore, careful preparation and oversight can ensure that the canyon's natural resources and attractiveness are conserved while also benefiting the local community's economic well-being.
Learn more about Canyon landscape, here:
https://brainly.com/question/22035152
#SPJ2
IS THIS CORRECT IF NOT WHATS THE ANSWER FAST PLS
What do the bullhorn acacia
trees get from the acacia
ants?
Answer:
The plants provide food and accommodation in the form of food bodies and nectar as well as hollow thorns which can be used as nests. The ants return this favor by protecting the plants against herbivores
Explanation:
What is likely to happen to a healthy population that is experiencing exponential growth ?
In what part of the plant are substances transported to where they are needed?
A. Roots
B. Stem
C. Leaves
Answer:
B. Stem.
hope it helps
stay safe healthy and happy.Answer:
B. Stem
Explanation:
In the stem part of the plant are substances transported to where they are needed. So, the option (B) is the correct answer.
list out the significance of Crop improvement.
Answer:
Plant breeders create crop varieties that can resist harsh circumstances such as cold, drought, and wind by tailoring the variety's development cycle to the available growing season.
Explanation:
Choose three things that blood transports throughout the body.
Nerve impulses
French fries
DNA
nutrients
wastes such as CO2
oxygen
Answer:
nutrientswastes such as CO2oxygenExplanation:
Blood brings oxygen and nutrients to all the parts of the body so they can keep working. Blood carries carbon dioxide and other waste materials to the lungs, kidneys, and digestive system to be removed from the body. Blood also fights infections and carries hormones around the body.
The body's transportation system, the blood, transports innumerable compounds to different parts of the body. Blood carries three things throughout the body: Oxygen, nutrients, and wastes such as carbon dioxide (CO2).
1. Blood carries oxygen from the lungs to all the cells of the body. Cellular respiration requires oxygen to generate the energy (in the form of ATP) that drives many bodily activities.
2. Blood carries nutrients absorbed by the digestive system to cells throughout the body. These nutrients, which are essential for growth, repair and building energy, include glucose, amino acids, fatty acids, vitamins and minerals.
3. Wastes such as [tex]CO_2[/tex]: Removes carbon dioxide from the blood cells, which is a byproduct of cellular metabolism, and carries it to the lungs for expiration. The acid-base balance of the body is maintained by this mechanism.
Learn more about Blood, here:
https://brainly.com/question/32316698
#SPJ6
When considering ecosystem biodiversity, why would it be dangerous to treat each ecosystem as an isolated environment?
1. each ecosystem has a constant and consistent number of predators
2. rainfall is global occurrence that impacts every ecosystem on the planet
3. environmental conditions appearing in one ecosystem may appear in another
4. there are complex interactions that take place between ecosystems
Answer:
1
Explanation:
they can never be mixed
helppppppp plzzzzzzzzzzzzzzzzz
Answer:
A
Explanation:
Im not sure what this is but im pretty sure its A it just seems the most logical but once u get someone good to answer this tell me if u got it right or not im curious bhaaajjajaja
which structure is unique to eukaryotic cells
Answer:
Unlike prokaryotic cells, eukaryotic cells have a membrane-bound nucleus, a central cavity surrounded by a membrane that houses the cell's genetic material. A number of membrane-bound organelles, compartments with specialized functions that float in the cytosol.
Explanation:
hope this helps
Needed substances are carried to the body cells by:
A)enzymes
B)blood
C)water
D)food
Which of the following best contrasts the structures found in plant and animal cells?
A. Animal cells have a large vacuole, a cell wall, and chloroplasts while plant cells have small vacuoles, no chloroplasts, and no cell wall.
B. Animal cells have small vacuoles and no chloroplasts while plant cells have chloroplasts, a large vacuole, a cell wall.
C. Animal cells have small vacuoles, a cell wall, and no chloroplasts, while plant cells have a large vacuole, no cell wall and chloroplasts.
D. Animal cells have a large vacuole and no chloroplasts while plant cells have small vacuoles, chloroplasts, ands a cell wall.
Answer:
B
Explanation:
The answer is B because animals have small vacuoles and no chloroplast while plants cells have chloroplast, a large vacuole, a rigid cell wall.
Why aren't human gonads up near our heart like they are in fish?
Nick has had a very stressful job for more than 10 years. At Nick’s annual doctor’s visit, what effects would the doctor most likely identify in Nick?
Answer:
don't known ask the goggle
A city installs recycling centers that take wood products. How might the
recycling centers help increase the availability of wood?
O A. Recycling increases the cost of wood.
O B. Recycling increases the consumption of wood.
C. Recycling increases the supply of wood.
D. Recycling increases the demand for wood.
Answer:
C. Recycling increases the supply of wood
The shape of a protein is most directly determined by the (1) amount of energy available for synthesis of the protein (2) kind and sequence of amino acids in the protein (3) type and number of DNA molecules in a cell (4) mistakes made when the DNA is copied
Answer:the answer is 2 kind and sequence of amino acids in the protein
Explanation:
what do you mean by faunal Diversity
Answer:
animal life especially
Explanation:
i hope it helps
this is my answer
correct me if im wrong
#carryonlearning
what are strengths and weaknesses of oxygen? will be giving brainliest if you are right :)
Answer:
Explanation:
Oxygen is a strong oxidizing agent and has the second-highest electronegativity of all reactive elements, second only to fluorine.
Oxygen can damage us though. It can react with many different types of molecules. It can damage things like amino acids, proteins, and the nucleic acids
What are the products (comes out) of cellular respiration? (select all that apply)
A. Carbon dioxide
B. oxygen
C. Water
D. Glucose (sugar)
What are the products (comes out) of cellular respiration? (select all that apply)
A. Carbon dioxide
B. oxygen
C. Water
D. Glucose (sugar)
Well Well Hello again XD, trust me when i say i'm not stalking you UvU...i'm just really into biology XDAnyway the answer to your question is:
Carbon dioxide and Water!!I apologize if i'm wrong//You're welcome if i'm correct((-Side Note-)): glad i could help lol
I hope you have a great day ^v^"Plant cell walls connect with other plant cell walls to create plants
A. organelles
B. mega cells
C. vacuoles
D. tissue
IS THIS CORRECT?? IF NOT WHATS THE ANSWER PLEASE
The organ systems work in isolation.
A. True
B. False
Answer:
B. False
Explanation:
No system of the body works in isolation. So, option (B) is correct.
Answer:
true
Explanation:
hope this helps
What is the main function of the endocrine system?
A. secrete hormones
B. send nerve impulses
C. produce blood cells
D. produce DNA
Answer:
I think the answer to your question is option A , secrete hormones
