How did the Nazi belief in the superiority of the Aryan race influence the Nazi treatment of Jews?
A- The Nazis were disturbed by the Jewish claims to be members of the Aryan race as well.
B- The Nazis wanted to keep Jews from resenting the Aryans and rising up to attack them.
C- The Nazis we’re concerned that most Jews were communists who believed in eliminating social classes.
D- The Nazis sought to rid Germany of Jews, whom they saw as ethically inferior to the Aryan race.
*urgent!!*

Answers

Answer 1

Answer:

c

Explanation:

Answer 2
The answer for this question is C.

Related Questions

oml pls help with this question will mark branliest :)))

Answers

Answer:

A

Explanation:

The answer would be A.

Explain the effect that cheap gasoline prices had on how/where many Americans lived.
in the 1950s

Answers

Much has online answer bad English

9.
Read the passage.

Excerpt from “A House Divided”
a speech by Abraham Lincoln

“A house divided against itself cannot stand.”
I believe this government cannot endure, permanently, half slave and half free.

I do not expect the Union to be dissolved—I do not expect the house to fall—but I do expect it will cease to be divided.

It will become all one thing, or all the other.

What does the house symbolize?


Abraham Lincoln’s home


a government building


the entire world


the United States as a whole

Answers

Answer:

The United States as a whole.

Explanation:

In his speech titled "A House Divided", Republican candidate representative Abraham Lincoln talks about "a divided house" and how it could lead to disaster rather than success. This metaphorical speech is taken from the teachings of Jesus in the Gospels of Matthew, Mark, and Luke.

In the speech, he alludes to the nation of the United States as a house, a single umbrella entity. He also declares, "a house divided against itself cannot stand." Here, his reference to "a house" is the nation as a whole.

Thus, the correct answer is the fourth option.

The slave laws of South Carolina were likely affected by the fact that:
A. Most of its leaders were not Christian.
B. Many of its settlers were artisans.
C. Many of its settlers came from the Caribbean.
D. Most of its land was used for family farming.

Answers

Answer:

D

Explanation:

A majority of South Carolinas population and leadership were christian, settlers mostly came from a farming background or looking for opportunity, and they mostly came from Britain.

The answer is C. Many of its settlers came from Caribbean. In between 1662 - 1807, Britain shipped almost more than 3.1 Million slaves across the Atlantic Ocean, where Africans where brought to the British owned colonies in the world. Specifically the Caribbeans; they were tasked to work on plantations daily.

Which of the following industrialist is not matched correctly with his industry?
1) Carnegie- steel
2) Rockefeller-oil
03) Morgan-airplanes

Answers

Answer:

Morgan

Explanation:

He did finance

european imperialism in the 19tn century was largely motivated by a desire to

Answers

Answer:

European imperialism in the 19th century was motivated by the desire of acquiring raw materials for their industries. Other motives were for power and territory expansion. In the 19th century, power can be seen through how many colonies were under a European nation.

Answer:

raw materials for there industries and other reasons for power and territory expansion

Explanation:

hope it helps

Which dynasty was in power during Islam’s Golden age?

Answers

Answer:

abbasid

Explanation:

Abbasid Caliphate

The Abbasid Caliphate was in power during Islam's golden age. The beginning of the golden age is in 786, when Harun al-Rashid came to power. please trust me mark me as brainliest trust me

The Abbasid Caliphate was in power during Islam's golden age. The beginning of the golden age is in 786, when Harun al-Rashid came to power.

What two issues worried Austria in the years before WW1?

Answers

Answer: The answer is C.

FIRST TO ANSWER GETS BRAINLIEST!!!
Which of the following statements about James Long is TRUE?

a. He disagreed with the boundaries of the Adams-Onis treaty.

b. He believed Texas should be free from Spain and under Mexican governance.

c. He was a pirate who led the revolutionary ships in a convoy.

d. He was a rebel revolutionary from the Galveston Island. ​

Answers

Answer:

he was a rebel revolutionary from the galveston lsland.

La corona española no contaba con una economía que le permitiera financiar las expediciones de conquista, de manera que estas fueron abordadas como: a) Empresas privadas b) Empresas globales c) Empresas financiadas por el papa d) Empresas públicas Ayúdenme por favor

Answers

Answer:

A) Empresas privadas.

Explanation:

La Corona Española empleó la figura de las capitulaciones, que por regla general hacía que las expediciones de conquista corriera a expensas del conquistador y su comitiva, además de establecer condiciones en las que tanto la Corona como el conquistador y sus expedicionarios obtenían beneficios.

En consecuencia, la respuesta correcta es A.

during the second industrial revolution, railroad expanison increased settlement in

Answers

3 different states yeah 3

compare and contrast the Treaty of Versailles and Woodrow Wilson's

Answers

Answer:

Treaty of Versailles and President Wilson's 14th points.

Explanation:

Both the Treaty of Versailles and 14th points are somewhat related as they both deals with Germany. Both tried to punish Germany because of the First World War which bought deaths and destruction.

Both wanted the return of Alsace Lorraine to France.

The 14th Points by President Wilson were less harsh than the Treaty of Versailles which was imposed by Allied powers with France, Britain, etc.

The 14 points are mainly to establish countries independence in Europe with peace. The treaty focuses on punishing the Germans by putting the blame and reparation terms.

Question 12
1 pts
hunted with horses
the Eskimos
Aztecs
the Plains Indians
Maya
Incas

Answers

Answer:

The plains Indians

Explanation:

The Mayans, Incas, and Aztecs typically primarily hunted on foot. The Eskimos did also hunted on foot in large groups. It was usually too cold for horses.

I hope this helped :)

PLEASE HELP!!!

3.Why are Africa's borders considered "arbitrary?" or freely and poorly drawn up?


Answers

Answer:

B

Explanation:

I'm not too sure about this myself so when in doubt, pick the wordiest one

Question 8
What do
you call millions of stars that group or cluster together?
solar system
O pictographs
O galaxies
universe

Answers

Answer: number 3: galaxies

How did the Kingdom of Piedmont in northern Italy defeat Austria and gain control of unification efforts across Italy?

Answers

Answer:

Foreign country helps Italy in its unification.

Explanation:

The Kingdom of Piedmont that is located in northern Italy defeat Austria and gain control of unification efforts across Italy because Italy was unable to defeat Austria and unify all its states. Italy would not be able to achieve independence or unity without foreign help so due to the help of Kingdom of Piedmont in the defeat of Austria, Italy was able to unify the country which was captured by Austria so we can say that foreign country helps Italy in its unification.

What did the Pacific Railroad Act of 1862 do? Check all of the boxes that apply.

Answers

Answer:

Established the Union Pacific Railroad Established the Central Pacific Railroad. Gave livestock to railroad companies. Gave loans and land to railroad companies. Decided where the railroad would meet in the middle.

Visual sources should be used within the discussion to reinforce and
explain the written information​

Answers

Answer:

True

Explanation:

It is TRUE that Visual sources should be used within the discussion to reinforce and explain the written information​.

The above statement is correct because visual sources reinforce and increase the interest of students or learners during the teaching process. Similarly, the visual sources also aid the teacher to explain the concept that is being taught better. Visual sources also give students or learners clear pictures of what is being taught.

Explaining the Effects of the Dred Scott Decision What were the results of the decision in the Dred Scott case? Check all that apply.

Answers

Answer:

In simple words, Abolitionists were angered by the Dred Scott decision, which they considered as a method for the Supreme Court to put an end to discussion about enslavement in the colonies The split among the North and the South over slavery widened until southern states seceded from the Union as well as the Confederate Counties of America was formed.

The answers are:

-Congress was not allowed to ban slavery in the territories.

-African Americans were not allowed to become US citizens.

-Northerners feared that slavery would become legal across the nation.

I just did the question..

When students are listening, speaking, and observing, they are _______ in the learning process?

Answers

Answer:

Participating

Explanation:

Because if they are paying attention they would be participating.

When students are listening, speaking, and observing, they are Participating in the learning process.

What is learning?

The process of picking up new information, skills, values, attitudes, and preferences is known as learning. Humans, animals, and some robots all have the capacity to learn, and there is evidence that some plants also have this capacity.

Gaining new abilities, information, perspectives, and values is the process of learning. Helping someone or a group of people learn is something that people can accomplish on their own, however, it's usually made easier with education.

Any intentional action or resource that supports learning at the individual, group, or organizational level is considered a learning strategy. Employees must be able to change their competencies in order to support the organization's strategy in circumstances where business is changing quickly.

Therefore, By listening, speaking, and observing, they are Participating in the learning process.

Learn more about learning here:

https://brainly.com/question/1503472

#SPJ2

Komisyung Konstitusyun na pinamumuan ni hukom​

Answers

Sorry don’t understand
what are you trying to ask here?

How did Napoleon change the bureaucracy?

Answers

Answer:

Napoleon held absolute power in the new government and crowned himself Emperor Napoleon I two years after being named consul for life. He made peace with the Church, codified the French laws, developed a new bureaucracy, and spreaded principles of the revolution.

Explanation:

en que influyeron la presencia de las islas en la vida de los antiguos griegos?

Answers

Answer:

Grecia es en escencia un conjunto de penínsulas con geografía muy irregular, debido a la enorme cantidad de pequeñas penínsulas, itsmos, y montañas que tiene ésta región. Al mismo tiempo, Grecia se encuentra al frente del Mar Egeo, el cual está lleno de islas, desde algunas que tienen un tamaño considerable como Creta, a otras que son muy pequeñas como Mikonos.

Explanation:

La presencia de islas representó para los antiguos griegos la insularización de su cultura, ésto quiere decir que si bien los griegos se reconocían a sí mismos como parte de un conjunto más o menos cohesionado, al mismo tiempo, convivían con grandes diferencias entre sí precisamente debido a lo irregular de la geografía, a que la comunicación entre islas es más complicada que en un espacio continuo de tierra firme. Éste tipo de geografía promovió entonces la desintegración política, la diversidad cultural, e incluso, la beligerancia entre los diferentes pueblos y ciudades estado griegas de la épica.

what did the song dynasty invent in transportation?

that's it.

Answers

During the Song Dynasty there were canals built that connected to the main rivers. The compass was also invented and they used it for navigation.

8. List any 3 most important ways of protecting Arab-Islamic culture.

Answers

Answer:

Avoiding the adaptation of foreign cultures and promote our Arab-Islamic culture.

Explanation:

Avoiding the adaptation of foreign cultures, transfer the Arab-Islamic culture in the next generation through education and provides environment to children of  Arab-Islamic culture are the three ways of protecting Arab-Islamic culture. If we adopt some aspects of the western culture so our children will follow the western culture and our future generation will not know about our beautiful Arab-Islamic culture.

What conflict over land has caused problems in the Middle East and has also resulted in acts of terrorism throughout the world?

Answers

Answer:

In simple words,The first proxy war began with both the Iran-Iraq conflict (1980-1988), when Saudi Arabia began to support Iraq in order to assist in their development. When the Americans attacked Iraq and deposed Saddam Hussein in 2003, Iraq remained the site of yet another proxy conflict between the two countries.

This war initiated the building of informal forces by the countries of middle east such as ISIS etc. which further led to the conditions that we evidence today.

Which right does Article I, Section 11 of the Washington State Constitution protect?

A. Freedom of speech
B. Freedom religion
C. Right to an attorney
D. Right to bear arms

Answers

Your answer is freedom of rely

Why did the Cold War result in an “arms race”?

Answers

Because when they did battle they lost and became evil

Answer:

Well, the US built Nuclear weaponary to orrignally to discourage the Soviet commusisim expansion. But, when the Sovets tested out their own nuclear weapon, the arms race started.

Explanation:

What was the Minie Ball?
A cannonball that could travel twice as far.
A cannonball that could travel twice as far.

A missile that could sink an Ironclad ship
A missile that could sink an Ironclad ship

A bullet that could be loaded quicker and fired more accurately.
A bullet that could be loaded quicker and fired more accurately.

A bullet that could be shot multiple times without having to reload.
A bullet that could be shot multiple times without having to reload. no links please help

Answers

Answer:

A bullet that could be loaded quicker and fired more accurately

Explanation:

This was a type of bullet developed by the French army officer Claude-Etienne Minié, in the year 1849. It was used during the American civil war. Minié developed this bullet because tradidional ammunition had to engage the spiral grooves, or rifling, inside the rifle barrel, had to be equal in diameter to the barrel, and shooters would have to jam the bullet into the rifle by force.  Because of this the rifles would become increasingly difficult to load as the barrel became dirty with gun powder residue. This bullet was smaller than the diameter of a rifle barrel, and could be easily loaded, even when the rifle became dirty.This gave rise to the ammunition that we see today. :)

Define the term poverty threshold.

Answers

Answer:

The poverty threshold, also known as the poverty limit, the poverty line, or the breadline, is the lowest level of income considered sufficient in a certain society. The poverty line is generally determined by adding up the entire cost of all basic resources consumed by an average human adult over the course of a year.

Other Questions
If he jumps from the plane with a velocity of +2 ft/s and, after 7 seconds of free fall, he has a velocity of -223ft/s, what is his displacement? Albino Moth - Unknown Allell is listed here. Transcribe it into mRNA andthen translate it into amino acids using the codon table. You only need topost the amino acids. DNA - TGG GGT AAG GAC GAG CGC ATC CAGAGPheUUUUUC)UUAUUGCysUGUUGCUGAUAUUAC)TyUAAStopSerLeuStopUGGTrpUCUUCCUCAUCGCCUCCACCGUAG)CAUTCAC)CUUCUCCUACUGHisLeuProCGUCGCCGACGGArgCAACAG)AAUGinlleSerAUUAUCAUAAUGACUACCACAACGThrAAC) AsnAGUAGC)AGAAGG)Met 13GAUArgGUUGUCValGCUGCCGCAGCGAlaGAC} AspGGUGGCGGAGGGGlyGUAGAAGAGGluGUG If two opposing forces are equal, then the net force is 0 N.true or false? Which is a quadratic function?A y = X-9B y = x +9C y = x + 2x -9 Describe how a jump rope can be used to model a cell membrane of a plant cell NEED HELP!! Edmentum PLATO 50 POINTS! Marketing through social media is very popular today. You have seen how mobile technology has accelerated the use of social media for marketing.Research at least three mobile marketing techniques and then write a report about a company that has used mobile marketing with success. Include the following points in your report: Describe in detail the technique used in the mobile marketing campaign.What was the campaign trying to achieve?Who was the target audience? What techniques did the company use to broaden the audience base?Describe the campaign process in detail.What results did the campaign achieve?How did mobile technology play a key role in the marketing campaign?How did mobile technology enhance the campaign compared to traditional marketing methods?Why do you think the campaign succeeded?In what ways could the company have improved the campaign? What was Darwins conclusion about the shells in Santiago True power can only be measured across what? malaria is caused by 9. I can't talk to you rightnow. Because I ___________. A) am study B) are studying C) am studying D) is studying 10. I hate ___________ money from other people. A) to borrow B) borrow C) borrowing D) having borrowed 11. A country is _____ than a city. A) cheap B) cheaper C) cheapest D) more cheaper 12. What___________ the cat doing over there by the chair? A) is B) are C) does D) do 13. At last I have discovered how___________ the door. A) to be opened B) opening C) to opening D) to open 14. A city is _____ than the country. A) the most exciting B) exciting C) more exciting D) excited How did Madison propose to improve the economy in the United States? what is the value of a? what is the a value of the vertex form...y = (x - 3 )^2 - 36 What were the pros and cons of Caesar crossing the Rubicon River? What value of x will make the triangles similar by theSSS similarity theorem? Using the information below, calculate net income for the period: Sales revenues for the period $1,323,000 Operating expenses for the period 258,000 Finished Goods Inventory, January 1 55,000 Finished Goods Inventory, December 31 60,000 Cost of goods manufactured for the period 559,000A. $774,000.B. $769,000.C. $530,000.D. $535,000.E. $448,000. PLEASE HELP!!!WILL MARK BRAINLIEST!!!Solve for X and Y in the rectangle. Thank you!m What is the relationship between the avoidance of unsafe situations and the use of refusal skills such as sexual abstinence? Henry is buying orange juice to make punch for a party. He can buy the juice in 32-oz cartons for $2.56 each or 48-oz cartons for $3.36 each. Which is the better value? Use the drop-down menus to explain your answer. which tessellation uses more than one type of regular polygon?