how does atomic spectrum differ from continuous spectrum​

Answers

Answer 1

Answer:

A continuous spectrum is a record formed by collecting light of all frequencies traveling through space together. ... A line spectrum is a record formed by collecting light emitted from excited atoms whose electrons are falling back down to lower energy states.

Explanation:


Related Questions

when the surface of a mirror curves inward, like the inside of a bowl, it is called a ____.
A) plane mirror
B) convex mirror
C) concave mirror
D) diffuse mirror

Answers

Answer:

C

Explanation:

The answer is always C

Answer:C. Concave mirror

Explanation:

When the surface of a mirror curves inward, like the inside of a bowl, it is called c. Concave mirror.

ASAP NEED HELP PLSSS
A gas occupying a volume of 3.75L at a pressure of 0.980 arm is allowed to expand at constant temperature until its pressure reaches 0.641 atm. What is the final volume of the sample?

Answers

Answer:

Volume = 5.73L

Explanation:

Data;

V1 = 3.75L

P1 = 0.980atm

P2 = 0.641atm

V2 = ?

This question involves the use of Boyle's law, which states that, the volume of a fixed mass of gas is inversely proportional to its pressure provided that temperature remains constant.

Mathematically,

V = kP, k = PV

P1V1 = P2V2 =P3V3=........=PnVn

P1V1 = P2V2

V2 = (P1 * V1) / P2

V2 = (0.980 × 3.75) / 0.641

V2 = 5.73L

The final volume of the gas is 5.73L

List and describe the steps of energy transfers that occur that allow a digital recording to be played through a speaker and ultimately become sound waves.

Answers

Answer:

1) Sound waves are stores as electrical signal in the digital recording.

2) the electrical signal of the digital recording is transcribed and sent to the voice coils.

3) the voice coil changes this electrical signal into varying magnetic fields.

4) The magnetic field pushes and pulls the diaphragm of the speakers.

5) the pushing and pulling of the diaphragm generates sound waves in the speaker.

Review the following chemical equation: Find the molar ratio between C6H6 to
carbon dioxide, CO2. 2C6H6 + 1502 YEILDS 6H20 - 12C02

Answers

Answer:

[tex]\frac{1}{6}[/tex]

Explanation:

Molar ratio is defined as the ratio of number of moles of reactants or products in a balanced chemical equation.

In this balanced equation, the number of C6H6 molecules react to form 12 CO2 molecules.

Thus, the molar ratio between C6H6 to  carbon will be equal to 2 moles of  C6H6 divided by 12 moles of CO2

[tex]\frac{2}{12}\\\frac{1}{6}[/tex]

After brushing, Fluffy's fur has a charge of +8.0 x 10' coulombs and her plastic brush has a charge of -1.4 x 10-8 coulombs. If the distance between the fur and
brush is roughly 5.0 * 10 meters, what is the approximate magnitude of the force between them?
(k = 9.0 * 10 newtonmeters/coulomb?)
A 5.0 x 106 newtons
B.
2.0 x 10-4 newtons
C
4.0 x 106 newtons
D. 2.5 x 10 newtons
Reset
Next
2020 Edmentum. All rights reserved.
SUS

Answers

Answer:

jeez thats some calculus stuff right there im pretty sure its b

Explanation:

What is the mole fraction of Ba(OH)2 in an aqueous solution that contains 22.8% Ba(OH)2 by mass?

Answers

Answer:

0.03

Explanation:

22.8 g Ba(OH)2 (1 mol Ba (OH)2/ 171.34 g) = 0.133 mol Ba (OH)2

77.2 g H2O (1 mol H2O/18 g) = 4.29 mol H2O

X= molar fraction= mol Ba(OH)2/ mol total

X= 0.133/ (0.133+4.29) = 0.03

0.03 is the mole fraction of [tex]Ba(OH)_2[/tex] in an aqueous solution that contains 22.8% [tex]Ba(OH)_2[/tex] by mass.

What is a mole fraction?

The ratio of the number of moles of one component of a solution or other mixture to the total number of moles representing all of the components.

Moles of [tex]Ba(OH)_2[/tex]

Moles = [tex]\frac{mass}{molar \;mass}[/tex]

Moles = [tex]\frac{22.8 g Ba(OH)_2}{171.34 g}[/tex]

= 0.133 mol [tex]Ba (OH)_2[/tex]

Moles of [tex]H_2O[/tex]

[tex]Moles = \frac{mass}{molar \;mass}[/tex]

[tex]Moles = \frac{77.2 g H_2O}{18 g}[/tex]

= 4.29 mol [tex]H_2O[/tex]

The mole fraction of [tex]Ba(OH)_2[/tex]

[tex]\frac{mol Ba(OH)_2}{total \;mol}[/tex]

= 0.03

0.03 is the mole fraction of [tex]Ba(OH)_2[/tex] in an aqueous solution that contains 22.8% [tex]Ba(OH)_2[/tex] by mass.

Learn more about the mole fraction here:

https://brainly.com/question/8076655

#SPJ2

please helpppppppppp

Select the TRUE statements about the carbon cycle

The carbon cycle is the process in which carbon travels from the atmosphere into organisms and the Earth and then back into the atmosphere.
Plants take carbon dioxide from the air and use it to make food.
Animals eat food and the carbon is stored in their bodies or released during cellular respiration.
Water (H2O) is cycled around the Earth

Answers

the carbon cycle is the process in which carbon travels from the atmosphere into organisms and the earth and then back into the atmosphere

How many atoms are there in 2 moles of helium?

Answers

Answer:

1 mole Of Helium = Weight of Helium/4Weight of Helium = 1*4 = 4 grams 1 mole of Helium contains 6.023*10²³ ( Avogadro number) atoms. Number of moles of in 4 grams of Hydrogen 4 grams is = given weight / molecular weight of Hydrogen (H₂) = 4/2 =2 Number of atoms/molecules in 2 moles of Hydrogen is (2*6.023*10²³) atoms. = 12.046*10²³ atoms.

(Hope this helps)

The number of atoms in 2 moles of helium is 1.204×10²⁴ atoms

From Avogadro's hypothesis,

1 mole of any substance = 6.02×10²³ atoms

Thus,

1 mole of helium = 6.02×10²³ atoms

With the above information in mind, we can obtain the number of atoms in 2 moles of helium as follow:

1 mole of helium = 6.02×10²³ atoms

Therefore,

2 moles of helium = 2 × 6.02×10²³ atoms

2 moles of helium = 1.204×10²⁴ atoms

Thus, we can conclude that 2 moles of helium contains 1.204×10²⁴ atoms

Learn more: https://brainly.com/question/24848191

Create a Element #Brainliest Challenge

Rules- It must Have Atomic mass and Number and it's Fictional name you created

For Fun Add #GoGenius​

Answers

Answer:

NeHe

Explanation:

Atomic Mass: 24.182302

Number: 18

I don't know, I just made it up.

The oxidation number of bromine in bromine gas is _____. A. 0 B. +1 C. –1 D. –2

Answers

Answer:

the answer is 0

The answer to the question is

A. 0

________________ substances have an equal amount of H+ and OH- ions in solution.

Answers

A neutral solution will have H+ ions equal to OH- ions. I think this should be the answer hhhh

Answer:

Water, and other neutral

Explanation:

That means those substances have pH = 7.

When the amount of H+ is more than the amount of OH- in solution, the substance is acidic ( eg.: Lemon juice ). pH < 7

When the amount of H+ is less than the amount of OH- in solution, the substance is basic ( eg.: Baking soda ). pH > 7

how does the sun light affect earths climate

Answers

Answer:

The Sun powers life on Earth; it helps keep the planet warm enough for us to survive. It also influences Earth’s climate: We know subtle changes in Earth’s orbit around the Sun are responsible for the comings and goings of the past ice ages. But the warming we’ve seen over the last few decades is too rapid to be linked to changes in Earth’s orbit, and too large to be caused by solar activity

Explanation:

PLEASE HELP :"( DUE NOW!!

What is the equation for the equilibrium constant for this equation?


CO+3H2⇌CH4+H2O



[H2O][H2]/[CH4][CO]



[CO][H2]3/[CH4][H2O]



[CH4][H2O]/[CO][H2]3



[CH]4[H2O]/[H2]3

Answers

Answer:

The correct answer is  

[CH4][H2O]/[CO][H2]3

Option 3 is correct

Explanation:

Step 1: Data given

For the equation aA + bB ⇆ cC + dD

The equilibrium constant is [C]^c * [D]^d / [A]^a*[B]^b

Step 2: Calculate the equilibrium constant Kc

CO+3H2⇌CH4+H2O

Kc = [H2O][CH4] / [CO][H2]³

The correct answer is  

[CH4][H2O]/[CO][H2]3

Option 3 is correct

What is El Nino and La Nina explained? Please help fast

Answers

Answer:

el nino: the boy

la nina: the girl

Explanation:

Answer:

el nino is dinosour la nino is fishcat

Explanation:

What is the correct answer? Please

Answers

Answer:

c

Explanation:

What is the answer ?

Answers

Answer:

b

Explanation:

Electromagnetic waves are waves that have no medium to travel whereas mechanical waves need a medium for its transmission.

What is the percent yield of C when 35 g CS₂ are reacted and produce 36.4 g C. * LABEL THE LIMITING REACTANT IN YOUR WORK.* Use the following balanced chemical equation to solve the problem: CS₂ + 4 CO --> 5 C + 2 SO₂ *

Answers

Answer:

Limiting reactant is CS2

% yield = 131.8 %

Explanation:

Using the alanced equation given, Mole ratio of C to CS2 is 1 : 5.

That is, for every 1 mole of CS2 used, 5 moles of Carbon is produced.

35g of CS2 --- [tex]\frac{35}{76.14}[/tex] moles

= 0.4597 moles

⇒ mass of C produced = 5 × 0.4597 × 12 g/mol

= 27.6 g of C.

Percentage yield (%) = [tex]\frac{actual- yield}{theoretical- yield}[/tex]

= [tex]\frac{36.4}{27.6} * 100[/tex] =131.9%

NEED HELPPP PLSSSSSSSSSS

Answers

I would pick the first option in the third option

Which situation describes why a rock sinks in water?
A. Air pressure is greater than the buoyant force.
B. The force of gravity is greater than the buoyant force.
c. The buoyant force is greater than the force of gravity.
D. The rock is less dense than water.

Answers

Answer:

b

Explanation:

what are the possible values for standard temperature and pressure

Answers

Answer:

0 °C and 1 Atm,

Explanation:

Standard Temperature and Pressure. Standard temperature is equal to 0 °C, which is 273.15 K.

Standard Pressure is 1 Atm, 101.3kPa or 760 mmHg or torr

How could you determine if a car door is made of a material, such as plastic?

Answers

Answer:Most cars have the visible outer panel, and supporting structure, made from steel. Some use aluminium, at least one series-produced model had magnesium doors, and there are also doors where the visible parts are plastic or fiberglass, with some sort of metal inside for strength.

Explanation:

Answer:

Most cars have the visible outer panel, and supporting structure, made from steel. Some use aluminium, at least one series-produced model had magnesium doors, and there are also doors where the visible parts are plastic or fiberglass, with some sort of metal inside for strength.

Which formula represents an isomer of CH3−CH2−COOH?


CH3−CO−O−CH3


CH3−CO−CO−CH3


CH3−C−OH−CH3

CH3−CH2−CO2−CH3

Answers

Answer:

CH3−CO−O−CH3

Explanation:

i just took the test

How many total atoms from Carbon are present on the reactant side?
20 points
2CH2+202
O2+HC4
5
2
1
3

Answers

Answer:

2 carbon atoms/molecules are present on the reactant side.

hope it helps!

Katie throws a 3 kilogram ball fast at a speed of 15 meters what is the momentum of the ball katie threw

Answers

Answer:

Hey!

Your answer is 45kg.m/s

Explanation:

Using the formula P=M x V

(p=momentum...M=mass...V=velocity)

We do M x V

15 x 3

Which gives us an answer of 45kg.m/s!

HOPE THIS HELPS!!

Balance the following equation by adding the correct mole numbers.
P⁴+Cl²->PCl³​

Answers

Hey there!

P₄ + Cl₂ → PCl₃

First, let's balance Cl.

There are 2 on the left, and 3 on the right.

To balance this, let's put a coefficient of 3 in front of Cl₂ and a coefficient of 2 in front of PCl₃.

P₄ + 3Cl₂ → 2PCl₃

Now we have 6 on the left and 6 on the right.

Next, let's balance P.

There are 4 on the left and 2 on the right.

Let's change the coefficient in front of PCl₃ from 2 to 4.

P₄ + 3Cl₂ → 4PCl₃

There are now 4 P on each side.

However, now Cl is unbalanced, with 6 on the left and 12 on the right.

We can change the coefficient in front of Cl₂ from 3 to 6.

P₄ + 6Cl₂ → 4PCl₃

So now, we have 4 P on each side and 12 C on each side.

This is our final balanced equation.

Hope this helps!

Answer:

1:1

Explanation:

Took test

How is a lithium atom (Li) different from a lithium ion (Li+)?

Li has fewer electrons than Li+
Li has more electrons than Li+
Li has fewer protons than Li+
Li has more protons than Li+

Answers

Answer:

Li has fewer protons than Li+

Li has fewer electrons than Li+

Why is the reaction SO2 + H20 → H2SO2 not balanced?
A. The oxygen atoms are in two molecules on one side, but one in
the other.
O
B. There are more molecules on one side than on the other.
O
C. There are more oxygen atoms on one side than on the other.
O
D. The sulfur atom is in different places in reactant and product
molecules
SUBMIT

Answers

Answer: C

# The main reason why the reaction above can not be balanced is:

   This chemical reaction SO2 + H2O -> H2SO2 is not correctly written.

    It must be: SO2 + H2O -> H2SO3

Explanation:

Note 1:

H2SO2 can be produced by the other chemical reaction:

2H2O + SCl2 -> 2HCl + H2SO2

....

Note 2: Answer A is false

As you can see in the reaction  SO2 + H2O -> H2SO3, the oxygen atoms are in two molecules on one side, but one in the other - However, this reaction is written correctly.

Note 3: Answer D is false

Of course the Sulfur atom must be placed in different places: in reactant and product molecules.

Note 4: Answer B is false

There are different kinds of chemical reactions, and this is normal that there are more molecules on one side than on the other.

The answer is C

The correct way to balance the reaction, would be to write it as SO2 + H2O →  H2SO3

Answer A is incorrect.

The oxygen atoms in the reaction SO2 + H2O -> H2SO3 are in two compounds on one end but on the other, it is in just one.

Answer D is wrong.

The sulfur atom has to be in the reactants and the products.

Answer B is not correct.

There are many types of chemical reactions . One side commonly has more atoms than the other.

Relate dark matter to the development of the universe after the Big Bang. In 3-5 sentences, speculate on how the development of the universe would have been different if there had been no dark matter. In your answer, use the term structures.

Please answer this and ill mark you as brainliest

Answers

Answer:

Dark matter also called baronic matter is the matter that makes up 27% of the universe.

In 1933 it was determined as that mass that cannot be seen, that is, the non-visible mass of outer space.

Dark matter also plays a central role in the formation of structures and the evolution of galaxies and has measurable effects on the anisotropy of cosmic microwave background radiation. The composition of this matter is unknown today.

The dark matter component has considerably more mass than the "visible" component of the Universe.

Explanation:

There are certain researchers who say that the appearance of dark matter was before the appearance of the big bang.

A relevant fact of this matter is that dark matter exerts gravity, and that gravity affects the movements of objects.

Despite the fact that nothing is known about its origin, astronomers have amply demonstrated that dark matter plays a determining role in the formation of galaxies and galactic clusters, which could not maintain their cohesion without its existence, but many doubt that it is the remainder / remnant or product of a big bang.

A community includes
A. all of the living organisms in a specific place at a specific time,
B. all plants, animals, minerals, and water in a specific place at a specific time,
C. only the plants in a specific place at a specific time.
D. only the animals in a specific place at a specific time.

Answers

Answer:
A. all living organisms in a specific place at a specific time

Answer:

answer: A. all of the living organisms in a specific place at a specific time

Explanation:

Is the equation Zn+HCl > ZnCL2+H2 unbalanced or balanced

Answers

Answer:

unbalanced

Explanation:

Cl and H have an extra atom

- Hope that helps! Please let me know if you need further explanation.

Other Questions
can anybody give me some options and some tips for my portfolio poem. for school. free verse poem. Take 2 y2 - 3 y - 5 from y3 - 6 y2 + 5 y . Select the correct answer.A) y3 - 2 y2 + 3 y + 5B) y3 - 4 y2 + 2 y - 5C) y3 - 4 y2 + 2 y + 5D) y3 - 8 y2 + 8 y + 5 How many Liters are in 17.3 moles of Iron? What is the volume of a rectangular prism with a length of 2 inches, a width of an inch & is a quarter of an inch in height? Is the below sequence DNA or RNA? How do you know?GTTTACAGGCGGCGCAATATCTGATCG Identify the vertex of the function graphed below.A. (1,2)B. (2,-1)C. (3,-2)D. (0,7) In the 1994 elections, Republicans won a clearmajority in states. Help asap!!! GIVING BRAINLIST Which characteristic of the father had the MOST influence on the action of the plot?A)angerB)courageC)fearD)gratitude A pink crayon is made with 12\text{ mL}12 mL12, start text, space, m, L, end text of red wax for every 5\text{ mL}5 mL5, start text, space, m, L, end text of white wax Can you help me please What was the effect of Thomas Paine's pamphlet Common Sense?A. It argued that women should be given the right to vote.B. It persuaded colonists to abolish slavery.C. It explained the benefits of westward expansion.D. It encouraged colonists to fight for independence. 1. Summarize the scientific information that leads to conservation in each of the articles.2. What social issues affected the problem or its solution in each of the stories?3. How did economics delay scientists' first attempts for conservation in each story?4. Describe the political actions that led to successful conservation in both stories. Which trend in hominid evolution can be supported by fossil evidence?Walking uprightUse of toolsIncreased intelligenceDecorating cave walls Find the hypotenuse of each Isosceles right triangle when the legs are of the given measure.Given = 6squareroot2 Select the correct navigational path to create the function syntax to use the IF function.Click the Formula tab on the ribbon and look in the ???'gallerySelect the range of cells.Then, begin the formula with the ????? click ?????. and click OK.Add the arguments into the boxes for Logical Test, Value_if_True, and Value_if_False. A bag contains 4 red, 2 blue, 6 green, and 8 white marbels. Round anwsers to the nearest tenth. What is the probibility of selecting a green marble, replacing it, and then selecting a red marble. please help i don't get it helppppppppppppp please why did the cold war start? a) at the end of world war 2, the soviet union and the united states competed for global influence and power