How is the election of 1860 related to Louisiana becoming the 6th state to secede?

Answers

Answer 1

Answer:

The U.S. state of Louisiana declared that it had seceded from the United States on January 26, 1861. It then announced that it had joined the Confederate States (C.S.); Louisiana was the sixth slave state to declare that it had seceded from the U.S. and joined the C.S.

Explanation:

i got that answer correct on ed2020


Related Questions

This form of government has those powers only given to it by the people

Answers

Answer:

That's Democracy

Democracy

Hope this helps :)

What was the purpose of the trip?

Answers

Purpose of trip

The purpose of a trip—for example, traveling to work or visiting friends—greatly influences travel behavior and mode choice. For example, a person's trip home from work is recorded as a work trip—again, even if the person ran several errands as well on the trip.


List at least two ways Booker T. Washington demonstrated perseverance in his life.

Answers

Answer:

"Booker" (the only name he had as a slave) decided early on that the key to life was a good education.

Booker was nine when slavery ended. His stepfather insisted that he work in a salt mine to help support the family. But Booker wanted to go to school, so he figured out a way to do both. He worked at the mine from 4 to 9 am in the morning, then went to school, and returned to the mine to work from 2 in the afternoon to 9 at night. A 12 hour workday PLUS school!

When he was 12, he heard about Hampton Institute, where he could continue his education. Even though it was 500 miles away, he talked his mother into letting him go. Then, he ran out of money halfway there. So, he walked over 200 miles to get there.

That's perseverance

Explanation:

Hurry!!

Francis Marion, also know as the Swamp Fox, used guerrilla
warfare while fighting the British in the South. Was Francis
Marion successful in using these techniques with his troops?
Explain why or why not.

Answers

Answer:

use ur brain and pay attention in class

Explanation:

Answer:

yes because he was able to maneuver through the swamps and avoid and distract British forces and win battles through stealth and other resourceful tactics

Explanation:

Please helppppppppppppppppppppp

Answers

Answer:

salt and gold is ur answer

Answer: Gold and Salt

Explanation:

Salt and good were their main goods.

How did America's stance on WWI change over the course of the war?

Answers

Answer:

Despite sympathies with Great Britain, France and their allies, the United States stayed neutral in the first years of the war. ... When the United States entered the war in April 1917, the U.S. Army had only 130,000 troops, no tanks and few planes. Congress quickly approved conscription to strengthen the forces.

Explanation:

Answer:

America had a stance of neutrality in 1914.  But in 1915 a movement declared that the U.S needed a much stronger army and the best way to achieve it would be entering WW1. In 1917, Germany sensed the tide was turning. German leaders agreed in January of 1917 to resume unrestricted submarine warfare to break the devastating army stalemate in Europe and the British navy’s successful blockade of critical German supply ports. This pushed American public opinion toward intervention. Germany’s unrestricted submarine warfare sent more ships to the ocean’s floor and the loss of American lives spiked. The U.S. protested and in February 1917 severed diplomatic relations with Germany, while Congress approved funds for increased military affairs. On April 2, President Wilson asked Congress to declare war against Germany specifically citing Germany’s renewed submarine policy as “a war against mankind. It is a war against all nations.” He also spoke about German spying inside the U.S. and the treachery of the Zimmermann Telegram.

On April 4, 1917, The United States went to war.

Explanation:

NEED HELP ASAP PLEASE PLEASE ❗️❗️❗️❗️❗️❗️❗️❗️❗️❗️❗️❗️❗️❗️❗️❗️❗️❗️❗️❗️❗️❗️❗️❗️❗️

Which phrase best completes
this list?
Themes of Transcendentalism
Oneness with nature
Goodness of humans
?
A. Duty to country
B. Logic and reason
C. Individualism
D. Formal religion

Answers

Answer:

C.

Explanation:

Answer: Individualism

Explanation:

Someone please help ASAP ill give Brainliest

Answers

Answer:

the answer will be 2 Jose Antonio's

Jose Antonio Navarro

ILL GIVE BRAINLY THING

The Seven Years War was a war between


France and Native Americans


Spain and Britain


France and Spain


France and Britain

Answers

the war was france and britain

franch and britian

Explanation:

How were Free People of Color treated in Louisiana's constitution of 1812?​

Answers

Answer:

Just before the civil war, they were enslaved around 1860 or so. They were treated as second class citizens and given no representation therefore. They were allowed to vote around 1965. So I think its D.

Can someone please help me with this I’ll give them extra points and brilliant it actually has to be an answer though

Answers

Answer:

im pretty sure its main idea

Explanation:

Answer:

Main idea

Explanation:

Confucius believed what would bring peace and harmony to China?


A. following the rule of ahimsa

B. fasting for one week a month

C. following the beliefs of their ancestors

D. making as much money as possible

Answers

Answer:

C. following the beliefs of their ancestors

Explanation:

Confucius believed that social order, harmony, and good government could be restored in China if society were organized around five basic relationships.

:)))))))

What was the population of holland in 1939

Answers

Answer:8 million

Explanation:

Approximately 8 million people in the year of 1939 in Holland

Please help me I don’t know this

Answers

Answer:

2: we the people

Explanation

the words we the people mean rule by the people

Click to review the online content. Then answer the question(s) below, using complete sentences. Scroll down to view additional
questions.
Online Content: Site 1


Robert Bunting did not want to join the war effort initially. What event changed his mind?

Answers

Answer:

b

you wecome f

Explanation:

Answer:

Direct democracy can be seen as a kind of system where citizens directly discuss and vote on the main issues of interest. This kind of democracy arose in Ancient Greece, where popular assemblies assembled the population of democratic city-states in the Agora (square), where laws and key decisions were discussed and resolved. Remember that in the Greek way, the exercise of political opinion was restricted to a specific portion of the population.

Explanation:

How did the Alien and Sedition Acts impact the federal government?

A.The Alien and Sedition Acts allowed the Supreme Court to deport and refuse re-entry to any non-citizens who were suspected of treason.

B.The Alien and Sedition Acts allowed the individual states to violate individual rights of non-citizens by detaining and deporting them without due process.

C.The Alien and Sedition Acts allowed the president to violate the individual rights of non-citizens by imprisoning or deporting them without due process.

D.The Alien and Sedition Acts allowed Congress to create laws during peacetime that limited the individual rights ofnon-citizens.

Answers

Answer:

B

Explanation:

how did queen die and when did he die​

Answers

Freddie Mercury died of pneumonia on November 24th, 1991

Answer:

November 24, 1991 and he had pneumonia hope this helps

Explanation:

1. Where was Marcus Garvey born?:
a. Great Barrington, Massachusetts
b. St. Ann's Bay, Jamaica
C. Chicago, Illinois
d. Kingsford Plantation, Bahamas

Answers

Answer:

Of Course! "B.St.Ann's Bay,Jamaica

"

Explanation:

Risk*

Answer:

b

Explanation:

Marcus Mosiah Garvey Jr. ONH (17 August 1887 – 10 June 1940) was a Jamaican political activist, publisher, journalist, entrepreneur, and orator. He was the founder and first President-General of the Universal Negro Improvement Association and African Communities League (UNIA-ACL, commonly known as UNIA), through which he declared himself Provisional President of Africa. Ideologically a black nationalist and Pan-Africanist, his ideas came to be known as Garveyism.

played a role in Imperialism due to the fact that governments believed that if you are going to become more powerful the empire must expand.

Answers

Answer: The Rise of Global Inequality

Explanation:  The Industrial Revolution in Europe marked a momentous turning point in human history. Those regions of the world that industrialized in the nineteenth century (mainly Europe and North America) increased their wealth and power enormously in comparison to those that did not. A gap between the core industrializing regions and the soon-to-be colonized or semi-colonized regions outside the European-North American core (mainly in Africa, Asia, the Middle East, and Latin America) emerged and widened throughout the nineteenth century. Moreover, this pattern of uneven global development became institutionalized or built into the structure of the world economy. Thus a "lopsided world" evolved a world with a rich north and poor south.

In recent years historical economists have charted the long-term evolution of this gap, and Figure 24.1 summarizes the findings of one important study. Three main points stand out. First, in 1750 the average standard of living was no higher in Europe as a whole than in the rest of the world. Second, it was industrialization that opened the gaps in average wealth and well-being among countries and regions. Third, income per person stagnated in the colonized world before 1913, in striking contrast to the industrializing regions. Only after 1945, in the era of decolonization and political independence, did former colonies make real economic progress, beginning in their turn the critical process of industrialization.

The rise of these enormous income disparities, which indicate similar and striking disparities in food and clothing, health and education, and life expectancy and general material well-being, has generated a great deal of debate. One school of interpretation stresses that the West used science, technology, capitalist organization, and even its rational worldview to create massive wealth, and then used that wealth and power to its advantage. Another school argues that the West used its political and economic power to steal much of the world's riches, continuing in the nineteenth and twentieth centuries the rapacious colonialism born of the era of expansion. Because these issues are complex and there are few simple answers, it is helpful to consider them in the context of world trade in the nineteenth century.

Which is a solution to the deforestation problem in the Amazon
Rainforest? *
O
Cleaner burning fuels
strict emissions on cars
have large protected areas of land in the forest
O
public transportation

Answers

Answer:

Cleaner burning fuels

Capitalism definition in your own words PLEASE

Answers

Answer:

Capitalism is an economic system in which private individuals or businesses own capital goods

Explanation:

The production of goods and services is based on supply and demand in the general market—known as a market economy—rather than through central planning—known as a planned economy or command economy.

Capitalism, also called free market economy or free enterprise economy, economic system, dominant in the Western world since the breakup of feudalism, in which most means of production are privately owned and production is guided and income distributed largely through the operation of markets.

There is a famous quote: “It would take the wisdom of Solomon to solve this problem” What does this quote refer to? Please help!

Answers

I think Solomon was a really smart person i forget what he did though people called him wise.

did the u.s pursue the policy of isolation during the cold war​

Answers

Containment was a United States policy using numerous strategies to prevent the spread of communism abroad. A component of the Cold War, this policy was a response to a series of moves by the Soviet Union to enlarge its communist sphere of influence in Eastern Europe, China, Korea, and Vietnam.

HEY CAN ANYONE PLS ANSWER THESE IN UR OWN WORDS!!!

Answers

Answer:

sorry dont know my own words but found this on the web

Explanation:

Third Punic War, also called Third Carthaginian War, (149–146 bce), third of three wars between the Roman Republic and the Carthaginian (Punic) Empire that resulted in the final destruction of Carthage, the enslavement of its population, and Roman hegemony over the western Mediterranean.

Answer:

1. After the third Punic war Scipio the younger and the romans destroyed the city of Carthage in 146 B.C.

2. The romans defeated the people of Carthage. Romans had take prisoners about 50,000 were sold into slavery.

Question- what was their main economic activity.

I need help read and answer the question plz

Answers

Answer:

trade

Explanation:

sold and bought items

What is the olest phone ever

Answers

Answer:

A flip phone

Explanation:

Answer:

the oldest phone doesn't really have a name but the oldest mobile phone ever is called the 1989 – MOTOROLA MICROTAC 9800X

Which of the following statements best defines the domino theory?

A. communism will topple the global economy
B. if one country falls to communism, others in the region will fall, too.
C. Socialist governments are a threat to freedom
D. communism will cause the fall of the US

Answers

Answer:

b

:]

have a good day

The domino theory defines if one country falls to communism, others in the region will fall, too. The correct option is B.

What is the importance of the domino theory?

Finally, the domino theory was significant because it explained American foreign policy at the time, during which the country was involved in two major wars. Furthermore, in both wars, the United States struggled and thousands of American soldiers were killed.

The domino theory held that all Soviets, communists, and socialists were inherently evil. A nuclear strike by the United States on Vietnam was required to prevent a Viet Cong victory that would set off a chain reaction of countries falling to the communists, similar to a row of falling dominoes.

Thus, the ideal selection is option B.

Learn more about the domino theory here:

https://brainly.com/question/28082356

#SPJ6

The last extermination camp was

Answers


Stutthof concentration camp

It was also the last camp liberated by the Allies on 9 May 1945. It is estimated that between 63,000 and 65,000 prisoners of Stutthof concentration camp and its subcamps died as a result of murder, starvation, epidemics, extreme labour conditions, brutal and forced evacuations, and a lack of medical attention.

please someone help!!

Answers

historical context: the tea act

point of view: no one can take from someone without their consent, the document provides situations of that

audience: students

purpose: to inform of The Tea Act

why is there not another answer.. is this 40 points free? i-

PLEASSSE HELP MAKING BRAINLIEST IF RIGHT

Answers

Answer:

A

Explanation:

Go with the answer A

A the answer is a it won’t let me send it without 20 characters
Other Questions
What is a central idea in the Newsela article "Washed-Up Plastics Become Art with a Vital Message"?Children enjoy the art displays of sea creatures.Many people now look for trash to pick up when they are visiting the beach.Creating artwork can be both beautiful and horrifying.Increased awareness of the dangers of ocean pollution are creating interest in Pozzi's art.Question 2Part BWhich detail from the text best conveys the answer in Part A?"'It's the only thing he's liked all day,' his grandmother said.""An army of about 10,000 volunteers in Oregon help her collect, prepare and assemble the beach trash into art.""All of the art is made from plastic trash that washed ashore, including a great white shark""She now has more than 70 pieces in three exhibitions currently traveling throughout the United States. She also has requests from overseas." Please help 4 questions for 10 points!!!------------------------------------------------------------1) Which expression is equivalent to 4(23)?4(20+3)4(2+3)4(2+13)4(20+30)..................................................................................................2. Which expressions are equivalent to 4(42)?Select each correct answer.4(20+22)4(40+2)4(4+20)4(4+2).......................................................................................................3.Which expression shows how 645 can be rewritten using the distributive property?640+6206+205640+6564+65...............................................................................4.Tori uses the greatest common factor and the distributive property to rewrite this sum:24 + 84What expression does Tori write?2(24+42)12(2+7)24(1+4)4(6+21).....................................................................my last one got deleted.... paid rent of Rs.25000 by cheque. make journal entry Use a number line to order the numbers from least to greatest. HELLLPPPP!!!!! Three hundred cars drove over a bridge in 23 minutes. At that rate, howmany cars would drive over the bridge in 138 minutes? write the code for RNA from this DNA STRAND :AAAAAATTTTTTCCCGGGGTTTATATATC What is the main purpose of foreign aid? Describe the religions of the early Indigenous peoples. Only________ can declare war! which sea would a boat pass through traveling from South Korea to Japan RIP grandsonhow does earths crust change earths surface According to the map, Italy in the early 19th century was under the control of Austria. under the control of Spain. united as the Kingdom of Italy. split into kingdoms and city-states. [2.1 + (9.2 x 3.3)] x 0.8 PLEASE HELPPFill in the blanks in the following sentences with the logical word(s). Pay attention to the pronunciation.Spell out the following numbers in french: 1. 200:2. 256:3. 987:4. 875:5. 435:Based on the context, fill in the blanks in the following sentences with either the logical word or the appropriate forms of voir or croire. Say the whole sentence aloud.6. Est-ce que tu crois________Paul va aller au cinma ce soir?7. Elles_________les pommes sur la table.8.________vous aux fantmes?Oui! Vous_________ce fantme, l! Mais non, je ne le___________pas! Name the factors in each of the following problems i need help lol i forgot how to do this Q.Ankit said to Rita, " It is your last chance." 1.Ankit said Rita it is your last chance. 2.Ankit told Rita that it is her last chance. 3.Ankit told Rita that it was her last chance. 4.Ankit told Rita that it was their last chance. what is the circumference of this circle? (Use C = [tex]\pi[/tex]d; [tex]\pi[/tex] = 3.14.)giving 20 points to the person who answers! no need to show your work, thank you. y32c-4-3 -2 -1-1+1 2 3 4-2+-3+-4+41What is the slope of the line? Hookes Law of Elasticity states that the force applied, y, varies directly with the distance a spring stretches, x (assuming the spring is not stretched past its elastic limit). If a force of 160 newtons stretches a spring 800 cm, how far will a force of 368 newtons stretch the same spring? Justify your answer.Group of answer choicesF. It will stretch the same spring 73.6 cm because the equation is y equals 5x.G. It will stretch the same spring 73.6 cm because the equation is y equals one fifth x..H. It will stretch the same spring 1,840 cm because the equation is y equals 5x.J. It will stretch the same spring 1,840 cm because the equation is y equals one fifth x..