i have another question, whats 16 divided by 6,720?

Answers

Answer 1

Answer: 0.00238095238

 

Step-by-step explanation:

Answer 2
0.00238095238 I think

Related Questions

151 3/16 divided by 10 1/4

Answers

Answer: 59/4 or 14 3/4

Step-by-step explanation:

151 3 /16  ÷ 10 1 /4

2419 /16  ÷ 41 /4    

2419/16 × 4/41  

2419 × 4 /16 × 41

9676 /656

Divide both sides by 164

9676 ÷ 164  / 656 ÷ 164

59 /4  = 14 3 /4

(Giving brainliest to correct answer)

Congruence

Answers

Answer:

SAS

Step-by-step explanation:

you are given two congruent sides

and since the right angle is a vertical angle, you can one congruent angle between the triangles

Choose the relationship that is modeled by the table, the graph, and the equation. Morgan buys apples for $2 per pound. O Morgan swims 2 miles more than the number of hours he is exercising, © Morgan practices for 2 hours a day. O Morgan walks 2 miles per hour.​

Answers

Answer:

Morgan walks 2 miles per hour.

Step-by-step explanation:

Answer:

d Morgan walks 2 miles per hour.

Step-by-step explanation:

What is an equation of the line that passes through the point
(
1
,
7
)
(1,7) and is parallel to the line
3
x

y
=
1
3x−y=1?

Answers

Step-by-step explanation:

We wish to express 3x - y = 1

in slope-intercept form.

3x - y = 1

=> y = 3x - 1

Slope of line = 3, therefore

Slope of parallel line is also 3.

We have y = 3x + c.

When x = 1, y = 7.

=> (7) = 3(1) + c, c = 4

Hence the answer is y = 3x + 4.

Find the value of X. Show your work.

Congruent triangle

Answers

Answer:

x = 3

Step-by-step explanation:

exterior angle of a triangle is equal to the sum of the measures of the two remote interior angles

97 + x = 64 + 27

x = 97 - 64 - 27 = 6

Answer: x=-6

you know that the interior angles of a triangle equal 180°. so lets find the remaining angle measure

64 + 27 = 91

180 - 91 = 89

so 89 is the third interior angle of the triangle. now let's find the exterior angle.

you know that the extended angle is supplementary; which means it will equal 180° as well. so lets add the third interior angle we just found and let's add it to the unknown expression:

89 + 97 + x = 180

186 + x = 180

-186        -186

x = -6

now it might seem wrong because x is negative and it feels like it should be positive. but let's check our answer.

64+27+89 does equal 180

and 97+(-6)+89 does equal 180

i hope this helps!

WHAT IS QUARTER OF 74?

Answers

Answer:

18.5

Step-by-step explanation:

I majored on Mathematics

Answer:

18.5

Step-by-step explanation:

74/4=18.5


Help me plssssssssss

Answers

Answer:

The answers are as follows:

5. [tex]12+3 = 3+12[/tex]

7. [tex](6+4)+8 = 6+(4+8)[/tex]

9. [tex](10*5)*7 = 10*(5*7)[/tex]

Step-by-step explanation:

5. 12 and 3

Commutative property of addition states that the order of two numbers in addition doesn't matter; the result will be the same. If a and b are two numbers then the property will be:

a+b = b+a

For the given question, the commutative property will be:

[tex]12+3 = 3+12[/tex]

Associative property deals with three numbers or variables. It states that when 3 numbers are being added or multiplied their order doesn't affect the result.

It can be stated as:

(a+b)+c = a+(b+c)

7. 6,4 and 8

The associative property will be:

[tex](6+4)+8 = 6+(4+8)[/tex]

9. 10,5 and 7

[tex](10*5)*7 = 10*(5*7)[/tex]

Hence,

The answers are as follows:

5. [tex]12+3 = 3+12[/tex]

7. [tex](6+4)+8 = 6+(4+8)[/tex]

9. [tex](10*5)*7 = 10*(5*7)[/tex]

- 5/6e (the fraction) - 2/3e (the fraction)=-24

Answers

Answer:

I believe this is the correct answer. e = 16

Find |x| when x = 15 and x = – 15.

Answers

Answer:15

Step-by-step explanation:trust me

Answer:

The absolute of x would be 15

Which is the fraction for 33%

Answers

33% in fraction is 33/100.

Please mark as brainliest ~

1/3 is the answer, Yw

In the diagram below, the three lines intersect in the same point, forming six numbered angles.

Answers

A and D are the true statements because opposite angles are equal

For the given figure of intersecting lines the expression holds is m∠1 + m∠3 + m∠5 = 180°. Option D is correct.

Given that, A figure of the intersecting lines is given where 3 lines intersect at the same point.

What is the angle?

The angle can be defined as one line inclined over another line.

What is a Line?

A line can be defined by the shortest distance between two points is called a line.

Here,
From the figure
∠1 = ∠4
∠2 = ∠5
So,
∠6 = ∠3
Now, from the option, the property hold is m∠1 + m∠3 + m∠5 = 180°. because m∠1 + m∠6 + m∠5 = 180°, or ∠6 = ∠3.

Thus, for the given figure of intersecting lines the expression holds is m∠1 + m∠3 + m∠5 = 180°. Option D is correct.

Learn more about Angles here: https://brainly.com/question/13954458

#SPJ2

You paint four walls. Each wall is a rectangle with a length of 18 feet and a height of 12 feet. One gallon of paint covers about 320 square feet. How many gallons of paint do you need in order to cover the walls?

Answers

Answer:

you will need exactly 2.7 gallons of paint but if rounded you'll need 3 gallons

Step-by-step explanation:

Hello! :)
Please help me solve this + explain your answer :)

I will indeed give you Brainlst <3

Answers

Answer: the triangles are congruent

Step-by-step explanation: if u add up all the angles u get 180 so all angles are congruent

2x + 3y = 2
y = {x+3

Answers

The solution of the system is (-2,2)

Step-by-step explanation:

a solution is a system of equations intersecting.

on the graph you can see that the lines intersect at (-2,2)

What is n2+5 If n=5?

Answers

Is that cube or n just multiply to 2?

Answer:

15

Step-by-step explanation:

n is 5 so 5 times 2 equals 10 and plus 5 it equal 15

(Giving brainliest to correct answer)
Need quick
28 POINTS ANSWER RIGHT

Congruence

Answers

Answer:

BE =DE

BEC=DEC

AEB AED

Step-by-step explanation:

not that hard lol

9x + 4

8x - 4

4x + 17

If the perimeter is 374 units, find the value of x and the area of the triangle.

The value of x is

The area is

square units.

Answers

Answer:

x = 17

Area = 10,362units²

Step-by-step explanation

Given the sides of the triangle

S1 = 9x+4

s2 = 8x-4

S3 = 4x+17

Perimeter of the triangle is the sum of all the sides

P = S1+S2+S3

374 = 9x+4+8x-4+4x+17

374 = 21x+17

21x = 374-17

21x = 357

x = 357/21

x = 17

Hence the value of x is 17

Area of the triangle is 1/2bh

A = 1/2bh

b is the base

h is the height

Let the base be 9x + 4 and height be 8x-4

b = 9x+4

b = 9(17)+4

b = 153+4

b = 157units

h = 8x-4

h =8(17)-4

h = 136-4

h = 132

Area = 1/2 * 157 * 132

Area = 157*66

Area = 10,362units²

What is the common ratio of the sequence?
-2, 6, -18, 54....
-3
-2
3
8

Answers

Answer:

-6/-2=-18/-6=54/-18

=3

Answer: A. -3

Step-by-step explanation: -3 is the correct answer. -2x-3=6, 6x-3=-18,

-18x-3=54

Jackson has twice as many cards as his friends Alex and Chase combined. Alex has 55 Cards in his collection. Jackson Has 200 cards in his collection. How many cards does Chase have in his collection?

Answers

Answer:

45

Step-by-step explanation:

200 divided by 2 = 100-55=45

Answer:

45

Step-by-step explanation:

200-55=145

Since Jackson has twice as many as them combined, he would have 45.

7. Triangle FIP was dilated by a scale factor of centered at the origin to
create triangle F'I'P', which has coordinates F' (1,-),1'(2,-1),P'(1,2).
Write the coordinates of the vertices of triangle FIP in the spaces
provided below.
FC
16
IC
17
PC
18

Answers

Answer:

AB is parallel to A'B'.

DO,1/2 (1/2x, 1/2y) =

The distance from A' to the origin is half the distance from A to the origin.

Step-by-step explanation:

A bag contains 4 white tiles and 8 black tiles. You select one tile at random from the bag. What is the probability that you select a black tile?

Answers

Answer:

p( black) = 2/3

Step-by-step explanation:

4 white + 8 black = 12 tiles

P ( black) = number of black / total

                = 8 /12

                 = 2/3

PLEASE HELPPPP ME!!!!!

Answers

Answer:

Problem 1: No

Problem 2: Yes

Step-by-step explanation:

Problem 1:

{(-2, 1), (-2, 3), (0, -3), (1, 4), (3, 1)}

This relation is not a function because there are two y-values, 1 and 3, related to one x-value, -2.

Thus, for a relation to be a function, every x-value must be related to exactly 1 y-value.

Problem 2:

{(0, 2), (3, 4), (-3, -2), (2, 4)}

In this relation, each x-value (domain) has exactly one y-value (range) that it is related to. Therefore, this is a function.

(Giving brainliest to correct answer)

Congruence

Answers

Answer:СССР в зеркале

Кто первый спустит курок

Убеждаешь - ложно заявляя свободу личности.

Бушующие войны и П-С-О,

Космос, О-С-В

Брежнев Рейган

Страх оружия С-Я-С

До взаимного уничтожения

Силой и мощью

Союза Советских Республик

Патриоты работают силой порядка

Светлое строят будущее

Наука, Творчество, Семья, Союз,

Образование, Коммуналка, Труд,

Дисциплина, Планировка, Доброта.

Родина – поём тебе,

В верности клянёмся,

Пролетарии всех стран Соединяйтесь

Серп и Молот!

Step-by-step explanation:

Using a scale where 3 inches = 5 feet. If a room measures 20 feet (Width) by 22.5 feet (length), what are the dimensions of the room in inches?

A 12 inches (width) by 13 inches (length)
B 12.5 inches (width) by 13 inches (length)
C 12 inches (width) by 13.5 inches (length)
D 12.5 Inches (width) by 13.5 inches (length)​

Answers

Answer:

wnna call me and lift the lorax

Step-by-step explanation:

Answer:

12 inches by 13.5 inches

Step-by-step explanation:

3 inches= 5 feet

0.6 inch = 1 feet

20 feet=12 inches

22.5 feet=13.5 inches

please give me brainiest!!<3

Answers to these 3 questions ?

Answers

43. 8y + 36 = 14y - 24
60 = 6y
10 = y

8(10) + 36
80 + 36
116

116° for the top and bottom angles

48 + x = 64
x = 16

64° is the measurements for the horizontal angles


44. 11.22(2) = 22.44
TE = 22.44

45. 4x + 8 + 27 = 6x
35 = 2x
17.5 = x

4(17.5) + 8
70 + 8
CD = 78

6(17.5)
CE = 105

Find the slope intercept equation of the line

Answers

Answer:

y= -3/5x+4

Step-by-step explanation

The slope intercept equation of the line on the graph is Y= -3/5 + 4

Andrade's dad ran 12 miles in 75 minutes. How long would it take him to run one mile?

Answers

If Andrade's dad can run 12 miles in 75 minutes, it would take him only 6.25 minutes to run 1 mile.

To get this answer, you need to divide 75 (the total amount of minutes) by 12 (the total amount of miles).

Answer:

6.25

Step-by-step explanation:

75 divided by 12

hope this helps

-8 - 1 = ?

Please show work for credit/ brainliest

Answers

Answer: The answer is -9

Step-by-step explanation:-8 - 1 = -9

It’s simple ! -8 and your getting smaller ( -1) = -9

which expression is equivalent to 3x - -3y

Answers

Answer:

3x + 3y

Step-by-step explanation:

The two minus signs make a plus sign. Therefore, we replace the minus signs with a plus sign, getting 3x + 3y.

3x+3y
The two minus signs cancel each out and you add it instead.

Need help will give 15 points!!

Answers

Answer:cool

Step-by-step explanation:

Other Questions
help would be appreciated ** if you could explain thatd be cool but if not thats ok 0.47 100with process Mircale are u online right now I need to talk to you pls Attempt 1Question You see Fred, a co-worker, not following safety procedures. What would be the bestthing to do?A) nothing, as his safety is his own responsibilityB) pretend you didn't see him, but consider telling the bossC) talk to him about putting his safety at riskD) follow his example -- maybe the safety procedures are not necessary What does x stand for in math Help me please Im begging u 3) What type of government did the Aztecs have? *A.One kingB. Prime MinisterC.PriestsD. Decentralized government made up of city states, each with their own kingsqueens what is 1256x - 14x + 16x simplified Use the restriction enzyme EcoRi to cut DNAVictim DNA :GGAAG ATTCTACATTACTGACGGACGTGACGTGACCTTCTTAA GATGTAATGACTGCCTGCACTGACTNumber of restriction fragments ( pieces of DNA after digestion) :Size of restriction fragments ( count the number of bases on the top strand of each fragment , listed from largest to smallest ) :Suspect 1 DNA :GGAATTAAGCTTATTG AATTCTTATAG AATTCGGGGCCCAAGCTTATG AATTCAATT CCTTAATTCGAATAACTTAA GAATATCTTAA GCCCCGGGTTCGAATACTTAA GTTAANumber of restriction fragments ( pieces of DNA after digestion) :Size of restriction fragments ( count the number of bases on the top strand of each fragment , listed from largest to smallest ) :Suspect 2 DNA :CCATATAG AATTCAAGCTTAAG AATTCGGGGGAACGTTG AATTCAATTAATTGGGGGTATATCTTAA GTTCGAATTCTTAA GCCCCCTTGCAACTTAA GTTAATTAACCCNumber of restriction fragments ( pieces of DNA after digestion) :Size of restriction fragments ( count the number of bases on the top strand of each fragment , listed from largest to smallest ) :PLEASE HELPPP!!!!I WOULD APPRECIATE A LOT :) list the difference between sdram and dram What is 2/5 divided 1/3 Kaden, Keith, and Kipp compete in a series of daily 3-way races. For each race, the probability that Kaden wins is 1/6, the probability that Keith wins is 1/2, and the probability that Kipp wins is 1/3. On a day that Kaden doesn't win, what is the probability that Keith beats Kipp? a file that serves as a starting point for a new document What is civilization? How did the Native American tribes fit into the concept of civilization? Were some tribe more civilized then others? If so, how ?(YOUR OWN WORDS 300 words pls !!! 10 POINTS) A dental hygienist is a health-care professional who works alongside a dentist to meet the oral health care needs of patients. Asked by one of her clients who needs to get a cavity filled what the average number of cavities a person gets filled by the time they are 50 years old, the hygienist responds that she will gather and determine not just the average, but also the median and the mode - because she would like to know this information herself. A bit of research turns up the following data table taken from a research project of a graduate student. The graduate student surveyed 20 people aged 50 from around Idaho.Patient ID# Cavities Filled1 12 83 74 95 116 127 78 59 210 011 812 913 714 615 816 917 818 919 820 8a. What is the mean (average) number of cavities a person gets filled by age 50?b. What is the median number of cavities a person gets filled by age 50?c. What is the most often an occurring number of cavities filled in this data set? Solve for n.(33)^2 = n^6 The sum of the digits of a positive 2-digit number is 12. The units digit is 3 times the tens digit. Find the number In REPL.it, the interface includes an Editor and an Interpreter.TrueFalse A biologist is recording the loss of fish in a pond. He notes the number of fish, f, in the pond on June 1. On July 1 there were 63 fish in the pond, which is 52 fewer fish than were in the pond on June 1. What is the number of fish in the pond on June 1?Which equation can be used to find the number of fish in the pond on June 1?63f=52f52=63f52=63f63=52 Why did the Spanish build presidios?A.) to protect the missions and their inhabitantsB.) to serve as prison camps for American Indians captured in battleC.) to provide centers for converting American Indians to CatholicismD.) to provide a quiet space for Spanish priests to study