If an object sinks in a fluid, the buoyant force is ____ the weight of the object.
a.
greater than
c.
the same as
b.
less than
d.
doesn't apply


Please select the best answer from the choices provided

A
B
C
D

Answers

Answer 1
answer:

greater than

Related Questions

Describe the conditions under which new species may arise.

Answers

Answer:

Explanation:i dont knowim so sorry

Answer:

New species arise through a process called speciation. In speciation, an ancestral species splits into two or more descendant species that are genetically different from one another and can no longer interbreed.

Explanation:

After studying prokaryotic and eukaryotic cells, what do scientists believe?

Answers

Answer:

Scientists believe that mitochondria evolved from aerobic, or oxygen-consuming, prokaryotes. ... Eukaryotic cells also contain a variety of structures and organelles not present in prokaryotic cells.

The smooth endoplasmic reticulum Group of answer choices converts sunlight into chemical energy. stores water, nutrients, and enzymes. is the site where lipids destined for other cellular compartments are manufactured. produces the energy needed to run chemical reactions in the cell.

Answers

Answer:

is the site where lipids destined for other cellular compartments are manufactured.

Explanation:

This is because smooth endoplasmic recticulum is an organelles found in eukaryotic organisms that lack membrane bound ribosomes and are found in cells that has much lipids like ovaries, testes, oil glands in the skin e.t.c. They are important in the synthesis of lipids is the site where lipids , Phospholipids, steroid hormones.

They also play a major role in detoxification of harmful metabolic by products and metabolic processes of calcium ions within the cell

Which organisms have groups of cells arranged into organs?
O A. Unicellular
O B. Multicellular
O C. Prokaryotic
O D. Bacterial

Answers

The answer is B, multicellular.

—Evidence—
•] Organs are differentiated structure formed by group of cells and tissues to perform the similar functions.

What steps do you think could be taken to help generate jobs and help people and rise out property

Answers

wait sorry i don’t get it text me in the text box

what are the limitations of cell theory​

Answers

Answer:

The shortcomings or drawbacks of cell theory are: Viruses are considered as acellular entities or organisms that do not have cell machinery, yet they are taken into account as organisms in this cell theory. Matthias Schleiden and Theodor Schwann did not know the mechanism of the cell.

Explanation:

How do we know that height in humans
is a polygenic trait and not a single-gene
trait?

A. There is no way to know for sure.

B. People have varying heights.

C. Height is too complex to be controlled by a single gene.

Answers

C.........................

CAN SOMEONE HELPP ME :(

Answers

I think it could be the answer b

What is the steps of preparing yeast slides?

Answers

Answer:

To begin, you need to prepare a yeast solution. Add the yeast and sugar to the warm water. Stir and let it sit for 45 minutes. Once the yeast solution is ready, place a small drop onto a slide and cover with a coverslip.

Explanation:

□ Microscope 1
□ Microscope Slide and Cover Slip 1
□ Toothpick 1
□ Centrifuge Tube or Small dish 1
□ Centrifuge Tube Rack or small Test Tube Rack 1
□ Methylene Blue (preferably in a dropping bottle, .5% concentration) 1 drop
□ Petri dish with Yeast Cell Colonies 1
□ Disposable Pipette

the core technique of modern biotechnology is/are
1)chemical engineering
2)genetic engineering
3)both
4)none​

Answers

Answer:

I'm just guessing it ok I not sure

3)Both

Explanation:

Why where the Galapagos Turtles different from the mainland turtles if they shared a common ancestor?​

Answers

Speciation! Speciation occurs when a single species becomes two or more separate populations by a geographical barrier. This changes each population’s environment which forces them to adapt. Eventually these populations will become so different from each other that they will not be able to interbreed populations and create fertile offspring. This is what makes them different species, but they still share a common ancestor.

When light passes into a more dense material, it bends away from the normal

True or false

Answer : Flase

Answers

(つ ^_^ )つ Hey There!

Answer : False, When light passes from a more dense to a less dense substance, (for example passing from water into air), the light is refracted (or bent) away from the normal.

~Hope this Helps!~

The answer is false!

What is a virus and what cause a viruses​

Answers

Meaning:A virus is a submicroscopic infectious agent that replicates only inside the living cells of an organism. Viruses infect all types of life forms, from animals and plants to microorganisms, including bacteria and archaea.

Causes: Viral infections occur when a virus enters the body and invades the inside of the body's cells in order to reproduce. If the body's immune system is unable to fight off the virus, it multiplies and spreads to other cells, repeating the process and leading to a widespread infection.
A virus is a submicroscopic infectious agent that replicates only inside the living cells of an organism. Viruses infect all types of life forms, from animals and plants to microorganisms, including bacteria and archaea

Please help, (Genetics question)

Answers

The answer is 3

Explanation I just makes sense I don’t know how to explain it but the answer is number 3


Earth's atmosphere and oceans transfer heat through the evaporation and movement of water, producing-
A. Magnetic reversals and living organisms

B. Solar eclipses and lunar storms

C. Earthquake and volcanoes

D. Winds and ocean currents

Answers

Winds and ocean currents

Susan suffered from a heart attack. When the doctors tested the heart muscle they found that she
had an increased ratio of lactic acid to pyruvic acid in her heart tissue. What does this say about
the availability of oxygen in her heart muscle cells?

Answers

Answer:

The heart cells had no received adequate oxygen supply.

A man and a woman have 24 children. Of the children, 17 have brown
eyes and 7 of the children have blue eyes. What are the most likely genotypes of the parents?

Answers

Answer:

Possible genotypes of parents:

Bb and Bb

OR

Bb and bb

Explanation:

Note:

B (dominant) - brown

b (recessive) - blue

explain how important is the role of the parents during the earlier stage of development?​

Answers

The Role of parents is important is the early stage of development because parents are there to teach and help the child learn and advance in life

An Autotroph get energy from the sun, not from food.
Tue
False

Answers

Answer:

True

Explanation:

Inclusion bodies may contain which of the following?

Polyhydroxybutyrate
Ribosomes
DNA
RNA

Answers

Inclusion bodies contain very little host protein, ribosomal components or DNA/RNA fragments.

Inclusion bodies may contain Ribosome, DNA, and RNA. The correct option is B, C, and D.

What is an inclusion?

It is a type of body that is present in neurons, tissue cells, and like red blood cells, bacteria, viruses, etc. It is a type of protein.

These bodies contain or store fats and sugars in animals and in plants it store glycogen.

Thus, the correct options are B, C, and D.

Learn more about inclusion

https://brainly.com/question/20111189

#SPJ2

Predict: How do you think a period of hot summers will affect the rabbit population?

Answers

A period of hot summers will actually affect the rabbit population in a positive way. It will allow the population to increase in size and get ready for harsh weather that is to come for the rest of the year.

Paleoclimatic analysis has generated a claim that there is a possible correlation between an extinction event around 29 million years ago that allowed grasslands to become abundant and the adaptive radiation of several groups of butterflies.

Which of the following proposes the best alternative hypothesis for the claim?

A- Climate analysis conducted by sampling pollen preserved in amber shows an increase in grass pollen 29 million years ago, but there is no significant difference between speciation rate, as well as species richness with regard to butterflies, before and after 29 million years ago.

B- Climate analysis conducted by sampling pollen preserved in amber shows an increase in grass pollen 29 million years ago, which indicates there was an increase in grasslands that correlates to an increase in butterfly speciation during the same time period.

C- There is a correlation between the rapid and wide-ranging decrease in species richness of insects in general 29 million years ago and the increase in species richness and diversity among the butterfly population during the same time period.

D- Evidence of rapid speciation among butterfly species 29 million years ago is evenly distributed among all environments of that period.

Answers

I think the answer could be C

Starting with spore dispersal, and identify adaptations in the life cycle of the bryophyte for living in a terrestrial environment (ie, in air, without water surrounding the plant body). What are new stresses associated with living on land, and what morphological or physiological features did the first land plants have to evolve to cope with these stresses

Answers

Answer:

Stresses such as lack of nutrients, space, competition and water availability.

Explanation:

Lack of nutrients, space, competition and water availability are the stresses that the bryophyte can experience by living on land. The morphological or physiological features such as lowering transpiration rate by stomata, attain specialized structures to collect sunlight and fulfill water requirement by absorbing water from the air if no water is available in the soil etc are the features that the plant has to attain to cope with these stresses.

1. Given the following DNA sequence, determine the correct order of amino acids.

GGCATGAGGTAA

2. For this mutated sequence:

• Determine the correct order of amino acids,

• How the two strings of amino acids will differ.

• also circle the mutation

GGAATGAGGTAA

Which of these is the change.

No Change-
1 Amino acid changed-
Premature stop signal -
No stop signal-
1 amino acid added/deleted -
All the amino acids changed after the point of mutation-

Answers

Answer: 1- CCGT ACT CCATT

2- CCTTACTCCATT

Explanation:

A-----T

C-----G

G-----C

T-----A

Which one of the following is the largest source of greenhouse gases in the atmosphere? A. the burning of fossil fuels B. chemicals released during manufacturing C. the release of carbon dioxide from cellular respiration D. Deforestation​

Answers

a is the answer i believe

The first phase of Mitosis is _________ . In this phase the DNA condenses down into ________, and the duplicated separate. The second phase of Mitosis is_______ . In this phase the sister chromatids line up on the _______ plate through a push and pull motion as they connect to the microtubule spindle fibers emanating from the ________. The third phase of Mitosis is________ . In this phase the________ (sister chromatids or homologous chromosomes) are pulled apart. The fourth phase of Mitosis is_______ . In this phase the nuclear ________starts to reform and the DNA de-condenses.

Answers

The first phase of mitosis is prophase where DNA condenses down into chromosomes and the duplicated separate. The second phase of mitosis is metaphase where sister chromatids line up on the cell plate through a push and pull motion as they connect to the microtubule spindle fibers emanating from the centrosome. The third phase of mitosis is anaphase where sister chromatids or homologous chromosomes are pulled apart. The fourth phase of mitosis is telophase where the nuclear membrane starts to reform and the DNA de-condenses.

MITOSIS:

This question is describing the process of mitosis, a kind of cell division that results in two genetically identical daughter cells. Mitosis consists of four stages namely: prophase, metaphase, anaphase, and telophase etc.

PROPHASE is the first stage of mitosis where DNA condenses down into CHROMOSOMES, and the duplicated separate.

METAPHASE is characterized by the lining up of sister chromatids at the CELL PLATE through a push and pull motion as they connect to the microtubule spindle fibers emanating from the CENTROSOME.

ANAPHASE is the third stage of mitosis in which duplicated chromosome/sister chromatids are pulled apart into opposite poles.

The fourth stage is TELOPHASE where the NUCLEAR MEMBRANE starts to reform and the DNA de-condenses.

Learn more at: https://brainly.com/question/3327479?referrer=searchResults

The image illustrates a building with a green roof - a roof that is covered in
living vegetation. Why would a society use this sustainable practice?
A. It reduces the amount of carbon dioxide taken up in an area.
B. It replaces invasive nonnative plants with native plants.
C. It replaces natural wilderness with more pavement.
D. It reduces the building's energy costs for heating and cooling,

Answers

Answer:The image illustrates a building with a green roof - a roof that is covered in living vegetation . What is a goal of this sustainable practice for societal development ?

Explanation:

A society uses this sustainable practice because it reduces the amount of carbon dioxide in an area. So, the correct option is (A).

What is Sustainable practice?

Sustainable practices are described as supporting ecological, human and economic health and vitality. Sustainability recognizes which resources are limited. It should be used conservatively and wisely which take into account long-term priorities and consequences of the way resources are used.

Reduce, reuse and recycle are the basic principles of wise use of resource. Natural resources are conserved and protected by deploying these principals by reducing landfill waste, energy consumption and pollution.

Some sustainable practices are:

By reusing paper and plastic bags for shoppingBy opting for paperless documentsBy avoiding disposable kitchen items

Thus, a society uses this sustainable practice because it reduces the amount of carbon dioxide in an area. So, the correct option is (A).

Learn more about Sustainable practices, here:

https://brainly.com/question/14815584

#SPJ2

What is one of the causes of daily variations in temperature on a planet's surface?
OA.
the speed of a planet's rotation
OB.
the rotation of a planet's moons
O C.
the time it takes for a revolution around the sun
OD.
the tidal force on the oceans

Answers

Answer:

D

Explanation:

i am sorry if this is wrong

Answer:

A. the speed of a planet's rotation

Explanation:

What do scientists mean when they refer to a
population?
A. all the organisms in an ecosystem
B. all the species that share similar
anatomical features
C. all the animals that acquire resources
through similar methods
D. all the interbreeding members of a certain
species in an ecosystem

Answers

Answer:

d.

Explanation:

What happens to the rate at which the reaction happens when the substrate levels increase?

Answers

Answer:

ok

Explanation:

Other Questions
13. Given the original DNA strand, which of the following would be the new, complementary strandof DNA? ACTTACGCCGAT *(8 Points)CAGGCATAATCGACTTACGCCGATTCAATCGCCGTATGAATGCGGCTA Help please! 50 points! Troll answers WILL be reported Describe how each of thefollowing are evidence for Continental Drift1. Fossils2. Landforms3. Rock Formations4. Climate what is 3/4x2/3a.5/12b. 6/12c.5/7d. 6/7 How to not go to jail for j walking (HELP ASAP)Select the graph which best represents this scenario:The amount of pancake batter that you must mix increaseswith the number of people who come to breakfast. It takes3 cups of batter to serve 10 people.(More context in the picture) What is not a type of text format that will automatically be converted by Outlook into a hyperlink?O email addressO web addressO UNC pathO All will be automatically converted. Cup G has a diameter of 4 in. and a height of 8 in. Find the volume of Cup G. (24^0)+(4^0). solve this problem fast Where dose the earliest known Indian literature come from Eva has a coupon for an oil change with synthetic oil for $59.95. She can buy 5 quarts of synthetic oil, which is what her car needs, for $26.54 and an oil filter for $6.47. How much can she save by doing the oil change herself?$79.22$139.17$59.95$32.92$26.94 which element is shown in the picture here? What is the sum of the two polynomials? Grapes cost $3.25 per pound. Darius paid a total of $26 for grapes.How many pounds of grapes did Darius buy? Which time interval has the greatest speed? resulve las siguientes operaciones matematicas en tu cuadernk PLEASE HELP! Please help me I dont understand how to do this and it has to be done by tonight!!! what effects can war have on politics and society? (20 points)What is the measure of ^1?A:230B:130C:125D:115 4w2 + 3W- 15w - 2Which expression represents the area in square feet that the homeowner will cover with fertilizer?