If someone asked you whether people can be left-brained or right-brained, how might you respond based on what you learned in this activity?

Answers

Answer 1

Answer:

if they write by left hand so they are right brained.

if they write by right hand so they are left brained.

or, the theory is that people are either left-brained or right-brained, meaning that one side of their brain is dominant. If you're mostly analytical and methodical in your thinking, you're said to be left-brained. If you tend to be more creative or artistic, you're thought to be right-brained.

Explanation:

because the right brain is control the left hand

and the left brain is control the right hand


Related Questions

How much of your dna do you think is the same as your friends dna ?

Answers

Answer:

E

Explanation:

Most of our DNA determines that we are human, rather than determining how we are different from any other person. So it is not so surprising that the DNA of any two human beings is 99.9 percent identical.

You are given the following DNA sequence and have determined that it is the sense parental strand. ATTGCCATGAAACGCCCCGGTACACCATTGTTCGGCAAATAAAAATAA What is the polypeptide sequence of this sense strand? Use the three letter abbreviation and separate the amino acids with a dash - e.g. Trp-Thr-Ala. If there is a stop codon - you may add an asterisk to the sequence - e.g. Trp-Thr-Ala-*

Answers

Answer:

* (Stop) - Arg - Cys - Phe - Ala - Gly - Pro - Cys - Gly - Asn - Lys - Pro - Phe - Ile - Phe - Ile

Explanation:

This question involves gene expression, which consists of transcription and translation. The process of transcription involves synthesis of mRNA from DNA template as follows:

DNA - mRNA

ATT - UAA

GCC - CGG

ATG - UAC

AAA - UUU

CGC - GCG

CCC - GGG

GGT - CCA

ACA - UGU

CCA - GGU

TTG - AAC

TTC - AAG

GGC - CCG

AAA - UUU

TAA - AUU

AAA - UUU

TAA - AUU

Using the codon chart, each mRNA codon is translated into an amino acid as follows:

* (Stop) - Arg - Cys - Phe - Ala - Gly - Pro - Cys - Gly - Asn - Lys - Pro - Phe - Ile - Phe - Ile

02:11:13
31
32
33
Kai looks at a photo of herself with her parents. She notices that while her features are similar to her parents features.
they do not appear to be identical.
Which explains why this is the case?
Their DNA is made of different codon sequences.
Their DNA is made of four different bases.
Kai inherited more proteins from one parent than the other.
Kai inherited different amino acids from either of her parents.
Markthanditum
Save and Exit
Next
SER

Answers

Answer:

The awnser would be their DNA is made of different codon sequences.

Explanation:

The reason is Kai gets her sequences from both her mom and dad and so do her parents from their parents and on and on.

The statement that best explains the characteristics of Kai with respect to her parents is as follows:

Their DNA is made of different codon sequences.

Thus, the correct option is A.

Why Kai does not appear to be identical to her parents?

Kai does not appear to be identical to her parents because of the process known as variation. Variations may be defined as the process of differences in traits of individuals of a progeny from each other and from their parents.

The codon that constructs the characteristics of the DNA significantly depends on the triplet of amino acid sequences that alter the formation of proteins which governs all the properties and mechanisms of living organisms including their appearances.

Therefore, the correct option for this question is A.

To learn more about Codons, refer to the link:

https://brainly.com/question/26929548

#SPJ6

Three babies were mixed up in a hospital. After consideration of the data below, which of the following represent the correct baby and parent combinations?
Couple # I II III
Blood Groups A and A A and B B and O
Baby # 1 2 3
Blood Groups B O AB
A) I-3, II-1, III-2
B) I-1, II-3, III-2
C) I-2, II-3, III-1
D) I-2, II-1, III-3
E) I-3, II-2, III-1

Answers

Answer:

The correct option is C) I-2, II-3, III-1

Couple I, Baby 2Couple II, Baby 3Couple III, Baby 1

Explanation:

Due to technical problems, you will find the complete explanation in the attached files

How is blood different after it is pumped through the capillaries in the intestines?

A. it has less oxygen
B. it has more oxygen

Answers

Answer:

B

Explanation:

It has more oxygen blood different after it is pumped through the capillaries in the intestines. Thus the correct option is A.

What is capillaries?

Capillaries are delicate blood vessels that exist throughout body. They transport blood, nutrients and oxygen to cells in your organs and body systems. Capillaries are the smallest blood vessels in your vascular system.

Nutrients are absorbed then it goes into the bloodstream through capillaries. These nutrients include acids, vitamins and fatty acids.

For more information regarding capillaries, visit:

https://brainly.com/question/64497

#SPJ2

As máquinas tem como fonte de calor?
A)Um comburente
B)O gás carbônico
C)Uma Bateria
D)Um combustível.

Answers

Answer:

Hola,  tu respuesta es B. Gas Carbonico

Explanation:

I believe it B. I did the test

Where can food get broken down? Select all that apply.

A. in the stomach
B. in the mouth
C. in the small intestine

Answers

Answer:

The answers are A. and B.

Explanation:

Digestion starts in the mouth when you chew, then the acids in your stomach break the food down further.

I believe A is the answer I learned this awhile ago hope this helps!!

bacterial spieces that retain the purple dye after decolorizer is added and appear blue or violet are referred to as

Answers

Answer:

gram positive is the answer

Explanation:

1. This part of the electromagnetic spectrum passes though lead and has the highest energy of all emissions.

Answers

The answer is Gamma

Gamma rays have so much penetrating power that several inches of a dense material like lead

1. This part of the electromagnetic spectrum passes though lead and has the highest energy of all emissions.

A. Microwave

B. Radio

C. X-Ray

D. Gamma

Answer: D. Gamma Rays

Gamma rays have the highest energies and shortest wavelengths on the electromagnetic spectrum.

☆彡Hanna

#CarryOnLearning

What is the answer to this

Answers

Answer:

in which class you are please tell

3 shows active transport

In tomatoes, red fruit color is dominant to yellow. Round-shaped fruit is dominant to pearshaped fruit. Tall vine is dominant to dwarf vine.
a. Suppose you cross a true-breeding tall plant bearing red round fruit with a true-breeding dwarf plant bearing yellow pear-shaped fruit. Predict the appearance of the generation.
b. Assuming that the genes controlling the three traits are on three different pairs of chromosomes, what are the possible genotypes in the generation?
c. What are the expected phenotypic ratios?

Answers

Answer:

a) Al the offspring will have genotype - TtRrOo

b) Al the offspring will have genotype - TtRrOo

c) Tall, Red and Round

Explanation:

Given -

Red color of fruit is dominant to yellow color of fruit.

Round shape of fruit is dominant to pear shape of fruit

Also, Tall vine is dominant to dwarf vine

Crossing -  true-breeding tall plant bearing red round fruit (TTRROO) * true-breeding dwarf plant bearing yellow pear-shaped fruit (ttrroo)

a) Al the offspring will have genotype - TtRrOo

b) Al the offspring will have genotype - TtRrOo

c) Tall, Red and Round

Select the correct answer. Oll-rich countries in the Middle East cover about 4% of Earth's total land area but possess about 48% of the world's known oil reserves. What is the main reason for the high concentration of reserves in this part of the world?​

Answers

Answer: The main reason for the high concentration of reserves in this part of the world which is the middle east that covers bout 4% of earth's total land area but possess about 48% of the world's known oil reserves is due to GEOLOGICAL PROCESSES. Hope this answer helps.

A slow change in a species over many generations is

Answers

Answer:

micro evolution

Explanation:

The answer is micro evolution

A slow change in a species over many generations is called [tex]\sf\purple{evolution}[/tex].

[tex]\bold{ \green{ \star{ \orange{Mystique35}}}}⋆[/tex]

the volume of a human brain is normally about 1200cm3. the osmolarity of solutes in the cerebrospinal fluid surrounding the brain is normally about 300mM. how does the volume of the brain change when the cerebrospinal fluid osmolarity drops to 280mM

Answers

Answer:

yesterday was a temporary password is goes by

1. 7. The ability to taste the chemical PTC is determined by a single gene in humans with the ability to taste given by the dominant allele T and inability to taste by the recessive allele t. Suppose two heterozygous tasters (Tt) have a large family. Predict the proportion of their children who will be tasters and nontasters. What is the likelihood that their first child will be a taster

Answers

Answer:

3/4 taster; 1/4 non-taster

The likelihood that their first child will be a taster: 75 %

Explanation:

Complete dominance occurs when a dominant gene variant or 'allele' completely masks the expression of the recessive allele in heterozygous individuals (i.e., individuals carrying one copy of the dominant allele and one copy of the recessive allele). In this case, both parents are heterozygous for a single gene trait (i.e., the ability to taste) which is ruled by complete dominance. In consequence, the expected phenotypic ratio in the progeny (F1) will be:  

- Alleles: T (dominant taster allele); t (recessive non-taster allele)

- Parental cross: Tt x Tt

- Punnett Square from this cross:

         T        t

T       TT     Tt

t        Tt       tt

Expected F1 phenotypic ratio: 3/4 taster (i.e., 1/4 TT genotype + 1/2 genotype Tt = 3/4 or 75%); 1/4 non-taster (tt genotype = 1/4 or 25%). Moroever, the chance that the first child has the taster phenotype is 3/4 (75%).

Which of these is a long-term human health issue likely caused by air
pollution?
A. Cancer
B. Damaged hearing
C. Dementia
D. Bioremediation

Answers

Answer:

A. Cancer

Explanation:

Since Lung Cancer is a type of Cancer you can get Cancer.

Drag each label to the correct location.
Classify the organisms based on what they eat.

Answers

Answer:

plants---- producer

trees---- producer

earthworm------decomposer

zebra---- consumer

tiger------- consumer

I don't seem to see the last item there clearly

Answer:

plants---- producer

trees---- producer

earthworm------decomposer

zebra---- consumer

tiger------- consumer

I hope this helps

does skim milk contain roughage?​

Answers

Yes it does indeed Just look it up also lol

The complementary DNA sequence of AATTGGCC is

TTAACCGG
AATTGGCC
GGCCAATT
ATATGCGC

Answers

The first one TTAACCGG

Answer:

TtAaccgg

nznzn

Explanation:

nnsjsbsjjzhz

what is the meaning of localisation ?​

Answers

The meaning of localisation is the process of making something local in character or restricting it to a particular place.

Localization is the adaptation of a particular product or service to one of those markets.

... XxMissFlirtyxX...

Describe the function of Chloropasts

Answers

Answer:

Chloroplasts are found in plant cells, they make up the green pigment ( chlorophyll ) which manufactures food for the plant during photosynthesis process.

differentiate between the plants of sugarcane and plantain..​

Answers

Sugarcane or sugar cane refers to several species and hybrids of tall perennial grass in the genus Saccharum, tribe Andropogoneae, that are used for sugar production. The plants are 2-6 m (6-20 ft) tall with stout, jointed, fibrous stalks that are rich in sucrose, which accumulates in the stalk internodes. Sugarcanes belong to the grass family, Poaceae, an economically important flowering plant family that includes maize, wheat, rice, and sorghum, and many forage crops. It is native to the warm, temperate tropical regions of India, Southeast Asia, and New Guinea. The plant is also grown for biofuel production, especially in Brazil, as the canes can be used directly to produce ethyl alcohol (ethanol).

PLEASE MARK ME AS BRAINLIEST.☺️☺️☺️✌️✌️✌️

Environmental factors can influence natural selection because they can increase or decrease?
the number of chromosomes in an individual.
O the number of chromosomes in a population.
the amount of genetic variation in an individual.
O the amount of genetic variation in a population.
оо

Answers

Answer:

...

Explanation:

.......................

Answer:   the amount of genetic variation in a population.

Explanation: :)

Mitochondria and chloroplasts have a number of features in common. Which of the following is NOT one of them?

Answers

Answer:

give options.............

A hypothesis that is non-falsifiable is ___________.

Answers

Answer:

Si no es posible refutarla, dicha teoría queda «corroborada», pudiendo ser aceptada provisionalmente, pero no verificada; es decir, ninguna teoría es absolutamente verdadera, sino a lo sumo «no refutada».

Explanation:

Si no es posible refutarla, dicha teoría queda «corroborada», pudiendo ser aceptada provisionalmente, pero no verificada; es decir, ninguna teoría es absolutamente verdadera, sino a lo sumo «no refutada».

which of these diseases cannot be controlled by killing the vector?
A. River blindness
B. Malaria
C. Polio
D. Cholera
E. Bilharzia (shistosoma)

Answers

Answer:

malaria

Explanation:

hopes this helps

Which polymers contain nitrogen?
A.starch
B.glycogen
C.cellulose
D.chitin
E.amylopectin

Answers

Answer:

Chitin

Explanation:

Chitin is a polysaccharide containing nitrogen

What 4 organic compounds is carbon found in?

Answers

Answer:

Carbon is the primary component of macromolecules, including proteins, lipids, nucleic acids, and carbohydrates.

Explanation:

) A florist obtained a prize winning flower that he wants to breed to be sold. The trait that makes his flower stand out is dominant for a particular trait. In order to successfully breed this flower, he needs to make sure that the dominant trait is pure dominant and not a hybrid. What should the florist do to determine whether or not the flower is pure or hybrid for this trait?

Answers

Answer:

The correct answer is - Test cross.

Explanation:

A test cross is a cross that is made between an organism with an unknown dominant genotype and an organism that purebred recessive genotype for the particular trait. It determines if the unknown genotype of the individual being tested is purebred allele dominant or heterozygous for the trait.

If all offspring in F1 generation has phenotypically dominant trait then the tested organism is pure breed dominant and if half of the offsprings have the phenotypically dominant trait and half show recessive trait then the organism to be tested is heterozygous or hybrid.

The florist will test cross whether or not the flower is pure or hybrid for this trait.

A test cross would be a hybrid between this and an individual with nothing but an undiscovered dominating genotype as well as a creature having a purebred minority genotype for such specific characteristic.It establishes whether the undiscovered genotype of the subject being examined is purebred allele dominant as well as heterozygous for something like the characteristic.

Thus the aforementioned response is correct.

Learn more about test cross here:

https://brainly.com/question/16805498

What kind of community does the photograph show?
A. Mountainous
B. Metropolitan
C. Coastal
D. Rural
Pls help

Answers

Answer:

That is a rural community.

The green area on the map shows the rural community. It is an open land with less population, houses and with lots of open spaces. It is rural community in the given image.

What are the types of community?

There are so many options to live in a community.

The community can be of following types:

Rural community: Here houses are made very far from each other. It has open land spaces with less density of population.Urban community: These are located in cities. In this type of community, people lives in very close proximity.Suburban community: This community is a mixture of urban and rural community.

Thus, the given paragraph is of rural community.

For more details regarding rural community, visit:

https://brainly.com/question/14057728

Other Questions
13. How many electrons does a complete third electron shell hold? Bob and John went to the candy store. Bob bought 5 pieces of fudge and 3 pieces of bubble gum for a total of $5.25. John bought 2 pieces of fudge and 3 pieces of bubble gum for a total of $3.00. What was the cost of the fudge and the gum? What is the y-intercept for y = 5x^2 + 2x -2? Which is the best example of poetic language?1 Heed his slippery words, his wicked ways.2 A girl was giggling behind the door.3 Once upon a time a frog was kissed.4 We saw a boat on the ocean at sunset. 2. Length of a rectangular park is 11 m and breadth is 5m. Find the area of thepark. If of the park is covered with plants and grass, find the remaining area. The Z90 project being considered by Steppingstone Incorporated (SI) has an up-front cost of $250,000. The project's subsequent cash flows are critically dependent on whether another of its products, Z45, becomes an industry standard. There is a 50% chance that the Z45 will become the industry standard, in which case the Z90's expected cash flows will be $110,000 at the end of each of the next 5 years. There is a 50% chance that the Z45 will not become the industry standard, in which case the Z90's expected cash flows will be $25,000 at the end of each of the next 5 years. Assume that the cost of capital is 12%. Refer to data for Steppingstone Incorporated. Based on the above information, what is the Z90's expected net present value? Group of answer choices$6,678 $3,251 $15,303 $20,004 $45,965 How many solutions exist for the given equation?1/2(x + 12) = 4x -1zeroonetwoinfinitely many 4. Is y = 6 a linear equation? Explain. plz answer my question:-if U= {0,1,2,3,4..................20}, A= {1,3,5,7,9,11,13,15,17,19} B= {0,2,4,6,8,10,12,14,16,18} then prove that A-B = AB Help please I need this done Which types of forces exist between the two protons in a helium nucleus?1.a repulsive electrostatic force and a repulsive gravitational force2.a repulsive electrostatic force and an attractive strong nuclear force3.an attractive electrostatic force and an attractive gravitational force4.an attractive electrostatic force and an attractive strong nuclear force Mrs .Thomas has $71.00 to purchase bottles of juice for her class. If the bottles of juice cost $3.55 each ,how many bottles can she buy? What is the true meaning of absolute value? Last month, Claire's bank statement said that she overdrew her account. Her bank balance was -45.3245.32minus, 45, point, 32 euros. when was philippines found? Use the geometric mean (altitude) theorem. What is the value of m? 4 2 StartRoot 7 EndRoot 4 StartRoot 10 EndRoot 160 TP1. (State the meaTP2. (Define accounting.TP 3. accounting.) 1/4x1/2x1/3 help pls hurry if a cold piece of metal is added to hot water, the water will Why is the statue of former president Teddy Roosevelt outside the American Museum of Natural History so controversial?