Answer:Adaptation in Darwins Finches. Beak depth, which is correlated with body size and the ability to crack larger seeds, varies according to drought conditions: plants produce fewer, harder seeds in dry years and more, softer seeds in wet years. Only larger birds with deeper depths survive in drought years.
Explanation:
Can someone please help me
Answer:
carbon dioxide plus water in the presence of light energy to sugar and oxygen
HURRY. Why is transcription said to be unidirectional?
Answer:
Transcription is unidirectional because you are copying only ONE side of the DNA. Remember that DNA is a double stranded helical structure. One strand of DNA is complementary to the other strand.
Explanation:
What change to the following molecule's structure would result in a saturated fat?
Answer:
It needs to gain a Hydrogen atom to eliminate the double bond between the two carbons.
Explanation:
Unsaturated fat has one or more double bonds in its molecule. Saturated fat has a single bond. If you want an unsaturated fat to become saturated it needs to gain more more hydrogen atoms which will eliminate the double bonds between carbons of the unsaturated fat.
Hope this helped :)
Which statement best explains the myth about how Romulus and Remus founded Rome?
Answer: Romulus defeated his brother, then founded Rome on one of the seven hills.
Explanation: Despite there is no answer choices, I'm thinking back on a little quiz I took, and it had the same exact question with the same exact answer choices, and that was the correct answer
help need answer asap !!
What is the purpose of the other tube of water?
Explanation:
cant see photo
Answer:
delude the other thing
there is no picture so i have no idea what your asking. ill edit this answer to be more specific when you explain
Explanation:
please answer this!!
Answer:
mouth coughing out biok sid carbon
How does evolution result in reproductive success?
Answer:
Often when species evolve, they receive a trait that may make them live longer or make it where their survival chances are significantly increased. Which in turn can make their offspring stronger and able to live longer, therefore increasing their population.
There are many different types of cells with many different types of cellular structures and functions. Which of these structures is found in all types of eukaryotic cells?
A. chloroplast
B. cell wall
C. nucleus
D. centrioles
Answer:
nucleus
Explanation:
chloroplasts and cell walls are only found in plant (and fungi) cells, while centrioles are only in animal cells.
The structure that is found in all types of eukaryotic cells is the nucleus. The correct option is C.
What are eukaryotic cells?Eukaryotic cells are those cells that contain true cell organelle. These cells are present in the higher organism, and they perform complex functions like replication, mitosis, etc.
There are two types of cells. They are prokaryotic and eukaryotic cells. Prokaryotic cells are those that do not contain an organelle and a nucleus. They are present in smaller organisms.
The nucleus is the brain of cells. It controls all functions of cells, and it contains the genetic material of the organisms. In prokaryotic cells, the nucleus is absent and in eukaryotic cells, the nucleus is present. That is the difference between them.
Thus, the correct option is C. nucleus.
To learn more about eukaryotic cells, refer to the link:
https://brainly.com/question/982048
#SPJ6
Answer this please I promise 30 points + mark as brainliest ( only relevant answers )
Answer:
A) Group X = Rose ,mango tree,marigold,palm tree
B) This is the answer of group X =Rose ,mango
This is the answer of group Y =Fern ,pine trees
Explanation:
Answer:
jen, from my heart im saying i lu.v u for real
its been almost 5 months weren't having the same old c.hat we used to have.
ik that ur scared to c.hat with me since the day ur mom caught u
but still the old memories keep coming into me how many times i try to forget u, i still lu.v u jen still lu.v u
and as i made u a promise that one day we'll meet, i still keep thqat word and that day even if its just one day, we're gonna enjoy the max we could
i'll be waiting for that moment and i hope u would be too...
still lu.v u :( .......
What is the atomic mass of Sulfur that has 18 neutrons?
Answer: 32.066 atomic mass units
B is the correct option.
write a short paragraph on hydra
Answer:
at the moment i am thinking of 3 different hydra, marvel, mythical creature and creation on sexual reproduction between plants. If you could tell me the subject i could explain it to you. :)
Explanation:
Which of these is an advantage of fossil fuels? *
O Reliable
O Large reserves
O Greenhouse gas emissions
O Non-renewable
Answer:
reliable
Explanation:
Explanation:
Fossil fuels are a non-renewable resource.
Can you tell me which go where?
Answer:
heredity goes to the first one
phenotype at the second one
Explanation:
Most stars seem to move across the night sky because
a. the universe is expanding
b.the universe is getting smaller
c. Earth is orbiting the Sun
d. Earth is spinning on its axis
I think it is C but uh if its not D Hope this helps-
Explanation: because
Electron transport from complex I to complex IV pumps more protons than transport from complex II to complex IV.
With this in mind, which will produce more ATP
A. Transport from complex I produces more ATP.
B. Transport from complex II produces more ATP.
C. Both produce the same amount of ATP.
Answer:
A
Explanation:
ATP synthase uses a proton gradient to make ATP. Since transport from complex I creates a larger proton gradient, it also produces more ATP.
Electron transport from complex I produces more ATP.
ELECTRON TRANSPORT CHAIN:
The electron transport chain, ETC, is the third and last stage of aerobic cellular respiration. It produces the highest molecules of ATP in cellular respiration. The ETC involves the transfer of electrons to series of molecules in order to create an electrochemical gradient needed for ATP synthesis. The electron transport chain is made up of four complexes namely: Complex I, II, III and IV. NADH and FADH2 produced in the Krebs cycle are the electron carriers. Complex I pumps more hydrogen ions (H+) from the mitochondrial matrix to the intermembrane space. Since the pumped is directly related to the number of ATP molecules, complex I will produce more ATP molecules.Learn more: https://brainly.com/question/442662?referrer=searchResults
write the code for RNA from this DNA STRAND :
AAAAAATTTTTTCCCGGGGTTTATATATC
Answer:
UUUUUUAAAAAAGGGCCCCAAAUAUAUAG
Explanation:
All you have to do is apply the same concept as DNA, but T (Thymine) is replaced with U (Uracil)
17. What causes evaporation?
O Air that is unsaturated with water vapor comes into contact with the surface of the water
O Air that is cooler than the water comes into contact with the surface of the water
O Air that is warmer than water comes into contact with the surface of the water
O Air that is supersaturated with water vapor comes into contact with the surface of the water in
Evaporation occurs when air that is warmer than water comes into contact with the water's surface, hence option A is correct.
What is evaporation?As a liquid transforms into a gas, evaporation, a sort of vaporization, occurs on the liquid's surface. For instance, a high concentration of the evaporating substance in the surrounding gas significantly slows down evaporation when humidity affects the rate of evaporation of water.
It takes in moisture from garden soil as well as the biggest lakes and seas, and the level of the water will decrease when it is heated by the sun.
Therefore, solar energy, or heat from the sun, is what causes the evaporation process to occur, hence option A is correct.
Learn more about evaporation, here:
https://brainly.com/question/5019199
#SPJ5
Which factor makes enzymes well-suited to the role of catalyst in a biochemical reaction?
A)Enzymes do not affect the energy of a reaction.
B)Enzymes slow down reactions so products can form.
C)Enzymes can be reused because they do not permanently bond with substrate.
D)Enzymes can only bind to other enzymes so the same product is formed each time.
Answer: C
Explanation: Once an enzyme binds to a substrate and catalyzes the reaction, the enzyme is released, unchanged, and can be used for another reaction.
Enzymes can be reused because they do not permanently bond with substrate.
What are Enzymes?
A biological catalyst called an enzyme is usually always a protein. It accelerates a certain chemical reaction in the cell. The enzyme is continuously employed during the reaction and is not destroyed. Each enzyme molecule found in a cell is unique and tailored to a particular chemical reaction.
Proteins called enzymes assist our bodies' chemical reactions move forward more quickly. For several processes, including digestion and liver function, enzymes are crucial.
Health issues might result from having too much or too little of a specific enzyme. Healthcare professionals can also use the enzymes in our blood to look for injuries and illnesses.
Therefore, Enzymes can be reused because they do not permanently bond with substrate.
To learn more about Enzyme, refer to the link:
https://brainly.com/question/14953274
#SPJ6
The charged particles in the beams that Thomson studied came from atoms. As these particles moved away from their original atoms, they formed a visible beam. The current model of the atom includes protons, neutrons, and electrons.
What is the best use of an atomic model to explain the charge of the particles in Thomson’s beams?
An atom’s negative particles are surrounded by positive matter, so the positive particles are easier to remove.
An atom’s positive particles are surrounded by negative matter, so the negative particles are easier to remove.
An atom’s smaller negative particles are at a distance from the central positive particles, so the negative particles are easier to remove.
An atom’s larger positive particles are at a distance from the central negative particles, so the positive particles are easier to remove.
The question to the above information is;
What is the best use of an atomic model to explain the charge of the particles in Thomson's beams?
Answer;
An atom's smaller negative particles are at a distance from the central positive particles, so the negative particles are easier to remove.
Explanation;
-Atoms are comprised of a nucleus consisting of protons (red) and neutrons (blue). The number of orbiting electrons is the same as the number of protons and is termed the "atomic number" of the element.
J.J. Thomson discovered the electron. Atoms are neutral overall, therefore in Thomson’s ‘plum pudding model’:
atoms are spheres of positive chargeelectrons are dotted around insideAnswer:
Its C on edge
Explanation:
1. Energy transfer is inefficient between trophic levels because
A. Molecules are fully digested from each trophic level.
B. Dead organisms and waste are recycled throughout the trophic levels.
C. Organisms within a trophic level are fully consumed.
D. All organisms within a trophic level die.
2. Primary productivity is defined as
A. The rate that plants and other photosynthesis organisms produce organic compounds.
B. The process where green plants and some other organisms convert light energy into chemical energy using carbon dioxide and water.
C. The overall amount of energy captured by plants and other photosynthetic organisms by the chloroplast.
D. The adjusted amount of energy in an ecosystem due to energy use by organisms for respiration.
Thanks if you help, It's highly appreciated. :-)
Answer: b dead organisms And waste are recycled throughout the tropic levels.
Explanation:
Answer:
part 2
the rate that plants and other photosynthetic organisms produce organic compounds.
Explanation:
:)
Which of the following foods are native to rainforests?
a. papayas
b. mangoes
c. Sugarcane
d. all of the above
Answer:
on edge here's the correct answer
Explanation:
Answer: It is D)
Explanation:
How is the rock in the deep mantle similar to the rock in the parts of the mantle nearest the surface? How is it different?
Answer:
Rocks within the mantle contain more magnesium and iron than the ones in the crust. Difference: Rocks in the deep mantle are under intense heat and pressure.
What increases as you move from the surface to the interior of the Earth?
Answer:
Heat/temperature
Explanation:
"There are three main sources of heat in the deep earth: (1) heat from when the planet formed and accreted, which has not yet been lost; (2) frictional heating, caused by denser core material sinking to the center of the planet; and (3) heat from the decay of radioactive elements." These give the core and a few of the outer layers of the earth more and more heat.
Which statement is true about gold and helium?
A. They both occur as a gas at room temperature.
B. They are both made of subatomic particles.
C. They are both used in balloons.
D. One of made of protons and the other of only electrons.
Answer:
The answer is B
B. They are both made of subatomic particles.
An example of __ is the color of betta fish. When a RED fish (GG) is crossed with a YELLOW fish (gg), all of the offspring will be a ORANGE color (Gg)
Answer:
The correct answer is - incomplete dominance.
Explanation:
In the betta fish, there are different types of colors found in the fishes depends on the alleles present in their gene which follows incomplete dominance. Incomplete dominance is an inheritance pattern where a dominant allele does not mask completely and produce a blend of both alleles if present in heterozygous condition.
In the question, It is stated that when a cross between RED fish (GG) and a YELLOW fish (gg) produce orange color fish as offspring (Gg) which is a mix or blend of both alleles Red (dominant) and yellow (recessive).
20 points and will mark brainliest! Please explain how you got it though
Answer:
crossing over during meiosis
Explanation:
i just had biology last semester hope this helps
o
1. Which criteria are used to classify amphibians into orders?
Answer:
They are classified into three orders: frogs and toads, salamanders and newts, and caecilians.
Which objects have the most eccentric orbits?
A. Uranus and Neptune
B. Jupiter and Earth
C Saturn and Venus
D. Mercury and Pluto
PLEASE HELPPPPPPP
(Monstro the Goldfish & Epigenetics)
Answer:
mmmmmmmmmmmmdddddd
Explanation:
ddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddd
