Explanation:
Problem Set 4 Answers
1a. The template DNA strand, from which the mRNA is synthesized, is 5’ CAAACTACCCTGGGTTGCCAT 3’
(RNA synthesis proceeds in a 5’ à 3’ direction, so the template strand and the mRNA will be complementary to each other)
b. The coding DNA strand, which is complementary to the template strand, is 5’ ATGGCAACCCAGGGTAGTTTG 3’
c. The sequence of the mRNA is 5’ AUGGCAACCCAGGGUAGUUUG 3’
(the sequence of the mRNA is complementary to the template strand and identical to the coding strand with U substituted for T)
d. The third codon is 5’ ACC 3’. Therefore, the corresponding anti-codon is 5’ GGU 3’
2. Below is a table for the genetic code:
T
C
A
G
T
TTT Phe (F)
TTC "
TTA Leu (L)
TTG "
TCT Ser (S)
TCC "
TCA "
TCG "
TAT Tyr (Y)
TAC "
TAA Stop
TAG Stop
TGT Cys (C)
TGC "
TGA Stop
TGG Trp (W)
C
CTT Leu (L)
CTC "
CTA "
CTG "
CCT Pro (P)
CCC "
CCA "
CCG "
CAT His (H)
CAC "
CAA Gln (Q)
CAG "
CGT Arg (R)
CGC "
CGA "
CGG "
A
ATT Ile (I)
ATC "
ATA "
ATG Met (M)
ACT Thr (T)
ACC "
ACA "
ACG "
AAT Asn (N)
AAC "
AAA Lys (K)
AAG "
AGT Ser (S)
AGC "
AGA Arg (R)
AGG "
G
GTT Val (V)
GTC "
GTA "
GTG "
GCT Ala (A)
GCC "
GCA "
GCG "
GAT Asp (D)
GAC "
GAA Glu (E)
GAG "
GGT Gly (G)
GGC "
GGA "
GGG "
a. The following codons can be mutated by one base to produce an amber codon:
CAG Gln
AAG Lys
GAG Glu
TCG Ser
TTG Leu
TGG Trp
TAA Stop
TAT Tyr
TAC Tyr
The complementary strand will read TAA-GGG-CGT since the A is complementary to T and C is to G nucleotide.
What are nucleotides?A biological molecule known as a nucleotide has the basic building blocks of a nitrogenous base, pentose sugar, and phosphate. As polynucleotides, DNA and RNA are composed of a chain of monomers with various nitrogenous bases. The execution of metabolic and physiological processes requires nucleotides.
Building blocks of nucleic acids, energy storage, carriers of activated metabolites for biosynthesis, structural moieties of coenzymes, and metabolic regulators are all roles that nucleotides play in the physiology of animals.
Adenine and thymine and guanine and cytosine are the proper bases to couple with in DNA. Therefore, the complementary strand will read TAA-GGG-CGT since the A is complementary to T and C is to G nucleotide.
Learn more about nucleotides, here;
https://brainly.com/question/28178584
#SPJ2
You are working with a set of human remains that show two pathologies. You note some spongy bone on the upper side of the eye socket of the individual. You also note several lips or spurs of bone protruding from the vertebra. What two afflictions did the individual likely suffer from
Answer:
Porotic hyperostosis and an iron deficiency anemia
Explanation:
Iron deficiency anemia is a popular type of anemia caused by the deficiency of the mineral iron in the blood. The body needs iron to produce hemoglobin which helps to distribute oxygen in the body. When there is no iron in the blood, the entire body would be deprived of oxygen.
Porotic hyperostosis is a condition whereby the bones in the skull or cranial vault becomes spongy and swells. The cause of the condition could be the hemolytic or megaloblastic anemia that occurs as a result of excessive production of hemoglobin.
Why is it important to avoid applying too much nitrogen fertilizer?
O A. Too much nitrogen can buffer cells from extremes in pH.
B. Too much nitrogen in surface runoff can poison fish.
C. Too much nitrogen in surface runoff can cause algae to overgrow.
O D. Too much nitrogen can increase the salinity of soil.
Answer:
too much nitrogen in surface runoff can cause algae to overgrow
Nitrogen fertilizers used in large-scale agriculture could leave a legacy of pollution that would persist for decades in soil and groundwater, scientists in France and Canada warned, which published a study in the National Academy of Sciences magazine, " PNAS ". According to these scientists, the excess of these fertilizers in the environment has been linked to contaminated drinking water and can cause the rapid growth of algae that compromise aquatic ecosystems and coastal marine life.
Explanation:
Brainliest please?
Some people see hydroelectric energy, energy harnessed from water
movement, as a clean alternative to fossil fuels. Others believe that utilizing
this renewable energy source is dangerous for the salmon populations that
rely on water sources for migration. Which environmental factor should be
taken into consideration when deciding to use renewable sources of energy
like hydroelectricity?
a. cost savings from switching from fossil fuels to renewable energy
increases in carbon emissions due to the production of new energy
systems
decreases in renewable energy as they are being used for human
sustainability
d. fluctuations of limiting factors in the ecosystem affected by the new
source of energy
C.
The correct answer is D. Fluctuations of limiting factors in the ecosystem affected by the new source of energy.
Explanation
As is mentioned in the statement, the energy from a hydroelectric plant is obtained through the movement of water that makes move some blades which produce energy with it. lLater, this is transformed and transported to the cities. However, to obtain these clean natural renewable resources, it is necessary to take into account what environmental factors may be affected with the implementation of a hydroelectric plant, because the operation of hydroelectric can affect natural processes such as fish migration, patterns of reproduction, feeding, among others that take place in a river, having negative consequences for these species which would cause an imbalance in nature. According to the above, the correct answer is D. Fluctuations of limiting factors in the ecosystem affected by the new energy source.
Sand blowing against a rock is an example of
erosion
physical weathering
chemical weathering
Answer:
physical weathering
Explanation:
Tim has long eyelashes (dominant) and Karen has short eyelashes (recessive). Which statement is true?
O You know Tim's genotype and phenotype.
O You only know Tim & Karen's genotype.
O You know Karen's genotype and phenotype. O You know both Tim & Karen's genotype and phenotype.
O You know Karen's genotype and phenotype.
because short eyelashes is a recessive gene and that means it's present in two copies
On a weather map, wind speeds are related to____.
A. the location of elevation changes
B. the spacing of isobars
C.the spacing of isotherms
D. the location of fronts
The negative effects of
include flash floods, mudslides, and droughts.
Answer:
Deforestation would be your answer.
hope it helps!
6)Why do the walls of the stomach secrete hydrochloric acid?
7)Which TWO parts of the alimentary canal make up the small intestine?
1.The enzyme pepsin.Pepsin breaks down proteins in the stomach
2 Im pretty sure its the duodenum and the ileum
When a tree is cut and burned, it is converted into which of the following?
carbon reservoir
carbon cycle
carbon source
carbon sink
Answer:
Carbon Source
Explanation:
When trees are burnt, they release all the carbon inside them. Therefore, making it a source.
Answer:
Carbon Source
Explanation:
Fire takes up oxygen and releases all of the Carbon from inside of the tree.
Imagine a type of plant that people could eat as food, BUT it was
found to make MORE oil per hectare than microalgae. Would you
recommend using algae OR this new plant for fuel? Why or why not?
(Write at least 3 complete sentences)
Answer:
Although each of these strategies is being used to produce fuels, they are ... Algae can produce biomass very rapidly, with some species doubling in as few as 6 h, and ... Microalgae have additional advantages over terrestrial plants. ... The terrestrial models use land that is not presently used for food agriculture. One of the fuel sources of the future is algae, small aquatic organisms that convert sunlight into energy and store it in the form of oil. S. ... Algae could potentially produce up to 60 times more oil per acre than land-based plants. ... In the future, anything that runs on gasoline and diesel could also use biofuel from algae.
Explanation:
Paul has a disorder caused by a defective gene in his mitochondria. It Paul
marries Helen, who has no family history of the disorder, what percentage of
their children will likely have the disease?
A. 25 percent
B. 100 percent
C. O percent
D. 50 percent
Answer:
25 percent
Explanation:
"What is the function of the organelle known as the mitochondria" a:to make carbon hydrates b: to make lipids c: to make ATP d: protein synthesis
Answer:
To make ATP
Explanation:
Do turkeys get sleepy from that thing in turkey that makes you sleepy?
Answer:
Turkey allegedly causes drowsiness because it is packed with a nutrient called tryptophan. Tryptophan is one of 20 naturally occurring amino acids—the building blocks of proteins. Because the body is unable to manufacture tryptophan on its own, it must be obtained from food protein.
1) Describe the process of osmosis
2)What is ostmotic pressure?
3)Describe the importance of a semipermeable membrane in osmosis?
4)Explain the connection between isotonic solutions and osmosis
5)Why is osmosis referred to as an example of facilitate diffusion?
ANSWER THESE CORRECTLY AND YOU WILL GET 55 points!
Help please ! Thanks
Answer:
75%
Explanation:
The allele for purple flowers (capital P) is dominant.
The allele for white flowers (lowercase p) is recessive.
If one allele is capital P, it doesn’t matter if the other allele is another capital P or a lower case p, the capital P will dominate and purple flowers will show up.
The Punnett Square shows:
PP, Pp, Pp, and pp
• 3 of the offspring have at least one dominant and capital P, so purple flowers show up.
• 1 of the offspring has two lowercase and recessive alleles (p), so white flowers show up.
3/4 or 75% of the offspring will have purple flowers.
[tex]\huge\boxed{Option A}[/tex]
_____________________________________ PEA PLANT:Pea plant has purple color flowers dominant over white color flowers.
Purple flower dominant allele is P
White Flower recessive allele is p
We would get White flower pea plant only when the recessive allele is in HOMO.ZYGOUS condition
_________________________________________________________
CONDITIONS:Hom.ozygous Dominant Alleles: PP (Purple Flower)
Heter.ozygous Dominant Alleles: Pp Purple Flower)
Hom.ozygous Recessive Alleles: pp (White Flower)
____________________________________ CROSS:Whenever we cross Heterozygous Dominant(Pp) purple flower with another Heterozygous dominant (Pp purple flower), we get 75% of the flowers PHENOTIPICALLY(physical appearance) white flowered, and 25 white flowered Because as you can see in the picture,
The P1 is Pp
The P2 is Pp
When we cross them,
It has 4 offsprings,
PP Hom.ozygous Purple flower
Pp Heterozygous Purple flower
Pp Heterozygous Purple flower
pp Hom.ozygous white flower
Thus the answer is 75% as there are phynotypically 3 purple flowers present
_____________________________________ Best Regards, 'Borz'1. List the 5 types of tissue found in an animal’s body.
Answer:
There are four types of tissues found in animals: epithelial tissue, connective tissue, muscle tissue, and nervous tissue. In this lab you will learn the major characteristics of each tissue and examine various types of each tissue under the microscope.
Explanation: I don't know the #5 but there are four of them
why might the author have capitalized the word "DO"
Answer:
To express a feeling in a sentence. Or, if someone is saying it to bolden the meaning.
Explanation:
Which of the following best describes why cells must be tiny?
Answer: Cells must be tiny so the DNA will not overload.
Explanation:
Answer:
cells must be tiny
Explanation:
they have to be tiny because your body is made up of hundreds of cells and they make up your body and in order to have the cells your body needs as you grow they asexual reproduce which makes more and makes you grow which is why they are tiny and when science is special because they need a special tool to see. the cells
Read the article and use it to answer the question that follows.
Sex Linked Inheritance
Why are women often carriers of X-linked traits but rarely affected by them?
Answer:
See the answer below
Explanation:
Women are often carriers of X-linked traits but are rarely affected by the trait because they have two X chromosomes and the two have to carry the X-linked allele in order for them to be phenotypically affected, especially if the trait is a recessive one.
Unlike men that are XY and only require one X-linked allele in order to be affected for X-linked recessive traits, women need two alleles - one on each chromosome - in order to be affected. One of the X chromosomes of a woman usually comes from the woman's father and the other one from her mother. In order to be affected, a woman must inherit an affected chromosome from her father and her mother respectively, thereby reducing the probability of having the trait.
The X chromosome of a man usually comes from his mother. Hence, a man only needs to inherit an affected chromosome from his carrier mother to be affected for the trait, thereby increasing the probability of having the trait when compared to a woman.
This is not the case for X-linked dominant traits where both men and women have an equal chance of being affected.
Women carry two XX chromosomes in their cells. They carry the X chromosome but rarely gets affected by the trait because to be phenotypically affected they should carry X linked disease trait on both the X chromosomes.
Especially in the case when the trait is recessive then they should have two XX chromosomes which are linked to traits.
In the male, they have one X and one Y chromosome so they acquire an X chromosome and gets affected by it.
In male presence of one X chromosome from the carrier mother is enough to pass the trait. While in females to have X linked recessive trait they should have two alleles.
The woman does not get affected as one chromosome comes from the father and the other from the mother so to be affected the woman must acquire genes with traits from both parents.
Therefore, women are often carriers but are rarely affected by them.
To learn more about X linked traits follow the link:
https://brainly.com/question/11189684
what is chromosomes
Answer:
Chromosomes are thread-like structures located inside the nucleus of animal and plant cells. Each chromosome is made of protein and a single molecule of deoxyribonucleic acid (DNA). Passed from parents to offspring, DNA contains the specific instructions that make each type of living creature unique.
Cellular respiration involves a reaction between glucose and oxygen to form_____
1: carbon dioxide
2: water
3: all of these
4: energy
Answer:
3. All of these
Explanation:
When the reaction of cellular respiration occurs, carbon dioxide and water is created while energy gets released.
Answer:
3: all of these
Explanation:
They actually form ATP, which is essentially energy. Byproducts are water and carbon dioxide. I would say all of these answers are true! Remember though, ATP (energy) is the main product while water and carbon dioxide are byproducts.
PLZ HELP!.......Which features help reduce the amount of runoff that occurs in an area?
A)hard soil
B)steep slopes
C)paved surfaces
D)increased vegetation
Answer:
The answer is D) Increased vegetation.
Explanation:
Plants help keep earth and soil in place so it wont cause runoff.
Answer:
The Answer would be D). increased vegetation.
Explanation:
Edge 2021
Which two terms describe this type of bone fracture?
simple, incomplete
compound, complete
simple, complete
compound, incomplete
The correct answer is Compound, complete
Explanation:
Bone fractures occur as bones (hard tissue that is part of the skeleton) break, which can be caused by traumatic incidents, certain diseases, among others. Moreover, fractures are classified into different categories such as compound/simple, complete/ incomplete depending on the characteristics of the bone fracture.
In the case of compound fracture, this occurs if the bone is exposed. This means the bone breaks and then displaces causing an open wound. This occurs in the bone fracture from the image because the bone has moved to the left and break the skin, muscle, and other tissue of the area. On the other hand, a fracture is complete is the fragments of the bone are completely separated, which occurs in the image because the bone has been completely divided into two sections.
sunspots sit on the sun's ____
Answer:
photosphere
Explanation:
plz mark B R A I N L I E S T
Nietzsche believes that aesthetics is not as promising as religion.
true or false
Answer:
True
Explanation:
Believe in me
The belief of Nietzsche that aesthetics is not as promising as religion is definitely true.
What is Aesthetics?Aesthetics may be defined as a branch of philosophy that deals with the nature of beauty, art, and taste and with the creation and appreciation of beauty.
Religion is significantly a part of life that is different from the aspects of aesthetics, eating items, and thought processes.
Religion is something that deals with the concept of peace, joy, and prosperity among the people of the same or different religions.
Therefore, the belief of Nietzsche that aesthetics is not as promising as religion is definitely true.
To learn more about Aesthetics, refer to the link:
https://brainly.com/question/1011079
#SPJ2
From which countries have pandemic flu outbreaks originated? Check all that apply.
Russia
Mexico
USA
Canada
Answer: USA, And Russia
Explanation:
if a news article contains bias what should you do?
A.take it as fact
B.read another article on the same topic
C.throw the article away
D.automatically agree with the reporter
Answer: B
Explanation:
Answer:
B!
Explanation:
E d g e 2021
What form does the radiation that is used to treat cancer take?
SOS
alpha particles
photons
beta particles
neutrons
Answer:
Photon radiation
A high-energy photon beam is by far the most common form of radiation used for cancer treatment. It is the same type of radiation that is used in x-ray machines, and comes from a radioactive source such as cobalt, cesium, or a machine called a linear accelerator (linac, for short).
The speed of radioactive particles is also an important factor in medical use. Beta particles travel very fast. This, combined with their small size, gives them significant penetrating power. In cancer treatment, for example, beams of beta particles can be created outside the patient's body and directed at tumors.
Answer:
b
Explanation:
Grade 8 2020-2021
Which form of energy is almost always produced during energy transformations?
O
A heat
B. electricity
C. light
D. sound
Answer:
A
Explanation:
Because I searched it up
Answer:
A
Explanation:
During transformations from one form to another, heat energy is almost always produced. Whenever a form of energy is converted to the other form, heat is almost always released during the reaction.
you think that there is still discrimination between
Sons and daughters in terms of providing education in our country | What Strategies do you suggest to overcome such discrimination against girls ?
Answer:
well for me i don't think so cause you see now a days that parents treat their children equally they don't have to spoil the son and forgets nout the daughter, parents are equally to their kids and in that case their will be no discrimination at all