If you have a cup of water the
same temperature as the
ocean, which has more heat
energy? why​

Answers

Answer 1

Answer:

the ocean because there are a lot of particles.

Explanation:

I HOPE ITS HELP YOU


Related Questions

please help me answer this

Answers

Answer:

last one a dormancy structure D

Explanation:

It helps keeps bacteria and stuff dormant`

Complete the T-chart by categorizing each environmental factor as something that would most likely increase or decrease genetic variation. Some answers will fit in both columns depending on the situation.

Predator-prey relationships
Competition
Toxins
New habitat
Disasters
Increased food source
A 2-column table has columns with labels Increase variation and decrease variation.

Answers

Answer: 1. Decrease 2. Decrease 3. Both 4. Both 5. Decrease 6. Increase

Explanation: I got it right hopefully it helps

Answer:just did it

Explanation:

What are the products (comes out) of cellular respiration? (select all that apply)
A. Carbon dioxide

B. oxygen

C. Water

D. Glucose (sugar)

Answers

ANSWERS
A. carbon dioxide
B. glucose (sugar)
Yo WaSsuPp!!   ^v0!!

                         What are the products (comes out) of cellular respiration? (select all that apply)

A. Carbon dioxide

B. oxygen

C. Water

D. Glucose (sugar)

 Well Well Hello again XD, trust me when i say i'm not stalking you UvU...i'm just really into biology XD

Anyway the answer to your question is:

               Carbon dioxide and Water!!I apologize if i'm wrong//You're welcome if i'm correct

((-Side Note-)): glad i could help lol

                            I hope you have a great day ^v^"

The nucleoid occlusion mechanism is critical for the timing of chromosome partitioning. This mechanism ensures that _____. A. the Z ring forms before chromosome segregation B. the Z ring forms after the cell wall synthesizing machinery is assembled C. the Z ring forms after chromosome segregation D. the Z ring forms after the divisome is assembled

Answers

Answer:

C. The Z ring forms after chromosome segregation

Explanation:

Nucleoid occlusion, NO, is a mechanism in which the nucleoid prevents the the division of the chromosome in the cell's cylindrical part before segregation of the chromosome around the middle of the cell

NO is achieved by not allowing the formation of Z ring formation close to the nucleoid, (before the chromosome is segregated) thereby aiding the specification of the septation location

Therefore, the Z ring is formed after the chromosome is segregated

IS THIS CORRECT IF NOT WHATS THE ANSWER FAST PLS

Answers

Yep, that is a good answer!

What is the main function of the endocrine system?

A. secrete hormones

B. send nerve impulses

C. produce blood cells

D. produce DNA

Answers

the main function is A, secrete hormones

Answer:

I think the answer to your question is option A , secrete hormones

which structure is unique to eukaryotic cells

Answers

Answer:

Unlike prokaryotic cells, eukaryotic cells have a membrane-bound nucleus, a central cavity surrounded by a membrane that houses the cell's genetic material. A number of membrane-bound organelles, compartments with specialized functions that float in the cytosol.

Explanation:

hope this helps

IS THIS CORRECT?? IF NOT WHATS THE ANSWER PLEASE

Answers

Yup it is correct

Hope u get good marks stay safe
:D

Explica qué son los codones y los anticodones La siguiente secuencia de nucleótidos de ADN codifica para una secuencia de aminoácidos que forman una proteína hipotética, encuentre la secuencia de codones, anticodones y aminoácidos que se forman 5 ` A T G A G C A C C C A A A C T T G C TC T T A T T C T A A A A A G A C T 3

Answers

Answer and Explanation:

La informacion genetica de ensamblaje de aminoácidos durante la sitntesis proteica, se almacena en unidades llamadas codones.

Un codón es una secuencia corta de tres nucleotidos provenientes de la cadena de ADN o ARN mensajero. Cada codón representa uno de los 20 aminoácidos disponibles para sintetizar la proteina. En total hay 64 codones, de los cuales 61 codifican aminoácidos (mas de un codón puede codificar para el mismo aminoácido), de los cuales uno de ellos a parte es el codon de inicio de sintesis proteica. Los restantes tres codones corresponden a codones de finalización.

El anticodón es la secuencia de nucleótidos presentes en ARN de transferencia, que complementa a cada codón de ARN mensajero. De esta forma el ARNt reconoce el aminoácido correspondiente y lo ensambla en la nueva proteina.

ADN ⇒ 5 ` ATGAGCACCCAAACTTGCTCTTATTCTAAAAAGACT 3

Codones   ATG-AGC-ACC-CAA-ACT-TGC-TCT-TAT-TCT-AAA-AAG-ACT

ARNm ⇒  UACUCGUGGGUUUGAACGAGAAUAAGAUUUUUCUGA

Codones  UAC-UCG-UGG-GUU-UGA-ACG-AGA-AUA-AGA-UUU-UUC-UGA

Recordá que para ARNm, la secuencia de nucléotidos debe ser la complementaria para ADN.

Anticodones de ARNt ⇒ Complementarios a los codones de ARNm. Recordá que para los ARN, la timina se reemplaza por uracilo.

AUG-AGC-ACC-CAA-ACU-UGC-UCU-UAU-UCU-AAA-AAG-ACU

La proteina se construye en función de la información del ARNm, es decir que para la selección de aminoácidos, se consideran los codones del ARNm, y no los anticodones de ARNt.

UAC-UCG-UGG-GUU-UGA-ACG-AGA-AUA-AGA-UUU-UUC-UGA

TYR  SER  TRP  VAL   Stop  THR  ARG  ILE  ARG  PHE  PHE  Stop

Durante el 2° período académico, los estudiantes de 7° de un colegio de Armenia estudiaron los diferentes tejidos vegetales e hicieron un experimento con una planta de fríjol. Para el experimento, regaron con agua únicamente las hojas superiores de la planta, impidiendo por completo la caída de agua a la tierra en la maceta. Al cabo de 1 mes arrancaron la planta de raíz para estudiar esta zona y se dieron cuenta de que, si bien la tierra estuvo completamente seca durante todo el mes, las raíces se habían mantenido bien hidratadas. ¿Qué tejido podría explicar los resultados observados por los estudiantes de 7°?

Answers

i don’t know spanish sorry

Why aren't human gonads up near our heart like they are in fish?

Answers

Because fish need them near their heart for warmth. Fish often travel in cold temperatures, whereas humans have no need for protection over cold temperatures.

When considering ecosystem biodiversity, why would it be dangerous to treat each ecosystem as an isolated environment?
1. each ecosystem has a constant and consistent number of predators
2. rainfall is global occurrence that impacts every ecosystem on the planet
3. environmental conditions appearing in one ecosystem may appear in another
4. there are complex interactions that take place between ecosystems

Answers

Answer:

1

Explanation:

they can never be mixed

What is the smallest LIVING part of an organism?

A. Molecules

B. Cells

Answers

Answer:

Hi, there the answer is a cell

Explanation:

The smallest living part of an organism is a cell. The cell is the smallest structural and functional unit of living organisms, which can exist on its own.

Answer:

B. Cells

Explanation:

The cells are the smallest living part of an organism.

In what part of the plant are substances transported to where they are needed?
A. Roots

B. Stem

C. Leaves

Answers

Answer:

B. Stem.

hope it helps

stay safe healthy and happy.

Answer:

B. Stem

Explanation:

In the stem part of the plant are substances transported to where they are needed. So, the option (B) is the correct answer.

What do the bullhorn acacia
trees get from the acacia
ants?

Answers

Answer:

The plants provide food and accommodation in the form of food bodies and nectar as well as hollow thorns which can be used as nests. The ants return this favor by protecting the plants against herbivores

Explanation:

Which of the following best contrasts the structures found in plant and animal cells?

A. Animal cells have a large vacuole, a cell wall, and chloroplasts while plant cells have small vacuoles, no chloroplasts, and no cell wall.
B. Animal cells have small vacuoles and no chloroplasts while plant cells have chloroplasts, a large vacuole, a cell wall.
C. Animal cells have small vacuoles, a cell wall, and no chloroplasts, while plant cells have a large vacuole, no cell wall and chloroplasts.
D. Animal cells have a large vacuole and no chloroplasts while plant cells have small vacuoles, chloroplasts, ands a cell wall.

Answers

Answer:

B

Explanation:

The answer is B because animals have small vacuoles and no chloroplast while plants cells have chloroplast, a large vacuole, a rigid cell wall.

What is likely to happen to a healthy population that is experiencing exponential growth ?

Answers

Exponential growth refers to the increase in the growth of the population with respect to the time. The healthy population will likely to decrease after experiencing exponential growth because the carrying capacity of a region will not be able to sustain the growth of increase in number of individuals.

what do you mean by faunal Diversity

Answers

Answer:

animal life especially

Explanation:

i hope it helps

this is my answer

correct me if im wrong

#carryonlearning

Nick has had a very stressful job for more than 10 years. At Nick’s annual doctor’s visit, what effects would the doctor most likely identify in Nick?

Answers

Answer:

don't known ask the goggle

A city installs recycling centers that take wood products. How might the
recycling centers help increase the availability of wood?
O A. Recycling increases the cost of wood.
O B. Recycling increases the consumption of wood.
C. Recycling increases the supply of wood.
D. Recycling increases the demand for wood.

Answers

Answer:

C. Recycling increases the supply of wood

The shape of a protein is most directly determined by the (1) amount of energy available for synthesis of the protein (2) kind and sequence of amino acids in the protein (3) type and number of DNA molecules in a cell (4) mistakes made when the DNA is copied

Answers

Answer:the answer is 2 kind and sequence of amino acids in the protein

Explanation:

Plant cell walls connect with other plant cell walls to create plants
A. organelles
B. mega cells
C. vacuoles
D. tissue

Answers

It’s B.Mega cells…..

helppppppp plzzzzzzzzzzzzzzzzz

Answers

Answer:

A

Explanation:

Im not sure what this is but im pretty sure its A it just seems the most logical but once u get someone good to answer this tell me if u got it right or not im curious bhaaajjajaja

The huge U.S. Army base at Fort Bragg, North Carolina is home to a number of butterflies, plus other endangered animals and plants. Howitzers used during artillery training kill some of the butterflies, but fires started by the howitzer blasts also produce conditions in the base’s forests and wetlands that the butterflies need to survive. This is an example of which characteristic of military bases that makes them useful for conservation?

Answers

Answer: Because they cause a disturbed ecosystems.

Explanation: It is evident that the military base provided both survival and elimination platforms for the butterflies species, translating that the butterflies are living in a disturbed ecosystem.

Hence, this provides a good template to understudy conservation for the purpose of maintaining and making wise-use of important wildlife resources and most importantly, the endangered species. Butterflies species dynamics had been used as an important tool for conservation for years now.



3x + 2y = 6 is an equation in standard form.

Answers

Answer:

3x+2y=6xy because we have to add

Choose three things that blood transports throughout the body.

Nerve impulses

French fries

DNA

nutrients

wastes such as CO2

oxygen

Answers

Answer:

nutrientswastes such as CO2oxygen

Explanation:

Blood brings oxygen and nutrients to all the parts of the body so they can keep working. Blood carries carbon dioxide and other waste materials to the lungs, kidneys, and digestive system to be removed from the body. Blood also fights infections and carries hormones around the body.

The body's transportation system, the blood, transports innumerable compounds to different parts of the body. Blood carries three things throughout the body: Oxygen, nutrients, and wastes such as carbon dioxide (CO2).

1. Blood carries oxygen from the lungs to all the cells of the body. Cellular respiration requires oxygen to generate the energy (in the form of ATP) that drives many bodily activities.

2. Blood carries nutrients absorbed by the digestive system to cells throughout the body. These nutrients, which are essential for growth, repair and building energy, include glucose, amino acids, fatty acids, vitamins and minerals.

3. Wastes such as [tex]CO_2[/tex]: Removes carbon dioxide from the blood cells, which is a byproduct of cellular metabolism, and carries it to the lungs for expiration. The acid-base balance of the body is maintained by this mechanism.

Learn more about Blood, here:

https://brainly.com/question/32316698

#SPJ6

PLZ HELP ASAP I NEED THIS NOW

Answers

Your lungs…………,……………..

Needed substances are carried to the body cells by:
A)enzymes
B)blood
C)water
D)food

Answers

blood The way needed substances are carried to the body cells.

valves Structure that prevents blood from flowing backward.

capillaries Vessels where materials are exchanged between the blood and the body cells.

ventricle Pumps blood out of the heart

A Canyon landscape is of economic importance to an area. Explain
how this landscape can be utilized to secure economic sustainability
to the inhabitants.​

Answers

Answer:

.

Explanation:

............................

The financial advantages of a canyon landscape are contingent on careful management and long-term use. Careful preparation and oversight can ensure that the canyon's natural resources and attractiveness are conserved while also benefiting the local community's economic well-being.

What is Canyon landscape?

A canyon landscape is a form of topography characterised by deep and narrow valleys with sides that are steep, which are frequently created over time by a river or other water sources. Canyons varies in size spanning small gorges to enormous networks of interconnected valleys and can be found all over the world, from barren deserts to lush forests.

Canyons are primarily formed by erosive processes that include water, wind, and ice, that erode away the soil and rock gradually over time. The canyon walls get steeper and more prominent as the surrounding ground erodes, creating a distinct environment that is frequently physically attractive and ecologically varied.

Therefore, careful preparation and oversight can ensure that the canyon's natural resources and attractiveness are conserved while also benefiting the local community's economic well-being.

Learn more about Canyon landscape, here:

https://brainly.com/question/22035152

#SPJ2

what are alleles mutations in the dna

Answers

Answer:

Mutations Are Recessive or Dominant

Other Questions
Please help! I dont understand how to solve it with no angle Qu funcin cumple la poltica en los conflictos sociales Say you had the following DNA sequence: ATGCTGCGAAACTTTGGCTGA Let's say there was a mutation that removed one letter (the first C): ATGCTGCGAAACTTTGGCTGA Provide the 6 DNA codons that would be read following the mutation. Are they the same as the original 6 DNA codons that would have been read 1.Name the canan that connects the Red sea to the Mediterranean Sea2.Name the country where coffee was discovered3.Name the system of racial segregation seen in South Africa4What is the term given to the peninsula that forms the easternmost projection of the African continent5Name the precious gem that is the major natural resource of Africa6Name the Savannah region that is the site of the largest mammal migration on Earth A digital signal differs from an analog signal because it a.consists of a current that changes smoothly. b. consists of a current that changes in pulses. c.carries information. d. is used in electronic devices. Write an equation for the line that is parallel to the given line and that passes through the given point. y = 1/2x - 8; (-6, -17). Find the equation of the line that passes through the points A (2, 3) and B (5, -7) how did advancements in technologry help bring a quick end to conflict in the pacific during world war II My School in vanacola In what way was the Third Reich most successful?Strikes only occasionally affected production of goods.Factories and the infrastructure were expanded.The media enthusiastically supported the work of the ruling party.The workplace was open to many individuals. Consider the functionsf(x) = xn and g(x) = xmon the interval [0, 1], where m and n are positive integers and n > m. Find the centroid of the region bounded by f and g. Write 8 as a percentage of 32Plssss helppp A senator introduces a bill by taking it to the president pro tempore, the majority leader, and the minority leader.TrueFalse****If a bill cannot be voted on due to the lack of members present, it is unlikely that the bill will make it to the House floor.True***False 27:28A leader of the Montgomery Bus Boycott who also became the spokesperson for nonviolent protest by AfricanAmericans wasElla Baker.O James Farmer.O Rev. Ralph Abernathy.O Martin Luther King Jr.SubmitSave and ExitMark this and retumContentViewers/AssessmentViewer/Activity Which equation gives the volume of the sphere?O V=2/3(27)O V=4/3(27)O V= 2/3 (27)O V= 4/3 (27) por qu se termina el bombardeo de Hiroshima y nagasaki Explain how the slow recovery of the bald eagle population likely affected the recovery of the salmon population I just wanna kno how yo day goin n who ur top 3 fav rappers Last month, the Tecumseh Corporation supplied 400 units of three-ring binders at $6 per unit. This month, the company supplied the same quantity of binders at $4 per unit. Based on this evidence, Tecumseh has experienced:_________.a. a decrease in supplyb. an increase in supplyc. an increase in the quantity suppliedd. a decrease in the quantity supplied. the average of three numbers is 25. two of the numbers are 18 and 40. what is the third number