ILL GIVE BRAINLIEST TO WHOEVER ANSWERS FIRST (and correctly ofc)

ILL GIVE BRAINLIEST TO WHOEVER ANSWERS FIRST (and Correctly Ofc)

Answers

Answer 1

Answer:

y = 3 (4)^x

Step-by-step explanation:

quadruples means multiplies by 4

This equation is in the form

y = ab^x  where a is the initial amount and b is the amount we multiply by

y = 3 (4)^x

Answer 2

Answer:

B

Step-by-step explanation:

The exponential model is of the form

y = a[tex]b^{x}[/tex]

where a is the initial amount and b the growth rate

Here a = 3 and b = 4 , then

y = 3 [tex](4)^{x}[/tex] → B


Related Questions

¿Cuál es la expresión algebraica que representa el área sombreada en la siguiente figura?

Answers

La respuesta es : 10x + 4

La fórmula para el área sombreada es:

((x + 3) (2x + 1)) - (x (2 x-3)).

Simplificar

(2x ^ 2 + 7x + 4) - (2x ^ 2 -3x).

Sustraer

= 10x + 4

If 3 is added to three quarters of certain number,the result is 30.Find the original number If 3 is added to three quarters of a certain number, the result is 30. Find the original number

Answers

Answer:

[tex]x=36[/tex]

Step-by-step explanation:

From the question we are told that:

 [tex]3+\frac{3}{4}x=30[/tex]

Therefore

Making x subject

 [tex]x=\frac{4}{3}(30-3)[/tex]

 [tex]x=\frac{4}{3}(27)[/tex]

 [tex]x=36[/tex]

What number is 16% of y?

Answers

Answer:

0.16y

Step-by-step explanation:

16% of y is found by substituting 0.16 for 16% and then multiplying y by 0.16:

0.16y

0.16y

when you get the value of why you can then find the answer by multiplying the value of y by 16 and divide the answer by 100

cual es el perimetro de 12 cm de ancho y 22 de largo



es para hoy

Answers

Answer:

Perimeter of figure = 68 centimeter

Step-by-step explanation:

Given information:

Width of side = 12 centimeter

Length of side =  22 centimeter

Find:

Perimeter of figure

Computation:

Perimeter of rectangle = 2[l + b]

Perimeter of figure = 2[Width of side + Length of side ]

Perimeter of figure = 2[12 + 22]

Perimeter of figure = 2[34]

Perimeter of figure = 68 centimeter

what is the answer to this math question?

Answers

Answer:

answer is 230

Step-by-step explanation:

they need more than 800 so u take 800-571 which is 229 u then add one because u need at least one more than 800 which is 230.

Answer:

230.  

Step-by-step explanation:

You need more than 800 so you take 800 and talk away 71 which is 229, and then add 1 because you need at least one more than 800 , and you get an answer 230.  

CAN SOMEONE HELPPPPPP PLEASE?!??!!!!?

Answers

If AM=10, then AC=10 because both are radii. TC is a diameter so that’ll just be the radius doubled. TC=20!

Evan wants to make an array of 32 miniature cars. What are all the different ways Evan can place the cars?

Answers

Answer:

6

Step-by-step explanation:

An array will have would constitute the shape of a parallelogram, in which you are essentially solving for s₁ and s₂. Note that there are 32 miniature cars in all, in which both sides, when multiplied, must result in said number:

32 x 1 = 32

2 x 16 = 32

4 x 8 = 32

8 x 4 = 32

16 x 2 = 32

1 x 32 = 32

There are 6 ways for Evan to create a array of 32 miniature cars.

~

How many solutions exist for the system of equations below? ​

Answers

Answer:

No solution or none

Step-by-step explanation:

3x+y=18 equation 1

3x+y=16 equation 2

-3x-y=-18 multiply equation 1 by -1

0=-2 add above 2 equations

no solution or none

Select the correct answer.
For the next five years, a dairy company wants to increase its
(PLEASE HELP 30 POINTS!!!)
daily milk processing capacity (in gallons) by the equation y = x6 – 9** + 70x2
where x is the number of years. How many years will it take until the company can process 630 gallons of milk in a day?

answer choices

OA. 2 years
ОВ.3 years
OC. 4 years
OD.5 years

Answers

Answer:

5 years

Step-by-step explanation:

To determine the number of years needed for the company to process a certain amount of milk, we use the given function which relates the number of years, x, and the gallons of milk, y. We simply substitute the number of gallons to y and solve for x.  

y = x^6 − 9x^4 + 70x^2

630 = x^6 − 9x^4 + 70x^2

Solving for x, we will have

x = 4.8866 years or approximately 5 years

Hope this answer helps you :)

Have a great day

Mark brainliest

53.9 as a mixed number

Answers

Answer:

The fraction 53 9 is equivalent to 5 8 9.

Step-by-step explanation:

This fraction is a improper fraction once the absolute value of the top number or numerator (53) is greater than the absolute value of the bottom number or denomintor (9). So, the equivalent fraction is a mixed number which is made up of a whole number (5) and a proper fraction ( 8 9 ).

[tex]53 \frac{9}{10}[/tex]

53.9 can be split into 53 and .9

53 is the whole number

.9 is in the tenths place so it can be written out of 10: [tex]\frac{9}{10}[/tex]

It doesn't need to be simplified leaving us with 53 [tex]\frac{9}{10}[/tex]

Find an equation for the perpendicular bisector of the line segment whose endpoints are
(−1,−7) and (5,−3).

Answers

Answer:

y = -2/3x - 11/3

Step-by-step explanation:

a right triangle has legs of lengths 7 and 2, what is the length of the hypotenuse to the nearest tenth

Answers

Answer:

hypotenuse = 7.3

Step-by-step explanation:

here 7 and 2 are the legs og the right triangle .we should find hypotenuse.

let the legs of the right triangle be a nd b respectively . And c be hypotenuse

using pythagoras theorem to find hypotenuse

a^2 + b^2 = c^2

7^2 + 2^2 = c^2

49 + 4 = c^2

53 = c^2

[tex]\sqrt{53}[/tex] = c

7.28 = c

7.3 =c

Answer:

7.3

Step-by-step explanation:

[tex]7^{2} + 2^{2} = x^{2} \\ 53 = x^{2}\\\sqrt{53} = \sqrt{x^{2}} \\x = 7.3[/tex]

PLS ANSWER ASAP DUE 9:35

Answers

Answer:

c) 72

hope this helps!

please give brainiest<3

Answer:

72

Step-by-step explanation:

Substitution:

4^3 + 4 x 6 - 16

64+24-16=72

A phone company charged $67 for monthly access and $14 for each gigabyte of data used. If you sign a two-year contract and use 147.5 gigabytes of data, which value is the closest approximation to the total amount you will pay for phone service?

A. $2,700
B. $2,900
C. $3,400
D. $4,400

Answers

3,400, step by step explanation:
It’s C - first you multiply 67x24(2years) and then you find the multiplication of 14x147.5(how much gb used by the cost of one gb) and then you add the products of the 2 equations. It should look like this.
(67x24) + (14x147.5) = 3,673
They said an approximation to the total amount and C will be the closest one

FAST PLEASE HELP MEEE: At a certain high school, 35 students play only stringed instruments, 10 students play only brass instruments, and 5 students play both. There are also 5 students who play neither stringed nor brass instruments. what is the probability that a randomly selected student plays either a string or brass instrument?
P(AUB)={?}

Answers

Answer:

10/11

Step-by-step explanation:

35 stringed , 5 string and brass, 10 brass, 5 play neither string nor brass

P (A or B ) = students that play string or brass / total number of students = 35+5+10/ 35+5+10+5 = 50/55 = 10/11

What is the solution to the system of equations graphed below

Answers

Answer:

A

Step-by-step explanation:

The solution to a system of equations given graphically is at the point of intersection of the 2 lines.

The lines intersect at (- 1, - 1 ) ← solution → A

The solution is A i’m sure like the other guy said

Can anyone help me on this I would appreciate it

Answers

Answer:

14

Step-by-step explanation:

Triangle=180

180-90 (RA) = 90

90-41= 39

(2x+11)=39

2x=28

x=14

Insee its finna be 14

A bag contains 5 red marbles, 4 blue marbles and 7 green marbles. If three marbles are drawn out of the bag, what is the exact probability that all three marbles drawn will be green?

Answers

Answer:

.094

Step-by-step explanation:

5/11 is .455

11 total marbles 5 are green

but thats the probability of just one draw

so .455 x .455 x .455 is .094 for three separate draws

Directions: Solve for x. Round your answer to the nearest tenth. Make sure you calculator
is in degree mode!
11
35

Answers

Answer:

its 10 because chu papi munenu

Find the area of the shaded sector

Answers

Answer:

888

Step-by-step explanation:

Im pretty sure this is the answer, if helpful please mark me as brainiest :>

Which equation represents "the sum of eight times a number and seven is twice the number"?

8N + 7 = 2N
8N = 7 + 2N
8 (7 + 2N)
7N + 8 = 2N

Answers

The answer is 8N+7=2N
A - 8n + 7 = 2N - due to the question

Find the equation of the line that is perpendicular to the line
y = x-9 and passes through the point (7,9).

Answers

Answer:

[tex]y=-x+16[/tex]

Step-by-step explanation:

Hi there!

What we need to know:

Linear equations are typically organized in slope-intercept form: [tex]y=mx+b[/tex] where m is the slope and b is the y-intercept (the value of y when x is 0)Perpendicular lines always have slopes that are negative reciprocals (ex. 3 and -1/3, 5/6 and -6/5, etc.)

1) Determine the slope (m)

y=x-9

Rewrite the equation

y=1x-9

Now, we can identify clearly that the slope of the line is 1. The negative reciprocal of 1 is -1, so therefore, the slope of a perpendicular line would be -1. Plug this into [tex]y=mx+b[/tex]:

[tex]y=-1x+b\\y=-x+b[/tex]

2) Determine the y-intercept (b)

[tex]y=-x+b[/tex]

Plug in the given point (7,9) and solve for b

[tex]9=-7+b[/tex]

Add 7 to both sides to isolate b

[tex]9+7=-7+b+7\\16=b[/tex]

Therefore, the y-intercept is 16. Plug this back into [tex]y=-x+b[/tex]:

[tex]y=-x+16[/tex]

I hope this helps!

if a dice is rolled 240 times how many times do you think it will land on each number?​

Answers

Answer:

being they all have the same amount of chances to be rolled on the same amount  i would say 40

Step-by-step explanation:

Fast Rental Services and Red Rent Services provide rental cars. Fast Rental Services charges a flat fee of $4.50, plus $0.75 for every mile traveled. On the other hand, Red Rent Services charges a flat fee of $7.50, plus $0.65 for every mile traveled. Which equation could be used to find the distance, d, when the cost of renting the cars from both the companies are the same?

Answers

Answer:

4.50+.75d=7.50+.65d

Step-by-step explanation:

Y=4.50+.75d equation 1

y=7.50+.65d equation 2

4.50+.75d=7.50+.65d sub value of y in equation 2 into equation 1

.10d=3.00 simplify equation

d=30

check answer by subbing 30 for d into each equation.

y=4.50+.75(30)

y=4.50+22.50

y=27

y=7.50+.65(30)

y=7.50+19.50

y=27

both equations equal so 30 is the correct distance for when Fast Rental equals Red Rent

A group of friends wants to go to the amusement park. They have $363 to spend on
parking and admission. Parking is $5.50, and tickets cost $35.75 per person,
including tax. How many people can go to the amusement park?

Answers

Answer:

10 people can go to the amusement park

Step-by-step explanation:

363 - 5.50 = 357.5

357.5 / 35.75 = 10

Helpppppppppppppp!!!!!!!!!

Answers

Answer:

both 2 and -2

Step-by-step explanation:

Substitute 4 for r(x) on the given equation.

[tex]4=x^2[/tex]

[tex]\sqrt{4} =\sqrt{x^2}[/tex]

[tex]x=2[/tex]

[tex]x=-2[/tex]

Rationalize the denominator and simplily.​

Answers

Answer:

( (√ a+ 1) − 2 ) ^2/a-3

Step-by-step explanation:

Answer:

Step-by-step explanation:

(a-b)² = a²-2ab + b²

(a+b)(a-b)=a²-b²

[tex]\frac{\sqrt{a+1} -2}{\sqrt{a+1}+2}= \frac{(\sqrt{a+1}-2)(\sqrt{a+1}-2 )}{(\sqrt{a+1}+2 )(\sqrt{a+1}-2)}\\\\[/tex]

             [tex]=\frac{(\sqrt{a+1}-2 )^{2}}{(\sqrt{a+1} )^{2}-2^{2}}\\\\=\frac{(\sqrt{a+1})^ {2}-2*\sqrt{a+1}*2+2^{2} }{a+1-4}\\\\=\frac{a+1 - 4\sqrt{a+1}+4 }{a-3}\\\\=\frac{a+5-4\sqrt{a+1} }{a-3}[/tex]

What is the domain of the function v = root(3, x)

Answers

Answer:

The first answer. Negative infinity to positive infinity.

Step-by-step explanation:

As long as x is a real number, there will be a cube root

Answer:A

Step-by-step explanation:

Which of the lines that appear in the graph would be parallel to a line with a slope of 3 and a y intercept at 0,3

Answers

Answer:

Line AB

Step-by-step explanation:

The line is on crosses thru the exact points so its right.

Two boys and 3 girls were selected for the finals of a dance contést. One of the three different prizes marked A. B and C will be randomly awarded to the 5 contestants whose name is selected to win. Find the probability that the boy will win the prize marked B?

Answers

Answer:

2 boys and 3 girls were selected for the finals.

There are 3 prizes, A, B, and C (assigned in order, I suppose) assigned randomly to the five contestants.

We want to find the probability that a boy wins the prize B.

So here we have two cases:

A girl wins the first prize, A, and a boy the prize B.

The probability that a girl wins the prize A is equal to the quotient between the number of girls and the total number of contestants, this is:

p = 3/5

Next, the probability that a boy wins the prize B, is equal to the quotient between the number of boys and the total number of contestants (that now is 4, because a girl already won prize A).

q = 2/4

The joint probability is:

P = p*q = (3/5)*(2/4) = 6/20 = 3/10

Now we have the other case, where a boy wins the prize A and the other boy wins prize B.

The probability that a boy wins prize A is equal to the quotient between the number of boys and the total number of contestants, this is:

p = 2/5

The probability that the other boy wins prize B is equal to the quotient between the remaining number of boys (1) and the total number of contestants (now 4), this is:

q = 1/4

The joint probability is:

P' = p*q = (2/5)*(1/4) = 2/20 = 1/10

The total probability is the sum of the probabilities for the two cases, this is:

Probability = 1/10 + 3/10 = 4/10

(note that because the prize C is assigned after prize B, its existence does not affect the probability for the previous event, as expected)

Other Questions
The use of symbols such as charts, graphs, and signs are best classified as* 1 point oral communication written communication visual communication audio visual communication how to solve the chemical formula for Calcium Chlorate Joelle is a manager at a construction company, and she is interested in the chemistry behind the materials they use. She has begun studying the materials used to fill walls. She knows that to keep the temperature inside a room steady the material must be a thermal insulator, and she predicts that materials should not be acidic or else they would dissolve too easily in water.Which of these is a molecular ingredient that could be used in a wall-filling material ?C27H36N2O10Na6Ba6NeNaHCl Please help me with this I need it bad Which line from "I'm Nobody! Who Are You? by Emily Dickinson contains a sime?"Then there's a pair of usdon't tell"They d banish us you know.""How public. like a frogTo tell your name the livelong day" In young Goodmans Brown hawthornes reveals his feelings about his Puritan ancestors when Which is the definition of chronology? Please help, only a couple of days left!!! Translate and solve: twenty-three greater than b is at least 276. Solve the inequality.1x+5 < 62Help me please Please help! I dont understand how to solve it with no angle Qu funcin cumple la poltica en los conflictos sociales Say you had the following DNA sequence: ATGCTGCGAAACTTTGGCTGA Let's say there was a mutation that removed one letter (the first C): ATGCTGCGAAACTTTGGCTGA Provide the 6 DNA codons that would be read following the mutation. Are they the same as the original 6 DNA codons that would have been read 1.Name the canan that connects the Red sea to the Mediterranean Sea2.Name the country where coffee was discovered3.Name the system of racial segregation seen in South Africa4What is the term given to the peninsula that forms the easternmost projection of the African continent5Name the precious gem that is the major natural resource of Africa6Name the Savannah region that is the site of the largest mammal migration on Earth A digital signal differs from an analog signal because it a.consists of a current that changes smoothly. b. consists of a current that changes in pulses. c.carries information. d. is used in electronic devices. Write an equation for the line that is parallel to the given line and that passes through the given point. y = 1/2x - 8; (-6, -17). Find the equation of the line that passes through the points A (2, 3) and B (5, -7) how did advancements in technologry help bring a quick end to conflict in the pacific during world war II My School in vanacola In what way was the Third Reich most successful?Strikes only occasionally affected production of goods.Factories and the infrastructure were expanded.The media enthusiastically supported the work of the ruling party.The workplace was open to many individuals.