In a laboratory experiment with three groups of students, one group drinks pure water, a second group drinks an equal amount of beer, and a third group drinks an equal amount of concentrated salt solution, all during the same time period. Their urine production is monitored for several hours. Which groups are expected to have the greatest and least amounts of urine, respectively

Answers

Answer 1

Answer:

beer is the greatest and salt solution would be least

Explanation:


Related Questions

Which of the following is NOT a factor of sustainability?
Group of answer choices

economics

ethics

biodiversity

natural capital

solar energy

Answers

Answer:

natural capital

HOPE IT HELPS!

PLS MARK AS BRAINLIEST!!!

Biochemical and genetic experiments have demonstrated that the _________ of tRNA are important for recognition by its cognate aminotransferase-tRNA synthetase.

Answers

Answer:  Acceptor stem and anticodon loop.

Explanation:

Transfer RNA (tRNA) is a small RNA nucleic acid involved in protein synthesis (translation). Each tRNA molecule has two important areas:

A region of trinucleotides, called the anticodon A region where a specific amino acid binds.

During translation, the ribosome reads the sequence of the mRNA in groups of three bases to assemble the protein. So, in the mRNA chain there are codons, set of three bases, which determine the amino acid to be added to the peptide chain. The tRNA transfers the amino acid to the ribosomes, and then arranges them along the messenger RNA (mRNA) molecule. Then, the tRNA must have an anticodon that is complementary to the codon. Each type of tRNA is specifically combined with 1 of the 20 amino acids to be incorporated into proteins.

This means, during translation, each time an amino acid is added to the growing chain, a tRNA molecule is formed whose base pairs have a complementary sequence with mRNA molecule, ensuring that the appropriate amino acid is inserted into the protein. So, tRNA is a key link between RNA transcription and the translation of that RNA into protein. On the other hand, aminotransferases are enzymes responsible for attaching amino acids to the 3ʹ‐end of cognate tRNAs.

The acceptor stem is the site of attachment of amino acids to tRNA, and anticodon loop is the site of tRNA that is complementary to the codons found in mRNA (that determine the amino acid that will be added) This means, both parts are important for recognition, because the acceptor stem is where the amino acid is, and the anticodon loop ensures that the appropriate amino acid is inserted into the protein.

which particles is the fundamental unit of all matter in both living and nonliving

Answers

Answer:

atoms

Explanation:

all things in the universe are made of atoms and they are considered the fundamental unit of matter.

non-living things are composed of different compounds and molecules.

living things are made of cells, and cells themselves are made of different molecules. So living things are also made of atoms.

Which is a feature of a tonic receptor? Select one: a. The action potential occurs when there is a change in response to a change in condition. b. For this receptor, the stimulus begins with a burst of action potentials. c. They are normally inactive. d. When the stimulus changes the action potential generation changes. e. Provides information about the rate and change of the stimulus. f. The action potential is generated for a short time period.

Answers

Answer:

For this receptor, the stimulus begins with an explosion of action potentials.

that would be the correct option.

Explanation:

A tonic receptor is one that is activated when the action potentials were maintained over time and during the signaling of the receptor.

Tone receptors require continuous stimulation over a period of time to trigger a response and deliver it to the central nervous system.

It keeps the nervous system constantly active in the environment that surrounds it.

They are slowly adaptable, an example of these receptors are the merkel and ruffini receptors.

What cell feature is used by scientists to classify an unknown cell as prokaryotic or eukaryotic?

Answers

Answer:

Like a prokaryotic cell, a eukaryotic cell has a plasma membrane, cytoplasm, and ribosomes, but a eukaryotic cell is typically larger than a prokaryotic cell, has a true nucleus (meaning its DNA is surrounded by a membrane), and has other membrane-bound organelles that allow for compartmentalization of functions.

Explanation:

Hope this helps ;)

Which location is least likely to experience a volcanic eruption? Α. an island hot spot, such as the island of Hawaii B. Hamilton County on the plains of central Texas с. a convergent boundary, as in the Ring of Fire D a volcanic island arc, such as the Aleutian Arc in Alaska

Answers

Answer:

i think that the answer is B. Hamilton County on the plains of central Texas i took the test

Explanation:

Hamilton County on the plains of central Texas is least likely to experience a volcanic eruption. Therefore, option (B) is correct.

What are volcanoes?

Molten rock and gases stored under the surface erupt through a volcano, generating a hill or mountain.

Active, inactive, or extinct volcanoes. Active volcanoes are likely to erupt again. Dormant volcanoes may erupt again. Extinct volcanoes won't erupt.Magma collects inside active volcanoes. The magma chamber's pressure forces it through rock channels and onto the planet's surface.

Volcanic eruptions can be violent or slow-moving. Volcanoes erupt through vents on the sides or a primary entrance at the top. The volcano's morphology depends on eruption rate and magma chemistry. Land and sea volcanoes exist. As lava cools and hardens, underwater volcanoes build mountains and ranges. When volcanoes rise above the ocean, they create islands.

Learn more about volcano, here:

https://brainly.com/question/18058649

#SPJ5

Saguaro cacti are very tall cylindrical plants that usually have two L-shaped arms, one on each side. Suppose you lived in southern Arizona where the Saguaro cactus is common and you happen to have one growing in your yard. Your Saguaro has two arms but one is longer than the other. Now, assume that arm length in these cacti are controlled by a single gene with arms of the same length (A) being dominant to arms of different lengths. What is the genotype of your cactus

Answers

Answer:

The genotype is aa. Sorry if I am wrong.

Explanation:

I put the answer in the wrong spot xD

Put the vocabulary words in order from largest level of organization to smallest. Reorder answers 1. Population Reorder answers 2. Organism Reorder answers 3. Organ Reorder answers 4. Atom Reorder answers 5. Biosphere Reorder answers 6. Species Reorder answers 7. Organ system Reorder answers 8. Community Reorder answers 9. Cell Reorder answers 10. Ecosystem Reorder answers 11. Organelle Reorder answers 12. Tissue Reorder answers 13. Molecule

Answers

Answer:

The level of organization in order from largest to smallest is;

1. Biosphere

2. Ecosystem

3. Community

4. Population

5. Species

6. Organism

7. Organ system

8. Organ

9. Tissue

10. Cell

11. Organelle

12. Molecule

13. Atom

Explanation:

All living things on Earth are arranged in an hierarchical level of organization. The order in descending way is as follows:

1. Biosphere- Biosphere refers to the part of the Earth that constitutes all living organisms in interaction with their environment. It is the total of all ecosystems on Earth.

2. Ecosystem: Ecosystem refers to a group of living organisms i.e plant, animal and microbes interacting with each other and their abiotic environment e.g water, air etc. An ecosystem comprises of several communities.

3. Community- Community refers to a group of organisms interacting with each other at a particular time and habitat. A community is made up of two or more populations.

4. Population- Population refers to a group of organisms of the same species living together in the same habitat and capable of interbreeding.

5. Species- A species is a group of organisms usually with the same appearance and capable of producing fertile offsprings by interbreeding.

6. Organism- An organism is an individual living thing i.e. plant, animal, microbe. An organism is made up of several organ systems that work together to make it whole.

7. Organ system- Organ system refers to a group of organs working in an interconnected manner to perform certain functions in an organism.

8. Organ- An organ is a structure in an organism that performs a specific function.

9. Tissue- A tissue is a group of cells working together for the same purpose.

10. Cell- A cell is the basic and fundamental unit of life, which is the building block of all living organisms.

11. Organelles- An organelle is a specialized structure in a cell that performs specific functions. e.g. nucleus, mitochondria etc.

12. Molecule- A molecule is the smallest unit of a chemical compound responsible for the chemical identity of that compound. A molecule is made up of two or more atoms chemically bonded together.

13. Atom- An atom is smallest indivisible unit of mattter that partakes in chemical reactions. Atom is considered the smallest unit of matter.

Answer:

:)

Explanation:

A red flower producing snapdragon plant is crossed with a white flower producing snapgragon plant. Resulting F1 generation is crossed with one another to produce F2 generation.

This is incomplete dominance of genes.

Q1 What type of a breeding is this? (monohybrid, dihybrid or interspecific)

Q2 Draw a genetic chart to show P, F1 and F2 generations clearly indicating genotypes, phenotypes and generations.



Answers

Answer:

See the answer below

Explanation:

1. This is an example of monohybrid breeding. A monohybrid breeding is the type of breeding that involves parents with a pair of contrasting characters. On the other hand, a type of breeding involving a single gene is what is known as monohybrid breeding.

2. When a red flower snapdragon is crossed with a white flower snapdragon, the resulting offspring are usually pink - an indication of incomplete dominance of the gene responsible for flower color. Assuming the red flower's genotype is AA and that of the white flower is aa:

                       AA      x      aa

                 Aa      Aa      Aa      Aa

F1 genotype = all Aa

F1 phenotype = pink flower

At F2:

                          Aa      x      Aa

                 AA         2Aa           aa

F2 Genotype/phenotype:

       1AA - red color

       2Aa - pink flower color

        1 aa - white flower color.

I need help FAST!! U have too match the letters with the #.!

Answers

8 B

9 B

10 D

11 C

12 C

13 B

14 A

15 A

16 C

17 A

18 A

19 D

20 A

21 D

22 D

1. A star is 520 light years from Earth. During what event in history did the
light now arriving at Earth leave the star?

Answers

Answer:

A light year is the distance which is equal to 9,460,730,472,580.8 km, so:  

= 4.91957985 X [tex]10^{15}[/tex]km  

which is distance travels by the light.  Now what time it takes light to travel distance we found.  

A year has 365.25 days, so,

[tex]1 (\frac{365.25)}{1 year}) (\frac{24}{1 day}) (\frac{3600 s}{1 hr} )[/tex] = 31557600 seg/year

The light speed in the space is equal to 299,792.458 km/s, so:  

4.91957985 x [tex]10^{15} (\frac{1 seg}{29792.458}) \frac{1 year}{31557600}[/tex] = 520 years

if today, August, 2020, then

2020 - 520 = 1500

Spanish and Portuguese spread out over the southern part of the Western Hemisphere and bring in America brought to Spanish colony of Santo Domingo in year 1500.

Therefore, during the  period 1499 AD Columbus discovered JamaicaA light-year is a distance traveled by light in space during a period of one year from a celestial object to another celestial object. The distance between stars and Earth is 520 light-years. So, the light leaving the star is 520 years ago. The present year is 2019. Light from the star left 520 years ago. The time period on Earth is,

[tex]t=2019-520\\ t=1499 AD[/tex]

Learn More:https://brainly.com/question/8244352

what are 3 major functions of the femur?

Answers

Answer:

The femur is the longest bone in the human skeleton. It functions in supporting the weight of the body and allowing motion of the leg. The femur articulates proximally with the acetabulum of the pelvis forming the hip joint, and distally with the tibia and patella to form the knee joint.

Explanation:

Holding the body weight once standing and moving. People are being stabilized as they move. Connecting the hips and knees' muscles, tendons, and ligaments to the rest of your body. These are three functions of femur.

What is femur?

The femur is the bone in the thigh. It is person's body's longest and strongest bone. It is an essential component of the ability to stand and move.

There can be many functions of this bone, some are listed below:

Hold the body weight.Stabilize the body while moving.Connecting hip and knees.

Thus, above mentioned are three functions of femur.

For more details regarding femur, visit:

https://brainly.com/question/3264785

#SPJ2

which type of soil is likely to be found in horizon E

Answers

Answer:

A layer of pale,Sandy soil lacking clay and iron is likely to be found in horizon E

Answer:

bedrock

Explanation: A layer or bedrock is the type of soil is likely to be found in horizon E. Hence the correct answer is option A among the options. The bed rocks can be regarded very hard and it cannot be breakable.

According to kirk smith a professor of environmental health at the university of california berkley indoor fires increase risks of pneumonia tuberculosis lung cancer and low birth weight in babies born of women expose during pregnancy. What simple solution is being widely promoted to reduce the risk of death?
a) preparing meals using solar cookers.
b) switching from wood to burning crop waste as a fuel source.
c) adding more windows to houses as a source of ventilation.
d) passing a green tax to make homeowners pay for their pollution.
e) providing asthma inhalers to children under the age of 12 years.

Answers

Answer:

preparing meals using solar cookers.

Explanation:

solar cookers  radiates at low rates.Therefore the most of the nutrients in the foods are conserved.Thus most micro nutrients for biochemical activities are retained. Vitamins which can not withstand high temperature are preserved.

Most importantly carcinogens which are usually associated with high heat foods are avoided ,when cook with low heat of solar cookers

The solar cooker is smoke free,therefore irritation of the lungs,lung cancer associated with high heat  cookers is avoided.

Specifically,local Mayan women exposed to high heat smoke cookers, suffers lung cancer,and those with pregnancy gives to infants with low birth weights. Children exposed to theses high heat also experienced acute lower respiratory infections.

Thus the smokeless,low heat solar cooker is safer.

Mitotic cell division creates identical copies by replicating a cell's DNA __________ and then dividing ____________.

Answers

Answer:

Mitotic cell division creates identical copies by replicating a cell's DNA once and then dividing once.

Which of the following properties is the temperature at which a liquid turns to gas? (3 points)
оа
Magnetism
Ob
Thermal conductivity
ос
Melting point
Boiling point
Od

Answers

thermal conductivity

Answer:

Boiling point

Explanation:

I did the test

Which is incorrect descriptions of the genetic event initiated by the HIV reverse transcriptase (RT) upon the HIV infection?
a. RT catalyzes initial synthesis of ssDNA using viral genomic RNA as the template.
b. The first RNA template is degraded after ssDNA synthesis.
c. The whole process is completed after synthesis of dsDNA.
d. tRNAs are adopted as the first primers.
e. None of these

Answers

Answer:

e. None of these

Explanation:

The immune deficiency viruses (HIV) are retroviruses that use a reverse transcriptase (RT) enzyme to produce a single-stranded DNA (ssDNA) from an RNA template. The reverse transcription allows retroviruses to replicate their genetic material, which is integrated into the host's genome as a double-stranded linear DNA molecule in a similar way to the mechanism of insertion used by endogenous retrotransposons. The synthesis of DNA is started by cellular tRNAs (tRNA3Lys) that are packaged into the virion. After reverse transcription, the HIV DNA enters the nucleus of CD4 immune cells (also known as CD4+ T cells), and then it integrates into the genome to coopt the host's cell machinery for its own replication.

A purebred tall pea plant is cross-pollinated with a tall, heterozygous pea plant. Use a Punnett square to determine the probability the offspring inherita
recessive short allele. (I point)
75%
25%
0%
50%

Answers

Answer:

0%

Explanation:

This question involves a gene coding for height in pea plants. The allele for tallness (T) is dominant over the allele for shortness (t). This means that allele T will be expressed over allele t in an heterozygous state.

A purebred tall plant will possess genotype: TT while a heterozygous tall plant will possess genotype: Tt. The two parents will produce the following gametes:

TT- T and T

Tt- T and t

Using these gametes in a punnet square (see attached image), the following offsprings with genotypes: TT and Tt in a ratio 1:1 will be produced.

TT offsprings are purebreed tall while Tt offsprings are heterozygous tall. Hence, based on the question, no offsprings of this cross will possess the recessive genotype (tt). This means that 0% of the offsprings of this cross will be short.

Why do you think premenopausal women need more iron than
men of the same age?

Answers

Answer:

Women need more iron than men to make up for the amount of iron they lose in their menstrual period.

Explanation:

Answer:

Premenopausal women shed blood as part of menstruation every month, which lowers the level of iron in the body. So, they need more iron than men and are also at a greater risk for this nutritional deficiency.

PLATO

Explanation:

Without this, many cycles such as the water cycle and photosynthesis would not exist. What could all these cycles not exist without?

Answers

Answer:

This question appears incomplete

Explanation:

This question appears incomplete. However, one similar substance that, if missing, many cycles (particularly the two cycles/processes provided in the question) will not exist/proceed is the sun/sunlight.

In the water cycle for instance, if there is no sun/sunlight, there will be no heat to allow for evaporation of water from the water-body (ocean, sea, stream or lake) hence there will be no cloud of water droplets in the atmosphere. The implication of this is that, the first process of the water cycle will not proceed, hence the cycle will not exist.

During photosynthesis, carbondioxide reacts with water in the presence of sun/sunlight to produce glucose and oxygen. The absence of sun in this reaction will not lead to the production of glucose which is the useful product of photosynthesis for plant.

From the explanation above, it can be deduced that the absence of the sun/sunlight will prevent the two cycles from existing.

Choose the PCR primer pair that will amplify the breakpoint of a deletion of the segment of DNA between lines 1and 2.
5' TCGATTCCGGAAAGCTTAGTTTCCCGGGACGTATTGCCAACCTAGGTAAGCGCCGAATATCCATGGGCACC 3'
3' AGCTAAGGCCTTTCGAATCAAAGGGCCCTGCATAACGGTTGGATCCATTCGCGGCATTATAGGTACCCGTGG 5'
a. 5- AGCTAAGGCCTTTCGA and 5'-CCACGGGTACCTATAA
b. 5'- TCGATTCCGGAAAGCT and 5'-ACGTCCCGGGAAACTA
c. 5- TCGATTCCGGAAAGCT and 5'-CCACGGGTACCTATAA
d. 5'- TCGATTCCGGAAAGCT and 5'- GGTGCCCATGGATATT
e. 5' - GGTGCCCATGGATATT and 5' ACCTAGGTAAGCGCCG

Answers

Answer:

a. 5- AGCTAAGGCCTTTCGA and 5'-CCACGGGTACCTATAA

Explanation:

The Polymerase Chain Reaction (PCR) primers are short nucleotide sequences (composed of approximately 20  nucleotides in size) flanking a target sequence that is amplified during PCR reaction. These primers bind to the DNA template by means of complementary base pairing in order to make billions of copies of a target DNA region, which is then visualized as a band by electrophoresis. In this case, PCR primers from the item a- (i.e., AGCTAAGGCCTTTCGA and CCACGGGTACCTATAA) will bind to the DNA template of lines 1 and 2 in order to amplify a continuous region:

Schematically:

The Foward primer AGCTAAGGCCTTTCGA binds by complementary base pairing:

5'_(TCGATTCCGGAAAGCT)TAGTTTCCCGGGACGTATTGCCAACCTAGGTAAGCGCCGAATATCCATGGGCACC_3'

The Reverse primer CCACGGGTACCTATAA binds by reverse complementary base pairing:

3'_AGCTAAGGCCTTTCGAATCAAAGGGCCCTGCATAACGGTTGGATCCATTCGCGGCA(TTATAGGTACCCGTGG)_5'

As a substance is eaten, trace its path through the digestive system. Include one of the basic processes each step of the way: digestion, absorption, motility, secretion, and excretion.

Answers

Answer:

....... motility

Explanation:


Which of the following groups gets energy directly from the grass it eats?

Answers

Answer:

herbivores

Explanation:

i think it's herbivores because "herb"ivores get energy when eating grass or any other herb.

Question 3 (1 point)
During DNA replication, one of the new strands of DNA is synthesized continuously.
The other strand is synthesized as a number of separate fragments of DNA that are
subsequently linked by DNA ligase. Why does this occur?

- RNA primers only anneal to one of the parental strands of DNA.

- DNA polymerase III only synthesizes DNA in the 3' - 5' direction.

- DNA polymerase III only synthesizes DNA in the 5'-3' direction.

- One of the parental strands is unwound slower than the other by helicase.

Answers

Answer:

DNA polymerase III only synthesizes DNA in the 5'-3' direction.

Explanation:

DNA replication is an important phenomenon for every living cell. It is the process whereby the double-stranded DNA is doubled to form two new separate double strands. In order for DNA replication to occur, the double strand of the DNA molecule must first be unwound by an enzyme called DNA HELICASE. This gives two separate single strands, which individually acts as a template for the newly synthesized strands.

DNA polymerase III is the enzyme responsible for synthesizing new DNA strand by pairing complementary nucleotides to the old strands it attaches to. However, one of the old strands called LEADING STRAND runs in the 3'-5' direction while the other strand called LAGGING STRAND runs in the 5'-3' direction.

DNA polymerase III only attaches to the 3' hydroxyll end of the DNA and synthesizes new strand of DNA in the 5'-3' direction. Since the lagging strand runs in 5'-3', it is synthesized in small separate fragments called OKAZAKI FRAGMENTS which are later joined together by an enzyme called LIGASE.

N.B: As DNA polymerase synthesizes DNA strand on the leading strand(5'-3'), it is moving in an opposite direction of the lagging strand. Hence, it has to detach and come back to synthesize on the lagging strand. This causes the lagging strand to be synthesized discontinuously.

what type of molecule do plant cells use for long term energy storage

Answers

Answer:

ATP

Explanation:

In plants, energy is stored in the form of ATP and NADPH. Energy is produced in the presence of light it is in the thylakoids and mitochondria.

ATP: Adenosine triphosphate

NADPH:  nicotinamide adenine dinucleotide phosphate hydrogen

If tall is dominant over short, and yellow seed is dominant over green, how would you write the genotype of a pea plant that is heterozygous for tall, and that produces yellow seeds

Answers

Answer:

The answer has been written in paper and the image of the paper has been attached. Feel free to raise any doubt.

The medical term ____________________ describes a pus-filled lesion on the eyelid resulting from an infection in a sebaceous gland.​

Answers

Answer:

the medical term is hordeolum

what is sexual reproduction

Answers

Answer:

See explanation below...

Explanation:

Sexual reproduction is a type of reproduction that involves a complex life cycle in which a gamete with a single set of chromosomes combines with another to produce an organism composed of cells with two sets of chromosomes.

Best Regards!

Answer:

the production of new living organisms by combining genetic information from two individuals of different types (sexes). In most higher organisms, one sex (male) produces a small motile gamete which travels to fuse with a larger stationary gamete produced by the other (female).

Reaching for your coffee cup is accomplished by the _____ subdivision of the peripheral nervous system.

Answers

Answer:

somatic subdivision

Explanation:

The peripheral nervous system is divided into somatic and autonomic systems. The somatic system is required to transport sensory and motor information to the central nervous system. The somatic system is composed of nerves that connect different parts of the body including sensory fibers, skin, and skeletal muscles. On the other hand, the autonomic system can be subsequently classified into sympathetic and parasympathetic systems, which are required in fight (potentially dangerous) and calm-associated responses, respectively.

In the quest to understand the basis of infertility in humans, researchers have identified a mutation in a gene associated with chiasmata. This protein normally acts to promote homologous recombination.Why might a defect in homologous recombination have consequences for fertility?A. The chiasmata halts the whole process of meiosis, if crossover do not form properly.B. Crossover formation is a necessary step in meiosis I to ensure proper chromosome segregationC. A checkpoint requires a certain level of genetic variability for meiosis to proceed.D. Chiasmata are the connections between the centromeres and the centromeres that pull them to each pole of the daughter cells.

Answers

Answer:

B. Crossover formation is a necessary step in meiosis I to ensure proper chromosome segregation

Explanation:

Crossing-over is a unique phenomenon that occurs in the prophase I stage of meiosis I, where non-sister chromatids of homologous chromosomes exchange their chromosomal segment. The physical point where this exchange occurs is called CHIASMATA. Hence, a mutation that affects the gene associated with the chiasmata will affect the occurrence of crossing over or homologous recombination.

Crossing-over, through the formation of the chiasmata, is responsible for the physical alignment and proper segregation of chromosomes into gametes. Naturally, the chiasmata formed as a result of recombination during meiosis helps ensure that the chromosomes stay together until it is the right time to separate. This way, any chromosomal defect in the resulting gamete is prevented.

However, an error or defect in homologous recombination might give rise to gametes with chromosomal disorder, a condition known as ANEUPLOIDY i.e. missing or additional chromosomes in gametes. This can affect the fertility of the involved human.

Other Questions
4x +16 x+4Simplify your answer as much as possible. Consider the compound hydrazine N2H4 (MW = 32.0 amu). It can react with I2 (MW = 253.8 amu) by the following reaction 2 I2 + N2H4 ------------- 4 HI + N2 (a) How many grams of I2 are needed to react with 36.7 g of N2H4? (b) How many grams of HI (MW = 127.9 amu) are produced from the reaction of 115.7 g of N2H4 with excess iodine? famous comparative and superlative form I have settled in Mexico to help convert the Native Americans to Catholicism. Which of the following best describes me? How much long will an average travelogue be factories each of the following 2x2 20x 18 Digital communication should be used carefully and screened for unintentional meaning. True Or False The sum of 3 consecutive even numbers is 132pleaase help!!! Help fast please!! Which expression is equivalent to.. What are the lower quartile, upper quartile, and median for this box andwhisker plot?A) LQ = 22 UQ = 10 Median = 18.5B) LQ = 10 UQ = 22 Median = 18C) LQ = 10 UQ = 22 Median = 18.5D) LQ = 10 UQ = 22 Median = 19 HELPPPP!!!!! Based on the diagram above, which of the following correctly describes the function and components of layer A?A) movement; villi, blood vessels, lymphatic vessels B) movement; muscles and connective tissue C) absorption; villi, blood vessels, lymphatic vessels D) absorption; muscle and connective tissue If a car has a speed of 36m/s how long will it take to go 100 m Foodborne illness outbreaks can be caused by microorganisms such as bacteria, viruses, or parasites. Determine whether each outbreak was caused by bacteria, viruses, or parasites.a. A foodservice worker who doesn't wash his hands after handling contaminated seafood causes highly contagious tulike symptoms for passengers on a cruise shipb. Raw oysters contaminated with Vibrio vulnicus.c. An infected foodservice handler touches raw vegetables for a salad and transfers the condition that causes jaundice and liver damage to the customer who ordered the saladd. A broken water main in a port town contaminates a boat's entre water supply with Cryptosporidium. e. Prepackaged lettuce contaminated with Salmonella.f. A broken meat thermometer ends up causing dinner guests to eat an undercooked pork roast infected with Thichinella spiralis. Question 4 of 5Where does the author of the "Equal Pay Bill" letter think women should be?A. In the militaryB. Working side by side with men in equal paying jobsC. In mostly service oriented jobsD. At home raising their children Write an equation for a line on the graph that passes through the points (0.4) and (12,16) TB MC Qu. 9-336 Puvo, Inc., manufactures a single product in which ... Puvo, Inc., manufactures a single product in which variable manufacturing overhead is assigned on the basis of standard direct labor-hours. The company uses a standard cost system and has established the following standards for one unit of product: Standard Quantity Standard Price or Rate Standard Cost Direct materials 6.10 pounds $0.90 per pound $5.49 Direct labor 0.50 hours $36.50 per hour $18.25 Variable manufacturing overhead 0.50 hours $8.80 per hour $4.40During March, the following activity was recorded by the company: The company produced 3,500 units during the month. A total of 20,500 pounds of material were purchased at a cost of $14,680. There was no beginning inventory of materials on hand to start the month; at the end of the month, 4,720 pounds of material remained in the warehouse. During March, 1,200 direct labor-hours were worked at a rate of $41.50 per hour. Variable manufacturing overhead costs during March totaled $15,161. The direct materials purchases variance is computed when the materials are purchased. The variable overhead rate variance for March is:_______. a. $3,641 F.b. $4,355 U.c. $4,355 F.d. $3,641 U. Given: 8(y + 2) = 48Solve for y. 16 -6 20 4 Consider these three numbers written in scientific notation: 6.5 103, 5.5 105, and 1.1 103. Which number is the greatest, and by how many times is it greater than the smallest number? HELP ME PLZZzzzzzzzz In The Ancient City, the author compares details of several kinds of Greek clothing. What is the central idea thatconnects all the clothing the author describes?They are all pinned or knotted at both shoulders.O They are all made from a rectangular piece of cloth. They are all worn by both men and women.They are all worn by the middle and upper classes.