In general terms, how do the townspeople in "The Handsomest Drowned Man In The
World" react to the body which washes up on their shore at the beginning of the story -
give a quote to support and explain. Please someone help!!

Answers

Answer 1

Answer and Explanation:

In "The Handsomest Drowned Man in the World," a short story by Gabriel García Márquez, the townspeople react to the body with acceptance. He is first found by children when he washes up on their shore. Instead of being afraid of him, the children play with the body. When the adults of the village finally realize he is there, they take him into one of their homes, and the women take care of him. They will do for him what do for every body that washes up on their shore: they will mourn him with a brief wake, and then bury him in the ocean.

"They had been playing with him all afternoon, burying him in the sand and digging him up again . . .

While the men went to find out if anyone was missing in the neighboring villages, the women stayed behind to care for the drowned man. They took the mud off with grass swabs, they removed the underwater stones entangled in his hair, and they scraped the crust off with tools used for scaling fish."


Related Questions

Select which of the vocabulary words from the drop-down menu best completes this sentence.


You won't even kill a mosquito when it's biting you, but now you have no

Choose...

for an orphaned child?

Answers

Answer: Pity

Explanation: There is no drop down menu to pick from but the word that bests completes the sentence is “pity”.

You won’t even kill a mosquito when its biting you, but now you have no pity for an orphaned child.

The word “pity” means a feeling of compassion caused by the suffering and misfortunes of others.

Answer:

sympathy

Explanation:

another word for enviable

Answers

Answer:

Desirable

Attractive

Sought-after

Admirable

Explanation:

Those are a few words synonymous to enviable

Im am not a man im a inmate
PART A: Which of the following best identifies the article’s central idea?

Answers

Answer:

okkk

need help or anyting im ready

just tell me

Explanation:

One of the most powerful tools you have to create variety and to offer readers visual relief is
a) pulled quote.
b) infographics.
c) white space.
d) L-shaped layout.

Answers

I think it is b I hope it help

rewrite the paragraph in order to create a formal tone.
⬇️screenshot down⬇️
plz help
Thx

Answers

Answer:

Today, I went to a store to spend my  money my dad gave me for my birthday. While I was shopping, the sales clerk ignored me, and made an assumption that I had no money.  I then decided I would not spend my money at this store, and  would spend it at Toys R Us.

Explanation:

you are talking to a friend. you both have the sam ideas, taste,etc. use "either" and "neither"

Answers

Answer: So / Neither (Nor) / Either / Too. When someone expresses a statement, we can simply use phrases like “me neither”, “neither do I”, “nor can cats”, “James doesn't either”, “so does my dad” etc. to indicate that the same or similar situation applies to another person/group/entity.

Explanation:

Have a conversation and then write about what you think their tone is.

Answers

is there suppose to be a thing attached to this? Or is it having you actually have a conversation?

What is the verb phrase in the sentence?
Daily life in Egypt is reenacted there

Answers

The verb in the sentence is “re-enacted”
re-enacted means to act on

Hope this helps !

Use the sentence to complete the activity.

Jessica ate the cookies that her daughter baked for her.

In one to two sentences, identify the bold words as an independent clause, dependent clause, or phrase, and explain their functions within the sentence.

Answers

Answer:

hope this helps

Explanation:

Its a dependent clause because like the sentence Lexie gave the words "That her daughter baked for her" does not make sense alone so its a dependent clause, so its not a complete thought.

The sentence to complete the activity is :

- It is dependent clause.

Clauses

Lexie gave the words "That her daughter baked for her" does not make sense alone so its a dependent clause, so its not a complete thought.

A dependent clause may be a gather of words that contains a subject and verb but does not express a total thought.

A dependent clause cannot be a sentence. Regularly a subordinate clause is stamped by a dependent marker word.

Learn more about "Clauses":

https://brainly.com/question/15011732?referrer=searchResults

Answer the following questions in complete sentences by using some of your key vocabulary words of this cluster. Do babies usually have a lot of wisdom? Can experiences make you more wise?

Answers

i think babies are cute and funny but not that smart

Answer:

Do babies usually have a lot of wisdom?

Not really sure babies have a lot of wisdom since there brain its still developing. Since babies do not have life lessons and experiences since they are begging to live.

Explanation:

Can experiences make you more wise?

Wisdom is perhaps the most important quality that we can gain in our lives.  Wisdom only comes from those life lessons and experiences that stretch our minds and grow our understanding. Some wisdom-bringing experiences are delightful, and some are painful, but with wisdom as a by product, they are all worthwhile.

i have to write a haiku poem about struggle to get water in different parts of the world can someone help im stuck

Answers

Water is a need
Some places can’t get any
Most of them then die

In the book of life of Pi, Pi claims that "repetition is important in training not only of
animals but also of humans." In terms of training a dog to sit, explain how
repetition works with training humans. *

Answers

say you have a child , if you want the kid to start walking , you have to start getting the child to recognize the command to walk , instead of crawling. Explanation: im sorry if this is wrong i really tried :)

who's a good writer i need a favour plz

Answers

Answer:

i am

Explanation:

Answer:

One of the best writers in the old times, was Shakespeare.

Explanation: He wrote very well known and popular Novels.

Select one of these topics, and imagine a conversation in which someone tries to make a point using a form of fallacious reasoning. Write the conversation as you imagine it, focusing on the error in logic. It will be on the The value of reading vs. Watching television

Answers

Answer:

Bandwagon fallacy

Explanation:

Bill: Today, the reading culture that makes people smart is being eroded and I believe that this is caused by so many distractions in the world today.

John: I do not totally agree with you, Bill. The advent of social media, telephones, televisions might have reduced the number of people reading books, but these other sources can serve the purpose of books.

Bill: How do you mean?

John: Well, books are sources of information and so are televisions, social media, and phones. Besides, professors, scientists, and other learned people watch televisions most of the time and that has not reduced their intelligence or smartness.

Bandwagon fallacy appeals to the fact that many people do a particular thing in order to validate such act. In the conversation above, John appeals to the fact that learned people also watch televisions and that has not affected their smartness.

5
Select the correct answer from the drop-down menu.
Read the excerpt. Then choose the correct way to complete the sentence.
To Thoreau, the underlined sentence in this paragraph represents
an unjust government.
Reset
Next

Answers

According to Thoreau, the underlined sentence in this paragraph represents

An inadequate way to stand up to unjust governments

Civil Disobedience

This refers to the recommendation made by Justin Thoreau where he said that citizens should disobey an unjust government by refusing to pay taxes and other things which are required of a citizen.

As a result of this, and from the complete text, we can see that people needs to do more in order to stand up to unjust governments by observing civil disobedience.

Read more about civil disobedience here:

https://brainly.com/question/4441735

Answer:

To Thoreau, the underlined sentence in this paragraph represents

an inadequate way to stand up to

an unjust government.

Explanation:

I got this right on Edmentum, hope this helps <3

Check the picture for confirmation.

Why is it so important to be able to recognize the logical fallacy called "false cause"?

A. Knowing if one event caused another can help you win arguments.

B. Understanding cause and effect is only useful in math and science.

C. Most events have multiple causes, so finding a true connection between them is impossible.

D. Finding the real cause behind events keeps you from being mislead and helps you find real solutions to problems.

Answers

Answer:

D.

Explanation:

Only one that makes sense

It is so important to be able to recognize the logical fallacy called "false cause," because finding the real cause behind events keeps you from being misled and helps you find real solutions to problems. Hence, Option D is correct.

What is a logical fallacy?

Arguments that may sound convincing, but are based on faulty logic and are therefore invalid. They fall under the logical fallacy. They are the outcomes of either innocent errors in reasoning or deliberate attempts to mislead others.

If one takes logical fallacies at face value, it can lead to making poor decisions based on unsound arguments. For instance, whatever your feelings about tattoos, this is a logical fallacy. Just because everyone's getting this tattoo doesn't mean it's the right choice for your kid.

Therefore, Option D is correct.

Learn more about logical fallacy from here:

https://brainly.com/question/18094137

#SPJ5

Like a boil that can never be cured as long as it is covered up but must be opened with all its pus-flowing ugliness to the natural medicines of air and light, injustice must likewise be exposed, with all of the tension its exposing creates, to the light of human conscience and the air of national opinion before it can be cured. type of figurative language?

Answers

Answer:

Simile.

Explanation:

A figurative language also known as figures of speech can be defined as a deliberate and specific construction or use of language by authors, writers or speakers to create a special effect in their speech or write-up.

The main purpose of a figurative language is to convey more information and enable the readers or listeners have a deeper understanding of the piece.

Some examples of figurative language used in a literary work are oxymoron, paradox, metaphor, apostrophe, hyperbole, personification, simile, etc.

Simile has to do with the comparison of two things by using the word; as or like.

Hence, the type of figurative language used in the above write-up is simile.

Answer:

Like a boil that can never be cured as long as it is covered up but must be opened with all its pus-flowing ugliness to the natural medicines of air and light, injustice must likewise be exposed, with all of the tension its exposing creates, to the light of human conscience and the air of national opinion before it can be cured.

Type of figurative language:

Simile.

Meaning of figurative language:

comparing two unlike things using the words like or as.

Effect on tone and mood:

tension.

Effect on audience: either a tension or sadness from the story.

Explanation:

EXERCISE
Questions 1-5: Revise the following sentences so that the active voice replaces the passive
voice.
1. All of us were surprised to hear the views that were expressed by him.
2. At each new performance of the jazz band, the music was enjoyed by Pat even more.
3. Several different techniques for grafting can be employed by the gardener.
4. Only one person had not been persuaded by the rhetoric.
5. These improvements for bus riders were provided in part by Congress through a new program that
included two innovations: distribution of funds to localities and provision for annual increases to be
made through the coming six years.

Answers

Answer:

Active voice are :

1.

“All of us were surprised to hear the views that he expressed”

2.

“At each new performance of the jazz band, Pat enjoyed the music even more.”

3.

“The gardener can employ several different techniques for grafting.”

4.

“The rhetoric had not persuaded only one person.”

5.

''Congress provided these improvements for bus riders in part through a new program that included two innovations: distribution of funds to localities and provision for annual increases for six years.''

How does F. Scott Fitzgerald use his characters and story to show the gains and losses in pursuing wealth and upward mobility brainly

Answers

Answer and Explanation:

F. Scott Fitzgerald uses the characters to show how dreaming about something changes the entire psychological and emotional construction of an individual, leading him to the despair that makes him do anything to achieve that dream, even something immoral and improper. This is clear in Gatsby, who through his dream of social ascension, ends up taking very immoral attitudes, these attitudes are reinforced by his dream of being with Daisy. This quest for ascension and achievement becomes more and more desperate, because it seems increasingly distant, even though Gatsby has already achieved most of his goals. F. Scott Fitzgerald shows how uncontrolled despair, guided by desire, can cause tragedies and irreparable losses, as happened with Gatsby, who so much pursued his goals in non-commendable ways, had a sad and undesirable ending.

How can we use technology for the greater good?

Answers

Answer:

we can use technology for the greater good by making technological advances in the medical and business industries

Explanation:

Our school is planning on adding new elective options. We can decide to add a ceramics class, where students learn to create art from clay or a creative writing class, where students will learn to write short stories and poetry. Which do you think would be best for our school? Provide mutliple details to support your response. Response must be 3 SENTENCES OR MORE

Answers

Answer:

The ceramics class!

Explanation:

Now yes I do love ceramics, but I have a reason! Students can learn to make fine art, show passion through there art, and it's fun! Some students will find there passion for art through this elective. Some students find stress relief through this class. Also sometimes the art of making and shaping clay helps with anxiety or depression, because you can get all of your emotions out on the pottery.


What occurs if a person makes no considerations when interacting with another culture?
A. assimilation
B. culture acceptance
C. accommodation
D. culture clash

Answers

I’m pretty sure it’s d

READ As you read lines 336-384, continue to cite text evidence. Evidence that the narrator has changed. In the margin, summarize the sequence of events that occur when the seventh man receives K's watercolors.

Answers

Answer:

Explanation:

Animal parts.

How should sentence 4 be changed?


Don't worry I know just want to help yall the answer is H and if you want to thank me go to my yt and search Drizzy Pixel only have 116 subs but ill appreciate it

Answers

Answer:

Thanks for the points!

Nice you tube channel!

The name given to a paragraph/verse in a poem is... *

Stanza
Section
Focus
Part
help me plsssssssssssssssssss

Answers

Correct me if I’m wrong and sorry but I think it’s the right answer!
correct me if i’m wrong but i’m not sure

Question 8
5 pts
If you were given a research paper to write regarding the impact of testing on students in elementary
school, which would be the best resource to use?
A teacher blog titled "Elementary Experiences + Testing"
A book titled "Testing and its impact on young students" published in 1983
An article from a scholarly journal entitled "The impacts of testing on students ages 6-9" published in 2019
An article from Wikipedia about how different states implement standardized testing

Answers

Answer:

C.) An article from a scholarly journal entitled "The impacts of testing on students ages 6-9" published in 2019

Explanation:

The reason that this is the correct answer is that the article is from a reliable source and it was written recently ensuring that you get updated information, as well as it is going through the exact information that you need for your research paper. If you were to choose A then it wouldn't really add anything to your research paper and it would just talk about a random teacher teaching experience, this source is neither enhancing nor reliable. If you were to choose B then it would be too outdated to be useful and or informative making the text not reliable and potentially giving you incorrect information. Next, if you were to choose D then it wouldn't be reliable since it isn't from a trustable source (Wikipedia) neither is it talking about information that is necessary for making your text more engaging

"If you don't like something, change
it. If you can't change it, change your
attitude."


What does this quote mean?

Answers

What does this quote mean?

If you can change something you’re complaining about it, then you better take action and rid yourself of whatever it is. If you can’t change it, then perhaps, that’s the universe telling you that you need to change your outlook. Because without changing the outlook, you will allow it to bother you forever. For each negative, pick up a positive and only concentrate on that. The true message always seeps through; you just have to acknowledge it.

Have you ever had to do this?

yes many times yes

it means exactly as it says.

If it’s at all possible, certainly go ahead and try to change the thing (s) that is bothering you.

If you cant change it? If there is nothing you can do about it?

Then there is no point in going around frustrated, angry, bugged and bothered for the rest of your life.

Change your attitude. Find something positive in it, make peace with it, learn to live with it. Find a way to enjoy and be happy with life even though that ‘thing (s)’ still exists unchanged.

Here is an example

You have a an old, beat-up, dented car that still runs. You could hate the car because its ugly and people make fun of it. You cannot afford a new one. So you cant do anything about changing the car for a prettier one.

You could be miserable inside hating life because you are stuck driving a ridiculous looking car while everyone else has nicer cars.

Or you could change your attitude and think how lucky you are to have transportation and that you can go wherever you want, when you want.

You can recognize that some people have worse cars then yours or no transportation at all.

You can recognize that car does not define who your are.

Further you could give the car a funny name and affectionately call the car by its name.

Further, you could come up with you own jokes about your car, give it a personality and beat other people to the punch lines. You can get them to laugh and you can have fun owning your very own wonderful Dent-Mobile.

2.
Which of the following is not a true statement?


A. Essays can have more than one supporting paragraph.


B. Revise your rough draft as you write it.


C. Even the best writers must write several versions of a rough draft.


D. Every paragraph must have a topic sentence.

Answers

Answer:

B

Explanation:

When you're writing a rough draft, you want to write down the basic idea ypu plan on doing. rewriting it halfway through beats the purpose of a rough draft. You are meant to write it and then review it once your done and then continue to write a more advanced paragraph about the topic.

write a letter to your friend tell him or her that you want to come and spend some time with him or her.​

Answers

Answer:

Just say "I'm going to your house, thank you."

Explanation:

You have read the text "I Like the Way You Move!" In your opinion, should a person's gait biometrics be recorded and used for security? Write an argumentative essay that supports your claim with clear reasons and relevant evidence. Provide details from the text to support your response.

Answers

Answer and Explanation:

Movement is inherent to human beings and animals in general. This is because the movement allows the displacement and physical and spatial positioning of human beings. However, through gait biometrics, the movement has achieved broader concepts and purposes that can be very beneficial.

Gait biometrics is the study of human movement. This study analyzes not only human movement through geographic space, but also the movement of all members of the body, organs and muscles. With this type of study, it is possible to analyze biological, social and political concepts of extreme importance to understand humanity.

Despite its wide biological application, gait biometrics has been important in investigative events, where any minimal movement of any element of the body of an individual accused of something is analyzed scientifically, and can help in declaring it as guilty or innocent. Gait biometrics is also used in the financial, psychological, economic and political sectors.

Therefore, we can consider that the use of gait biometrics is beneficial and important for the progress of the human race and therefore it should be stimulated and new studies should be started.

Other Questions
Describing Work ActivitiesNote that common tasks are listed toward the top and less common tasks are listed toward the bottom.According to O*NET, a pharmacy technician should be able to use computers to enter, access or retrieve data to adhere to safety procedures and use the metric system.What Work Activities are being described? Check all that apply.a. processing informationb. getting informationc. interacting with computersd. evaluating information to determine compliance with standardse. identifying objects, actions and eventsf. updating and using relevant knowledge 13. Given the original DNA strand, which of the following would be the new, complementary strandof DNA? ACTTACGCCGAT *(8 Points)CAGGCATAATCGACTTACGCCGATTCAATCGCCGTATGAATGCGGCTA Arrange the following steps to explain the process of protein synthesis inside the eukaryotic cell. Help please! 50 points! Troll answers WILL be reported Describe how each of thefollowing are evidence for Continental Drift1. Fossils2. Landforms3. Rock Formations4. Climate what is 3/4x2/3a.5/12b. 6/12c.5/7d. 6/7 How to not go to jail for j walking (HELP ASAP)Select the graph which best represents this scenario:The amount of pancake batter that you must mix increaseswith the number of people who come to breakfast. It takes3 cups of batter to serve 10 people.(More context in the picture) What is not a type of text format that will automatically be converted by Outlook into a hyperlink?O email addressO web addressO UNC pathO All will be automatically converted. Cup G has a diameter of 4 in. and a height of 8 in. Find the volume of Cup G. (24^0)+(4^0). solve this problem fast Class A misdemeanor, based on the federal level, has a maximum fine of which of the following? Where dose the earliest known Indian literature come from Eva has a coupon for an oil change with synthetic oil for $59.95. She can buy 5 quarts of synthetic oil, which is what her car needs, for $26.54 and an oil filter for $6.47. How much can she save by doing the oil change herself?$79.22$139.17$59.95$32.92$26.94 which element is shown in the picture here? What is the sum of the two polynomials? Pakistan is the Islamic country which split from ___________.a.Chinac.Indiab.Japand.Britain Which of the following Spanish words is not a preposition?1. soy2. con3. para 4. de Grapes cost $3.25 per pound. Darius paid a total of $26 for grapes.How many pounds of grapes did Darius buy? Imagine that the economy is in long-run equilibrium. Then, perhaps because of improved international relations and increased confidence in policy makers, people become more optimistic about the future and stay this way for some time.1. Refer to Optimism. Which curve shifts and in which direction? a. aggregate demand shifts right.b. aggregate demand shifts left.c. aggregate supply shifts right. d. aggregate supply shifts left. 2. Refer to Optimism. In the short run what happens to the price level and real GDP? a. both the price level and real GDP rise. b. both the price level and real GDP fall. c. the price level rises and real GDP falls. c. the price level falls and real GDP rises. 3. Refer to Optimism. What happens to the expected price level and what's the result for wage bargaining? A. The expected price level falls. Bargains are struck for higher wages. B. The expected price level rises. Bargains are struck for higher wages. C. The expected price level rises. Bargains are struck for lower wages. D. The expected price level falls. Bargains are struck for lower wages.4. Refer to Optimism. In the long run, the change in price expectations created by optimism shifts:_____.a. long-run aggregate supply right. b. long-run aggregate supply left. c. short-run aggregate supply right. d. short-run aggregate supply left. 5. Refer to Optimism. How is the new long-run equilibrium different from the original one? a. both price and real GDP are higher.b. both price and real GDP are lower. c. the price level is the same and GDP is higher. d. the price level is higher and real GDP is the same. 6. People choose to hold a smaller quantity of money if:_____.a. the interest rate rises, which causes the opportunity cost of holding money to rise.b. the interest rate falls, which causes the opportunity cost of holding money to rise.c. the interest rate rises, which causes the opportunity cost of holding money to fall.d. the interest rate falls, which causes the opportunity cost of holding money to fall. 7. When the Fed sells government bonds, the reserves of the banking system:___.a. increase, so the money supply increases. b. increase, so the money supply decreases. c. decrease, so the money supply increases. d. decrease, so the money supply decreases.