In the story to my old master how does the organization of the selection contribute to the authors purpose?

Answers

Answer 1

Answer:

The organization allows the author to show the abuse he suffered and how his life is much better after he left his former "master".

Explanation:

In "To my old master" we are presented with a letter that an old slave wrote to his former master, responding to a proposal for him to return to doing in which he was a slave. The author of the letter organizes it very efficiently, where in a very sarcastic way he describes the abuses that he and his family suffered in doing and how their lives are much better away from doing, but if there is compensation for the work already done by they are a generous and fair economic proposal, they can consider doing it again, but they don’t need it.


Related Questions

11. What do you think the prefix IN- means?

Answers

Answer:

The prefix in, which means “in, on, or not,” appears in numerous English vocabulary words, for example: inject, influx, and insane.

means “in” “no” “not”

_____ can also be thought of as an appeal to the most basic values held by your audience.

1. Arguments

2. Logos

3. Pathos

4. Reasons

Answers

I think it’s answer A

A business with two locations buys seven large
delivery vans and five small delivery vans. Location A
receives 5 large vans and 2 small vans for a total cost
of $235,000. Location B receives 2 large vans and 3
small vans for a total cost of $160,000. What is the
cost of each type of van? Use x for the price of a large
van and y for the price of a small van.

Answers

Answer: price of a large van = $35000

price of a small van = $30000

Explanation:

Let the price of a large van = x

Let the price of a small van = y

Since A receives 5 large vans and 2 small vans for a total cost of $235,000. Location B receives 2 large vans and 3

small vans for a total cost of $160,000. This can be written as:

5x + 2y = 235000 ........ i

2x + 3y = 160000 ........ ii

Multiply equation i by 2

Multiply equation ii by 5

10x + 4y = 470000 ..... iii

10x + 15y = 800000 ..... iv

Subtract iii from iv

11y = 330,000

y = 330000/11.

y = 30,000

From equation I,

5x + 2y = 235000

5x + 2(30000) = 235000

5x + 60000 = 235000

5x = 235000 - 60000

5x = 175000

x = 175000 / 5

x = 35000

Therefore, price of a large van = 35000

price of a small van = 30000

The price of a large van, x and price of a small van, y is $35,000 and $30,000 respectively

Given:

large van = x

small van = y

Location A

5x + 2y = 235,000

Location B:

2x + 3y = 160,000

5x + 2y = 235,000 (1)

5x + 2y = 235,000 (1)2x + 3y = 160,000 (2)

multiply (1) by 3 and (2) by 2

15x + 6y = 705,000 (3)

4x + 6y = 320,000 (4)

subtract (4) from (3)

15x - 4x = 705,000 - 320,000

11x = 385,000

x = 385,000 / 11

x = 35,000

substitute x into (2)

2x + 3y = 160,000

2(35,000) + 3y = 160,000

70,000 + 3y = 160,000

3y = 160,000 - 70,000

3y = 90,000

y = 90,000 / 3

y = 30,000

Therefore, the price of a large van, x and price of a small van, y is $35,000 and $30,000 respectively.

Learn more about equation here:

https://brainly.com/question/15165519

Explain how context plays a role in determining whether a writer uses language that is formal or informal. NEED ANSWER ASAP

Answers

정말 몰라, 미안해, 난 정말 포인트

Which is most similar to the word indignation?
Calm
Delight
Anger
O Pleasure
hing

Answers

Answer:

anger

Explanation:

2. The name of the main character in Great Expectations is Pip, which means
A. 'seed."
OB. "poor."
OC. "boy."
OD. "snake."

Answers

A. "seed"

Pip- The word Pip, means seed of a fruit and, just like a seed, the novel deals primarily with Pip's growth and development from a boy to a man

The Outsiders
Compare and contrast Johnny's death scene in the novel and movie.​

Answers

In the movie, Johnny was bludgeoned to death and consumed by a large beast known only as the zillo. In the novel how ever, they took a more natural approach when he died from burns and a scrotum blockage

Answer:

it is more imotional in the book then the movie.

Explanation:

Historically, mining and purifying uranium hasn't been a very clean process. Even transporting nuclear fuel to and from plants poses a contamination risk. And once the fuel is spent, you can't just throw it in the city dump. It's still radioactive and potentially deadly. On average, a nuclear power plant annually generates 20 metric tons of used nuclear fuel, classified as high-level radioactive waste. When you take into account every nuclear plant on Earth, the combined total climbs to roughly 2,000 metric tons a year [source: NEI]. All of this waste emits radiation and heat, meaning that it will eventually corrode any container that holds it.

Choose the best concluding statement for this paragraph.

A) Nuclear power is a good thing, but no one can say how much of a good thing

B) The relative value of employing nuclear power depends largely on the circumstances.

C) Nuclear power involves many environmental dangers, which must be taken into consideration.

D) Nuclear power should be forbidden outright; whatever benefits it brings are far outweighed by the costs.​

Answers

Answer: C) Nuclear power involves many environmental dangers, which must be taken into consideration.

Explanation: I just did it on USATestprep

Answer:

It's C just did it

Explanation:

how does this excerpt show that esperanza has changed?​

Answers

Answer:

Explanation:

She describes her old life of comfort and nice things, then she shows a willingness to learn to work.

(ELA) Which part of an opinion essay should sum up your entire argument?

A. conclusion
B. introduction
C. evidence
D. reasons

Answers

the answer is A because the intro is the beginning nd the reason in evidence is in the middle so it’s. A

The ratio gold charms to Silver charms is 1:3 which they will not describe this relationship

Answers

what are the answer choices

Answer:

For every silver charm, there is 3 gold charms.

Explanation:

For every silver their is 3 Gold, but that is not true because there is 3 silver to every gold.

What does the suffix -ize mean?

full of

the action of

make

capable of being

Answers

Answer:

make

Explanation:

the answer is up at the top.

which lines in this excerpt from act 1 scene v11 of macbeth imply that macbeth considered duncan a good man​

Answers

Answer:

Besides, this Duncan

Hath borne his faculties so meek, hath been

So clear in his great office, that his virtues

Will plead like angels, trumpet-tongued, against

Explanation:

William Shakespeare's "Macbeth" revolves around the story of how Macbeth propels himself to be the King of Scotland. But despite being king, he would also bring about his downfall in the end.

Act I scene vii of the play reveals Macbeth's reluctance, at some point, about killing Duncan. But if he did not do that, then the throne will not be his. So, pressurized by his wife, he did the deed of killing Duncan and putting the blame on the chamberlains.

But, the opening scene shows Macbeth revealing his true opinion of the King. He admits "Besides, this Duncan

Hath borne his faculties so meek, hath been

So clear in his great office, that his virtues

Will plead like angels, trumpet-tongued, against".

These lines reveal how Macbeth considered Duncan to be a good man, whose virtues will speak for him even in the afterlife.

in your opinion did the speaker actually hear a ghost

Answers

Answer:no

Explanation:

Answer:

no

Explanation:

Which of the following is NOT true
about John Locke?
A. He encouraged people to shake off unjust authority.
B. He did not believe in "divine right."
C. He was Prime Minister to King George III.
D. He influenced Thomas Jefferson

Answers

I think answer should be d. Please give me brainlest let me know if it’s correct or not okay thanks bye

What problems does plastic debris in the ocean pose for marine life, and why? Use in your own words.

Answers

Answer:it can cause marine life to gain sicknesses from diseases in the plastic as well as digesting the plastic it also could choke and kill them if determined to eat it

Explanation:marine life deserve to have a safe environment and putting debris in there environment is just causing it to be less and less safe

What y’all think 1-10 I think -10000

Answers

Answer:

10

Explanation:

you look very beautiful

What does the word "incident" mean and why do you think Cullen uses thisword to describe the event in this poem?

Answers

Answer:

he is looking back from his childhood

Explanation:

Answer:

incident

1.

an event or occurrence.

2.

likely to happen because of; resulting from.

3.

falling on or striking something

If you develop your sinews you will be?

A. fit and strong
B. wise beyond your years
C. wealthy and powerful
D. sympathetic to others

Answers

Answer:

A

Explanation:

Read the excerpt from Utopia.

The folly of men has enhanced the value of gold and silver because of their scarcity; whereas, on the contrary, it is their opinion that Nature, as an indulgent parent, has freely given us all the best things in great abundance, such as water and earth, but has laid up and hid from us the things that are vain and useless.

Which historical fact will best help readers understand this excerpt?

Answers

The folly of men has enhanced the value of gold and silver because of their scarcity

Answer:

A

Explanation:

Read the excerpt from Roll of Thunder, Hear My Cry.

The night whispered of distant thunder. It was muggy, hot, a miserable night for sleeping. Twice I had awakened hoping that it was time to be up, but each time the night had been total blackness with no hint of a graying dawn. On the front porch Mr. Morrison sat singing soft and low into the long night, chanting to the approaching thunder. He had been there since the house had darkened after church, watching and waiting as he had done every night since Papa had been injured. No one had ever explained why he watched and waited, but I knew. It had to do with the Wallaces.
HELP
What does Cassie most likely feel in the excerpt?

loneliness
happiness
restlessness
peacefulness

Answers

its restlessness

Explanation:

Answer:

tense

Explanation:

read the passage he's not relaxed or unkind and definitley not joyful

I need help ASAP please help

Answers

Answer:

1/8 of 72 equals 9. this is because 9*8=72.

hope this helps :)

Read the excerpt from Heart of a Samurai and then answer the question.

Eleven eyes. When at last he dared to look up, what he noticed was their eyes. Each pair a different color: green as a stormy sea, blue as the sky, black as night, or brown as his own. One man had only one eye, and that one as gray as a cloudy day. The other eye was covered with a patch.

There did not seem to be any tails, horns, or fangs among them. There were some alarmingly hairy faces and plenty of big noses, though!

Six big noses, in fact: one long and hooked, two long and straight, one squashed and wide, one turned up at the end, and another as big and red as a radish.
Based on this excerpt, what can readers infer about the stories the fishermen were told about the barbarians?

Answers

Answer: The readers can infer that the stories told about the barbarians were told in a way to make the barbarians sound terrifying and dangerous. The fishermen were, most likely, told about the barbarians in a way to make the fishermen fear them, as a sign to beware of them.

Explanation: The way the barbarians were described was terrifying, almost gruesome. The person describing the barbarians most likely was trying to warn them not to run in to them.

Double quotation marks are used:
1) whenever there is direct quotation
2) for internal dialogues​

Answers

Answer:

1) whenever there is a direct quotation

Whenever there is a direct quotation

Which of the following is a denotation of interesting?
O A. Emotions of excitement
B. Overwhelming feeling
O C. Holding one's attention or provoking interest
O D. Memories of science class experiments

Answers

Answer:

c

Explanation:

it makes the most sense

fix the sentence

Susanna came home from a work. She putted the key in the lock of the apartament door. She opened the door. She clearly heard a voise inside her apartment. Was it the TV? Was it the radio? Was it her neighbor? She not know if she should go in or run away! She couldn’t move. She couldnt think. She heard the soft sound of footsteps. She couldn’t breathe. The door slowly opened. “Mom! What are you doing here” Susanna said, when she caught her breath. “Hi Honey! Dad and I are cooking dinner for you!” plz help

Answers

Answer:

Answer down below!

Explanation:

Susanna came home from work. She put the key in the lock of the apartment door. She opened the door, and she clearly heard a voise inside her apartment. Was it the TV? Was it the radio? Was it her neighbor? She did not know if she should go in or run away! She couldn’t move. She couldnt think. She heard the soft sound of footsteps. She couldn’t breathe. The door slowly opened. “Mom! What are you doing here” Susanna said, when she caught her breath. “Hi Honey! Dad and I are cooking dinner for you!”

Just as two colors will, when carefully mixed, form a third and different color (yellow and blue, for example, produce green), so too it is sometimes possible to see in the cooperative efforts of living things a resultant accomplishment that defies description on the basis of the characteristics of the creatures involved. A description of the traits and performances of the individual members of a hive of honeybees or a championship athletic team hardly serves to describe the results of their joint efforts.
Which of the following sentences best describes this paragraph?
Make a Selection:
A. The whole is greater than the sum of its parts.
B. The race goes to the swift.
C. Two is company while three is a crowd.
D. A bird in the hand is worth two in the bush.

Answers

Answer:

A.

Explanation:

We see that in the last sentence "A description of the traits and performances of the individual members of a hive of honeybees or a championship athletic team hardly serves to describe the results of their joint efforts."

The phrases "joint efforts" and "individual members" in contrast with one another gives us a clue

Which sentence uses a synonym context clue to help the reader understand the word gangly?

Answers

Answer:

Which type of context clue is used to help you figure out the meaning of ... Synonym context clue ... After reading the sentence represnted above, I recognized the type of ... out the meaning of the word jaunt and it is antonym context clue. ... you understand the meaning of the word petulantly in this sentence?

Explanation:

What motivated Nelson Mandela to fight for freedom in South Africa?

Answers

Answer:

The unshakeable belief in the equality of all people and his determination to overthrow the system of apartheid in South Africa.

Explanation:

He believed in equality and wanted to stop apartheid in South Africa. He wanted people to be treated equally.

HOPE THIS HELPED

What is the definition of a noun

Answers

Answer:

A word (other than a pronoun) used to identify any of a class of people, places, or things ( common noun ), or to name a particular one of these ( proper noun ).

Explanation:

Answer:

a word (other than a pronoun) used to identify any of a class of people, places, or things ( common noun ), or to name a particular one of these ( proper noun ).

Explanation:

A noun is a word that functions as the name of a specific object or set of objects, such as living creatures, places, actions, qualities, states of existence, or ideas. However, noun is not a semantic category, so that it cannot be characterized in terms of its meaning.

Other Questions
NEED HELP ASAP DUE 11:30PM ! Which descriptions of the English colonies in North America are accurate?Choose all answers that are correct.Question 46 options:The king granted a lot of self-government to Massachusetts and other colonies in the hope they would send back raw materials and would start paying taxes.The men on the Mayflower signed an agreement to write fair laws for the good of the colony.Virginia planters paid English laborers good wages to come work on their plantations.Jamestown was established on good ground near clean water in a healthy environment.Only about 1 in 5, or 20 percent, of early colonists in Virginia survived Match the expression with an equivalent expression 6( n + 4 ) = Can anyone please help me solve this?? A: x/8=3/4B: 2/5=x/40C: 1/8=x/40D:x/10=12/15 3(2(8-2x4)+25divided by 5 )-(2(8 divided by 4x2)-7(7-2x3) can you please help me:) Please help 4 questions for 10 points!!!------------------------------------------------------------1) Which expression is equivalent to 4(23)?4(20+3)4(2+3)4(2+13)4(20+30)..................................................................................................2. Which expressions are equivalent to 4(42)?Select each correct answer.4(20+22)4(40+2)4(4+20)4(4+2).......................................................................................................3.Which expression shows how 645 can be rewritten using the distributive property?640+6206+205640+6564+65...............................................................................4.Tori uses the greatest common factor and the distributive property to rewrite this sum:24 + 84What expression does Tori write?2(24+42)12(2+7)24(1+4)4(6+21).....................................................................my last one got deleted.... paid rent of Rs.25000 by cheque. make journal entry write the code for RNA from this DNA STRAND :AAAAAATTTTTTCCCGGGGTTTATATATC RIP grandsonhow does earths crust change earths surface [2.1 + (9.2 x 3.3)] x 0.8 y32c-4-3 -2 -1-1+1 2 3 4-2+-3+-4+41What is the slope of the line? Explain why the Hitler youth had only mixed success among the young German people. You may use the following in your answer comradeship (friendship), compulsory membership. hi...need help....thank you.. A restaurant customer left $1.35 as a tip...Plz help me complete the addition equation that represents the associative property DIRECTIONS: Use this information to answer Parts A, B, and C.A traffic cone has a diameter of 10 inches and a height of 27 inches.Part AFind the volume of the cone. Need answers for #3 please hep Identify the number of solutions for the equation below: A game store owner buys a Nintendo Switch game for $22.50 and sells it with a 40% mark up. What is the retail price?