____is associated with deamination of protein​

Answers

Answer 1

Answer:

Deamination is the removal of an amino group from a molecule

Deamination is associated with deamination of protein​

Answer 2

Answer:

in humans , deamination  takes place primarily in the liver, it can also occur in the kidney. if there's excess protein intake , deamination is used to break down proteins with amino acids for energy


Related Questions

The hypothalamic hormone that triggers the secretion of FSH and LH from the anterior pituitary is

Answers

Answer:

Hypothalamic-Pituitary-Gonadal Axis

GnRH produced by the hypothalamus stimulates the production of both LH and FSH. FSH functions by stimulating ovarian follicular development in females and regulating spermatogenesis in males. LH induces ovulation and corpus luteum formation in the ovaries.

plz give brainlist

hope this helped

Based on fossilized evidence, there are scientific claims made about the evolution of certain species. If a scientist studying the fossils of a specific species had a hypothesis other than what was currently accepted, what steps should be taken to have the alternative hypothesis considered

Answers

Answer: For the scientist to have alternative hypothesis considered, it is imperative he takes certain steps, this steps will ascertain the scientific claims already made about the evolution of species.

Therefore,the scientist will simply test the alternative hypotheses inorder to know that they are incorrect.

This testing of hypotheses to ascertain their incorrectness is very useful in the study of fossils.

What results if a broken chromosomal fragment becomes reattached as an extra segment to a sister or non-sister chromatid? A Duplication B Inversion C Polyploidy D Nondisjunction

Answers

Answer:

The correct answer is option A "Duplication".

Explanation:

Chromosomal duplication is defined as a type of rearrangement of genetic material at which extra copies of a DNA fragment are created. In this case if a broken chromosomal fragment becomes reattached, this fragment will represent an extra copy, and therefore the resultant genetic material is considered a chromosomal duplication.

Which ecosystem service would suffer from the opening of a mineral mine along a small mountain range?

A. Cultural
B. Provisioning
C. Regulating
D. Supporting

Answers

Answer:

D. Supporting

Explanation:

Ecosystem services include provisioning, regulating, culture and supporting services.

Opening of a mineral mine along a small mountain range will affect the supporting services of ecosystem because supporting services deals with soil formation, provision of habitat and nutrition cycle.

Opening of mineral mine will destroy the tosoil, landscape, forests and wildlife of mountain area which affect the supporting services such as habitat and soil formation.

Hence, the correct answer is "D. supporting".

which best describes bacterium?

Answers

Answer:

Bacteria (singular: bacterium) are classified as prokaryotes, which are single-celled organisms with a simple internal structure that lacks a nucleus, and contains DNA that either floats freely in a twisted, thread-like mass called the nucleoid, or in separate, circular pieces called plasmids. Hope this helps :))

Explanation:

Answer:

Bacteria are classified as prokaryotes, which are single-celled organisms with a simple internal structure that lacks a nucleus, and contains DNA that either floats freely in a twisted, thread-like mass called the nucleoid, or in separate, circular pieces called plasmids.

Explanation:

what are sex hormones?why are they named so? state their function.

Answers

Answer:

Sex hormones or hormones of the reproductive organs are certain cells in the reproductive organs that produce hormones.

The testis produces testosterone,the male sex hormone,and the ovaries produces oestrogen and progesterone, the female sex hormones.

In a sexually mature male,testosterone influences sexual behaviour, and together with FSH,regulates sperm production in the seminiferous tubules of the testes.

Sexually matured females undergo a regular 4-week reproductive or menstrual cycle during which a mature egg is released.This cycle is regulated by oestrogen and progesterone. During pregnancy, progesterone inhibits egg production (ovulation),brings about the development of the placenta and prevents the uterus from contracting....I hope this answers your question... Thank you for the question.

why it is necessary to water the plant for experiment​

Answers

Answer:

To activate the process of germination.

Explanation:

So the plants can get the whole photosynthesis step because it need sunlight and water to continue to grow.

Which is most likely a source of air pollution? littering CFCs oil spill runoff

Answers

Answer: CFCs

Explanation: The other options aren’t as relevant to air pollution.

Answer:

cfcs

Explanation:

What do nitrifying bacteria do?

Answers

Answer: Nitrifying bacteria such as Nitrosomonas play an important role in providing nitrogen to plants and limiting carbon dioxide fixation. They are found widely distributed in soil or water, where there are large amounts of ammonia, such as lakes or streams into which treated and untreated sewage is pumped.

Explanation:

Answer:

They change Nitrogen to Nitrite and ammonia. Which helps plants to use Nitrogen even though it's in another form.

Hope this helps ;) ❤❤❤

While performing an experiment, it is important to:
a. change the control setup
b. test many different variables at the same time
c. reach a conclusion
d. record observations and measurements

Answers

Answer:

D

Explanation:

While performing an experiment, it is important to record observations and measurements, as in Option d. Option d is correct regarding the facts of the experiments, while the others are wrong.

What is an experiment?

The experiment is carried out to observe the hypothesis, and in this process, a control set-up is taken whose value or result is already known, and the variables are taken and compared with the control. The controls set should never change in the experiment because the variables are tested with reference to them, and the measurements and observations of the experiment should be taken into consideration to prove the hypothesis. All the variables should not be tested at once because if this is done, it would introduce error into the experiment, and not all the experiments are done to get the conclusion.

Hence, while performing an experiment, it is important to record observations and measurements, as in Option d.

Learn more about the experiment here.

https://brainly.com/question/11256472

#SPJ2

Atmospheric nitrogen can be fixed by nitrogen-fixing bacteria. Arrange the following forms of nitrogen from the atmospheric N stage to the final form that enters the roots. 1. Ammonia 2. Nitrogen gas 3. Ammonium ion 4. Nitrite 5. Nitrate

Answers

Answer:the answer is ammonia

Explanation:the nitrogen fixing bacteria fix the nitrogen as ammonia

Consider the cladogram. A cladogram is shown. Roundworms have the derived characteristics of true tissues, bilateral symmetry, and a pseudocoelom. Which group of organisms has the derived characteristics of true tissues, bilateral symmetry, and a pseudocoelom? sponges roundworms annelids chordates

Answers

Answer:

The correct answer is - roundworms.

Explanation:

The answer is already mention in the question, however, the detailed answer is as follows:

The characteristics that are given in the question are true tissues, bilateral symmetry, and a pseudocoelom. Worms or helminths are known as primitive form of organization of the Bilaterians. All three group of worms or helmints have a basic bilateral symmetry.

These organisms inaugurated various characteristic that are found and carried by other animals such as  true tissues, bilateral symmetry, and a pseudocoelom.

Thus, the correct answer is - roundworms.

Answer:

its b

Explanation:

Ultra-high-temperature sterilization effectively reduces microbes that cause spoilage. removes only mesophilic microbes. reduces microbes that cause disease. removes all microbes that cause diseases or spoilage. reduces microbes that cause disease or spoilage.

Answers

Answer:

kills all microbes that cause disease or spoilage.

Explanation:

There are different methods of sterilization, such as ultraviolet radiation, autoclave mechanisms, etc.

The sterilization mechanisms eliminate the microorganisms completely, thus generating sterile surfaces.

These mechanisms are used with surgical instruments, the operating room environment.

The autoclave method is the most widely used today due to its economical price, its ease of use and its practicality.

Sterilization methods must be strictly controlled with pilot or test microbiological cultures to be able to corroborate that these mechanisms function correctly, since otherwise they could trigger strong pathologies due to cross contamination.

who discovered micro organisms​

Answers

Robert Hooke is the person that discovered Micro organism

Answer:

An English architect, "Robert Hooke" discovered micro organisms in 1665.

Hope this helped!

Have a nice day:)

BRAINLIEST would really help me:)

Dump out half of the particles. Place your hand tightly over the top and shake the container. Then remove most of the remaining particles, and shake the container again. Compared with the full container, which states of matter do these two models most closely represent? Explain.

Answers

Answer:

solid

Explanation:

The two models explained are most closely representing the "solid" state.

As in both the models the techniques used are to separate particles through shaking technique and shaking is efficient gravity separation method which helps in separating solid particles such as while dealing with tungsten and tin.

Hence, the correct answer is "Solid".

Answer:

When the container was half full, the particles had more freedom to move around than they did when the container was full. A half-full container represents a liquid. When the container had only a few particles, they had lot more freedom to move about. So, this model represented a gas.

Explanation:

plato answer

Why is environmental science important?

Answers

Explanation:

it is where we live and share resources with order species

I hope this was helpful

Can podocyte cells in the Bowmann capsule attach to any other basement membrane other than the glomerular basement membrane? That is, it can itself have a separate layer of base membrane?​

Answers

Answer:

"Podocytes are cells in the Bowman's capsule in the kidneys that wrap around capillaries of the glomerulus. Podocyte cells make up the epithelial lining of Bowman's capsule, the third layer through which filtration of blood takes place.[1] The Bowman's capsule filters the blood, retaining large molecules such as proteins while smaller molecules such as water, salts, and sugars are filtered as the first step in the formation of urine. Although various viscera have epithelial layers, the name visceral epithelial cells usually refers specifically to podocytes, which are specialized epithelial cells that reside in the visceral layer of the capsule. "

Explanation:

hope this helps

Proteins in the cell membrane have many functions. Which type of protein would be used for cell recognition and as a receptor? A. Pore proteins B. Endoplasmic proteins C. Glycoproteins D. Integral proteins

Answers

Answer:

C. glycoproteins

Explanation:

Glycoproteins are proteins containing glycans (oligosaccharide carbohydrates) attached to amino acid side chains. These oligosaccharides are attached to the amino acid chain by a posttranslational modification referred to as glycosylation, a modification generally found in extracellular regions. Glycosylation refers to the chemical reaction in which a glycosyl donor (i.e., the carbohydrate) is attached to a functional group in the protein. The glycosylation sites play distinct functional roles for both cell interactions and cell recognition. Moreover, glycosylation sites are also essential for substrate recognition by an enzyme. For example, secreted cytokines are glycosylated, which is required for their binding to receptors.

Technology has affected society by causing radical changes in how people live. For example, e-mail on the computer has changed the way we communicate with the world. Describe another example of how technology has changed how people live

Answers

Answer: the modern production of the cars change the way of transportation

Modern houses change the way where people locate

Another example of how technology has changed how people live is the widespread use of smartphones and mobile applications.

Smartphones have become an integral part of daily life for many people, revolutionizing the way we communicate, access information, and carry out various tasks.

Some ways in which smartphones and mobile applications have transformed our lives:

1. Communication: Smartphones have made communication more convenient and accessible. With features like instant messaging, video calls, and social media apps, people can easily connect with others regardless of their location.

2. Information Access: Smartphones provide instant access to a vast amount of information through the internet. With a few taps on a smartphone screen, people can search for news, look up facts, find directions, or access educational resources.

3. Online Shopping: E-commerce platforms and mobile shopping apps have revolutionized the way people shop. With smartphones, individuals can browse and purchase products or services from anywhere, anytime.

These are just a few examples of how smartphones and mobile applications have significantly changed the way we live.

Know more about radical changes:

https://brainly.com/question/32952641

#SPJ2

Imagine an invertebrate that lives in an estuary where salinity varies cyclically with the tides. If this individual is able to adjust the salt concentration of its body fluids, its salt concentration will have:____. a. a cyclic variation depending upon when the animal drinks. b. regular variations that range from large to small. c. slight fluctuations that are kept within a narrow range. d. a cyclic variation opposite that of the surrounding water.

Answers

Answer: Option C.

slight fluctuations that are kept within a narrow range.

Explanation:

An invertebrate that lives in an estuary where salinity varies cyclically with the tides. If this individual is able to adjust the salt concentration of its body fluids, its salt concentration will have slight fluctuations that are kept within a narrow range so has to maintain homeostasis and prevent the cells of the the invertebrate from not shrinking which can be due to the salt solution (Hypertonic).

Estuary is an area of water or shorelines where river meet the ocean. It normal do have concentration of salts. Organisms that live in estuaries must be able to adapt to their dynamic environments, wich is due to variations in water chemistry includes salinity, as well as physical changes like the rise and fall of tides.

a pupil performed an experiment in a school lab to show the action of a digestive enzyme on a food substance

a) Name and enzyme suitable for such an experiment
b) Name a food substance on which the enzyme that you have named will act
c) Describe any preparation of the food required before the experiment is performed. If no preparation is required state why?
d) give the temperature at which the enzyme-food mix should be maintained for the experiment to work
e) how much time is needed for digestion of food in this experiment?
f) describe a test to confirm that digestion has occurred ​

Answers

I prefer d as the correct answer!!!

a student hypothesized that pillar coral eat and digest zooxanthellae. which of these observations would cause the student to change this hypothesis

Answers

Answer:

the zooxanthellae in a pillar coral's body are alive

2) Micah and Taylor investigate the effect of tap water and spring water on the growth of plants.

They grew two plants of the same type and size in separate containers. Every three days, they

added the same amount of tap water to one plant and the same amount of spring water to the

other. Describe an action that would best improve the reliability of their results?

Answers

Answer:

To improve the reliability of the results, the nutritional component of each category of water must be tested and recorded.

Second, the experiment should be carried out under greenhouse conditions.

The above actions will afford more control. When an experiment is controlled, it means that except for the dependent variable, all other variables are kept constant by the scientist.

By performing the experiment under greenhouse conditions, the kind of water the plants receive, temperature and other biotic actors are kept within measurable limits thus increasing the reliability of the results.

Cheers!

Please I need help with this

Answers

TAAGCCGATAAATGCTAACGGTA

A gamete is best described as what?
A. The protective outer layer of an egg cell.
B. An enzyme in a sperm used to digest the egg cell's membrane.
C. A haploid cell produced for reproduction.
D. A diploid cell produced for reproduction.

Answers

Answer:

C. A haploid cell produced for reproduction.

Explanation:

The term "gamete" refers to reproductive cells such as sperm and ova. Sperm and ova are both haploid cells that unite to form diploid cells.

name 3 physiological processes of cell membrane?{3mks} plz help me guys

Answers

Answer:

the cell membrane is an extremely pliable structure composed primarily of back -to- back phospholipids (a "bilayer")

The scientist has chosen to study the motion of clouds in the atmosphere during a thunderstorm which type of model is most appropriate for her investigation

Answers

Answer: COMPUTER SIMULATION

Explanation: Computer simulation is a model that helps to scientists to have a clear and better understanding and be able to effectively predict the occurrence of future outcomes of real physical situations.

Computer simulation makes use of mathematical models to effectively analyse and predict future occurrences which helps the world to be better prepared and able to effectively manage physical and real world situations.

Why was the Nationalist Party more popular in China’s cities than in the countryside? Wealthy people who supported the party were concentrated in cities. People in the countryside were less active in politics than people in the city. Poor city dwellers hoped the Nationalist Party would bring economic change. The Nationalist Party threatened to end crop trade with Western nations.

Answers

Answer:

Wealthy people who supported the party were concentrated in cities.

Explanation:

Answer:

The answer is A on edge

Explanation:

Some food material is given
below. What are the diffrent
possible ways of cooking them?
Find out and write them.
Meat - Groundnuts - Potatoes
Spinach​

Answers

Answer:

Meat-Boiling, Grilling, frying and roasting

Groundnuts-frying,boiling

Potatoes-Boiling frying and roasting

The arrangement of leaves on a tree branch that reduces overlapping and overshadowingof leaves from sunlight is referred to as leaf …………………………………………………………This ensures exposure of most of the leaves to sunlight for maximum ……………………………………………..to take place in the ………………………………………………………………………of leaf cells. The grana contains numerous……………………………………………molecules which trap light………………………………….for ………………………………………………….of water, producing ………………………………………atoms required for the process of carbon (IV) oxide…………………………………………………………in the light……………………………………………………………stage of photosynthesis which takes place in the……………………………………………..of the chloroplast.

Answers

Answer:

phyllotaxy

photosynthesis

chloroplasts

chlorophyll

energy

oxidation

oxygen

reduction

independent

stroma

Explanation:

The arrangement of leaves that provide maximum exposure to sunlight is referred to as leaf phyllotaxy that reduces overlapping and overshadowing of leaves and supports maximum photosynsthesis.

The contains numerous chlorophyll molecules that trap the light energy for the oxidation of water and producing oxygen (O2) atoms required for carbon (IV) oxide reduction in light-independent, which takes place in the stroma of the chloroplast.

Hence, the correct answer in a sequential manner is as follows:

phyllotaxy

photosynthesis

chloroplasts

chlorophyll

energy

oxidation

oxygen

reduction

independent

stroma

Other Questions
What is the area of polygon EFGH? limit chapter~ anyone can help me with these questions?please gimme clear explanation :) PLZ HELP !!!!!! ASAP!!! What two factors determine how much potential energy an object has? Two balls are drawn in succession out of a box containing 5 red and 4 white balls. Find the probability that at least 1 ball was red, given that the first ball was (Upper A )Replaced before the second draw. (Upper B )Not replaced before the second draw. (A) Find the probability that at least 1 ball was red, given that the first ball was replaced before the second draw. StartFraction 24 Over 49 EndFraction (Simplify your answer. Type an integer or a fraction.) (B) Find the probability that at least 1 ball was red, given that the first ball was not replaced before the second draw. hi there can you please help me[tex]t = \sqrt{ \frac{ab - s}{r + ak} } [/tex] Plz Help I Will Mark Brainliest If Right f(x) = x^2 + 3 A). y > -3 B). All real numbers C). y 3 D). y 3 What is the difference between a matrix and a determinant? State if the triangles are similar. If so, how do you know they are similar and complete the similarity statement. Triangle LKJ____ Because she has limited shelf space, she can't put out all her copies of the CD at once. On Monday morning, she stocked the display with 40 copies. By the end of the day, some of the copies had been sold. On Tuesday morning, she counted the number of copies left and then added that many more to the shelf. In other words, she doubled the number that was left in the display. At the end of the day, she discovered that she had sold the exact same number of copies as had been sold on Monday. On Wednesday morning, the manager decided to triple the number of copies that had been left in the case after Tuesday. Amazingly, she sold the same number of copies on Wednesday as she had on each of the first two days! But this time, at the end of the day the display case was empty. Discussed the goals of harriet tubmen and reflected upon whether or not you believed they were successful. Includes key factors of success and their main accomplishments. Write a balanced chemical equation for the base hydrolysis of methyl butanoate with NaOH. (Use either molecular formulas or condensed structural formulas, but be consistent in your equation.) I broke the locket with a thick brick. What rhetorical device is being used in this sentence? A .Alliteration. B.Onomatopoeia c.consonance d.assonance Andrea hired Jack to be the sales agent for her paintings. However, in a month's time, she terminated the agency with Jack. Harold, a customer who had dealt with Jack earlier, was not aware of the termination. Harold approached Jack to buy a painting and wrote him a check of $5,000, the advance payment for the painting which Jack promised would be delivered in two weeks. When Jack did not contact Harold later, Harold demanded that Andrea honor the contract, since Jack sold the picture as her agent. Which of the following is true of this situation?A. Since Jack had apparent authority, Andrea is liable to honor his contract with Harold.B. Harold's duty was to contact Andrea. His failure to do this removes her liability to honor the contract.C. Jack had express authority as Andrea's agent, which is not terminated with the termination of their agency.D. As Andrea terminated the agency with Jack in violation of his rights, Jack has the direct authority to sell her paintings. A project has estimated annual net cash flows of $56,600. It is estimated to cost $339,600.Required:Determine the cash payback period. With the same block-spring system from above, imagine doubling the displacement of the block to start the motion. By what factor would the following change?A. Kinetic energy when passing through the equilibrium position. B. Speed when passing through the equilibrium position. PLEASE ANSWER QUICKLY ASAP READ QUESTIONS CAREFULLY Granger Inc. Comparative Balance Sheets December 31Assets 2017 2016Cash $80,800 $48,400Accounts receivable 87,800 38,000Inventory 112,500 102,850Prepaid expenses 28,400 26,000Long-term investments 138,000 109,000Plant assets 285,000 242,500Accumulated depreciation (50,000) (52,000)Total $682,500 $514,750Liabilities and Stockholders' Equity Accounts payable $102,000 $67,300Accrued expenses payable 16,500 21,000Bonds payable 110,000 146,000Common stock 220,000 175,000Retained earnings 234,000 105,450Total $682,500 $514,750Granger Inc. Income Statement Data For the Year Ended December 31, 2017Sales revenue $388,460Less: Cost of goods sold $135,460 Operating expenses, excluding depreciation 12,410 Depreciation expense 46,500 Income tax expense 27,280 Interest expense 4,730 Loss on disposal of plant assets 7,500 233,880Net income $154,580Additional information: 1. New plant assets costing $90,000 were purchased for cash during the year. 2. Old plant assets having an original cost of $51,750 and accumulated depreciation of $43,650 were sold for $1,350 cash. 3. Bonds payable matured and were paid off at face value for cash. 4. A cash dividend of $23,427 was declared and paid during the year.Required:Prepare a statement of cash flows for Granger Inc. using the direct method. wo independent samples have been selected, 100 observations from population 1 and 76 observations from population 2. The sample means have been calculated to be x1=11.9 and x2=12.9. From previous experience with these populations, it is known that the variances are 21=27 and 22=23. (a) Determine the rejection region for the test of Find the value of x. A: 15 B: 12 C: 10 D: 8