Kai took five tests this semester. His scores are listed below.

92, 88, 90, 96, 84

What is the mean absolute deviation of Kai's test scores?

Answers

Answer 1

Answer:

First, lets list them in order

84, 88, 90, 92, 96

Okay so the median is 90

the mean is 90 as well

Step-by-step explanation:


Related Questions

How much time has passed?
Start time: 4:45 a.m. End time: 7:25 a.m.

Answers

Answer:

2 hours and 40 mins i think

Step-by-step explanation:

Jordan's pet grooming business has a monthly cost function of C = $12p + $2100. His Revenue is given by the function R = $62p, where C is the total cost per month, R is the total revenue he receives each month and x is the number of pets he grooms in a month. How many pets must he groom each month to break even?

Answers

Answer:

Step-by-step explanation:

.

If the pattern in the table continues when will sales for DVD players equal sales for mobile phones?
answer choices
never
year 2011
year 2010
year 2012

Answers

Answer:

never because they are continually increasing at the same rate without multiplying and dividing

I WILL GIVE YOU BRAINLY PLSS



It costs Fred $0.20 to send a text message from his cell phone. He has already spent $4 in text messages this month. If he has a total of $10 that he can spend
this month on text messages, which inequality shows the greatest number of text
messages that he can send?
A. 4 + 0.20 ≤ 10
B. 4 + 0.20 ≤ 10
C. 4 + 0.20 < 10
D. 4 + 0.20 < 10


PLSS SHOW YOUR WORK PLSS

Answers

Answer:

I think it should be 4+ .20 = 10 so A or B maybe you wrote it out wrong

so the answer is A or B because you have to divied and A and B are the same  he would end up sending 50 msg

give the coordinates (1,4) after a translation 3 units up and 2 units to the left.

Answers

Answer:

The coordinates would be (3,7)

I NEED HELP ON SIMPLIFYING THIS SOMEONE HELP

Answers

Answer:

I think it is 3^8

Step-by-step explanation:

(3^5)^2

÷

3^-2

3^10

÷

3^-2

=3^8

Find the length of side A

Answers

Answer:

D) 4

Step-by-step explanation:

Hey guys ( or gals ) I have no idea what to do please help me.

Answers

Answer:

Irrational numbers cannot be written as a fraction, or the ratio of two whole numbers.

You would have to find a GCF (greatest common factor) and multiply it out of the radical.

ex.

[tex]\sqrt{6}[/tex] = 2 x 2 x 2

when you have to multiplier numbers then you can combine two of them to take outside the radical, meaning 2x2x2

2[tex]\sqrt{2\\}[/tex]

so [tex]\sqrt{6}[/tex] would be closest to the positive 2 on the number line and 2 notches.

[tex]\sqrt{11}[/tex]

is an irrational number, so it might fall into 3.3 if turned into a decimal.

Step-by-step explanation:

Suppose y varies directly as x, and y=26 when x=8. Find x when y=65.

Answers

Answer:

when y=65, x=20

Step-by-step explanation:

We are given:

y varies directly as x

and y=26, when x=8

We need to find x, when y = 65

y varies directly as x can be written as:

[tex]y\:\alpha \:x\\y=kx[/tex]

Where k is constant of proportionality.

Finding k, when y=26 and x=8

[tex]y=kx\\26=k(8)\\k=\frac{26}{8}\\k=3.25[/tex]

We get the value of k = 3.25

Now, we need to find value of x, when y=65 and k=3.25

[tex]y=kx\\65=3.25(x)\\x=\frac{65}{3.25}\\x=20[/tex]

So, when y=65, x=20

HELP ME PLZZZ This is the only table I don't know,

Answers

Answer:

apples: 6/8 = $0.75 per apple

pears: 1.25/1 = $1.25 per pear

peaches: 1.50/1 = $1.50 per peach

bananas: 4/6 = $0.67 per banana

"price per unit" means that you want to find out how much a single one of the product costs. you figure it out by dividing the price by how many there are.

Step-by-step explanation:

I hope this helps :)

NEED HELP!!! Answer all of the questions below you will see a link, I would give thanks to anyone that can do this:) If anybody needs any information on how to pull it up, there should be a link that says download Docx if that helps.

Answers

9514 1404 393

Explanation:

1. You are given the statement "A is B". In "if-then" form, it can be written, "if it is A, then it is B."

  If it is broccoli, then it is a vegetable.

__

2. The hypothesis is the "if-" part:

  (If) it is broccoli

__

3. The conclusion is the "then-" part:

  (then) it is a vegetable

__

4. The converse interchanges the hypothesis and conclusion:

  If it is a vegetable, then it is broccoli.

__

5. The converse is false. A potato is a vegetable, but is not broccoli.

__

6. The inverse negates the hypothesis and conclusion:

 If it is not broccoli, it is not a vegetable.

__

7. The inverse is false. A potato is not broccoli, but is a vegetable.

__

8. The contrapositive is the inverse of the converse:

  If it is not a vegetable, it is not broccoli.

__

9. The contrapositive has the same truth value as the original statement. Here, it the contrapositive is true.

The local car dealership will approve the purchase of a $32,795
car with a 72 month loan. Enter the length of the car loan in years.

Answers

Answer:

?

Step-by-step

Can you be more specific?

Marcie likes to collect stickers, but she also likes to give them away. Currently, Marcie has 87 stickers in her collection. If Marcie collects 5 new stickers each week and gives away 3 stickers each week, how many stickers will Marcie have in her collection after 5 weeks?

Answers

Answer: 97 stickers

Step-by-step explanation:

Marie has 87 stickers in her collection.

Each week she collects 5 and gives away 3.

The total number of stickers she gains per week is therefore:

= 5 - 3

= 2 stickers per week

In 5 weeks therefore, she would have collected:

= 2 * 5

= 10 stickers

Add that to the original number:

= 87 + 10

= 97 stickers

Write an equation to find the value of x so that each pair of polygons has the same perimeter. Then solve​

Answers

The Pythagoras Theorem:

the base squared and height squared added is equal to the hypotenuse squared.

so

(x+6)² + (x+3)²= (x+9)²

x²+36+12x+x²+9+6x = (x+9)²

2x²+45+18x=x²+81+18x

x²=36

x=√36

X= 6

now

(x+6)= 12

(x+3)=9

(x+9)=15

haha sorry correct it pls

Which of the following represents the factorization of the binomial below?
x² - 121
O A. (x-11)(x-11)
B. (x +11)(x+11)
C. (x +11)(x-11)
D. (X)(x-121)

Answers

Answer:

C. (x + 11) (x - 11)

Step-by-step explanation:

x² - 121

= x² - 11²

= (x + 11) (x - 11) (Difference of two squares)

HELPPppPpPPpppppppp BRAINLIESTTTT

Choose the inequality symbol (>,


<


=

Answers

The inequality is < because the equal sign is an equality.
I don’t need a brai

Mary's Muffins makes 300 muffins on Thursday mornings. On Fridays, they make 10 times as many muffins as they do on Thursdays. How many muffins does Mary's Muffins make on a Friday? *​

Answers

Answer: 3,000

Step-by-step explanation: 300 x 10 = 3000

Answer:

3000

Step-by-step explanation:

300+300=600+300=900+300=1200+300=1500+300=1800+300=2100+300=2400+300=2700+300=3000

Write the ordered pair corresponding to the point B.

Answers

Answer:

The ordered pair for point A is (-2, 0). For point B, move to the right 4 units to get an x-coordinate of 4, then move down 3 units to get a y-coordinate of -3. The ordered pair for point B is (4, -3). For point C, move to the right 3 units to get an x-coordinate of 3, then move up 5 units to get a y-coordinate of 5.

Step-by-step explanation:

hope this helps

Answer:

(-2, -3)

Step-by-step explanation:

Which expression is not equivalent to 3x-2

Answers

Answer: Let's simplify step-by-step.

3x−2

There are no like terms.

So it going to be the same, =3x-2

Step-by-step explanation: hope you understand

Answer:

2x + 2 + x

Step-by-step explanation:

Solve the equation-7(x-2)= -84

Answers

Answer:

x = 14

Step-by-step explanation:

First, use the distributive property:

-7x + 14 = -84

-7x = -98

x = 14

Answer:

my answer got deleted for no reason so ill add it again with my way of solving it with steps this time.

x=14

Step-by-step explanation:

divide both sides by -7

[tex]\frac{-7(x-2)}{-7} =\frac{-84}{-7}[/tex]

simplify

[tex]x-2=12[/tex]

add two to both sides

[tex]x-2=12[/tex]

    [tex]+2[/tex]   [tex]+2[/tex]

simplify

[tex]x=14[/tex]

hope having another method helps :)

The length of the two legs of a right triangle are 18 cm and 24 cm.
What is the length of the hypotenuse of the triangle?
O A. 30 cm
OB. 36 cm
OC. 42 cm
D. 48 cm

Answers

Answer: 30 cm

Step-by-step explanation: Take note that ^2 means to the second power.

a^2 + b^2 = c^2 (hypotenuse)

18^2 + 24^2 = c^2

324 + 576 = c^2

900 = c^2

To find the length of c you have to find teh square root of 900.

√c^2 = √900

c = 30

The length of the hypotenuse is 30 cm!

Hope this helped!

Here are the marks of a student in four exams. 65 80 76 69 The student takes a fifth exam. His mean mark for the five exams is 70 Work out his mark in the fifth exam

Answers

Answer:

mark of the fifth exam = 60

Step-by-step explanation:

Mean = sum of all marks / number of exam

Mean = 70

Number of exam = 5

Let x =

Mean = sum of all marks / number of exam

70 = (65 + 80 + 76 + 69 + x) / 5

Cross product

70 × 5 = (290 + x)

350 = 290 + x

350 - 290 = x

x = 60

mark of the fifth exam = 60

In which choice do all three points lie on the same straight line?
A. (0,0) (1, 1) (2, 4)
B. (5, 1) (-3,0) (-1,2)
C. (2, 10) (4.9) (5,8)
D. (0.1) (2,3) (4,5)

Answers

Answer:

D) (0,1) (2,3) (4,5)

Step-by-step explanation:

Explanation

Given Points are  A(0,1) , B(2,3) , C(4,5)

slope of the AB

                  [tex]= \frac{y_{2} -y_{1} }{x_{2}-x_{1} } = \frac{3-1}{2-0} =\frac{2}{2} =1[/tex]

Slope of BC

                [tex]= \frac{y_{2} -y_{1} }{x_{2}-x_{1} } = \frac{5-3}{4-2} =\frac{2}{2} =1[/tex]

Therefore slope of AB and BC are equal

The three points lie on same straight line

The three points are collinear points

Which statements verify that the solution set to |x + 3| < 5 is –8 < x < 2? Check all that apply.

1. Substituting a value into the inequality from the solution set, such as –2, will create a true statement.
2. Substituting a value into the inequality from the solution set, such as 1, will create a false statement.
3. Substituting a value into the inequality not from the solution set, such as 4, will create a true statement.
4. Substituting a value into the inequality not from the solution set, such as 6, will create a false statement.
5. Substituting any value into the inequality will create a true statement.

Answers

Answer:

1 and 4

Step-by-step explanation:

Answer:

1 and 4

Step-by-step explanation:

Only true statements out of the option

403, 395,387,...

Find the 36th term.

Answers

Answer:

n=36

a=403

d=395-403=8

an=a+(n-1)d

a36=403+(36-1)395

=14228

Answer:

the answer is actually 123

Step-by-step explanation:

What is -7x3 =
Need answers asap!

Answers

Answer:

it is -21

Step-by-step explanation:

make it braintliest please

Answer:

-7×3 = -21

Step-by-step explanation:

I hope it helps ❤❤

ANSWER NOW AND YOU GET 12 and ill answer one of ur questions

Answers

Answer Im going to geuss the last, Im not sure but it looks right.

Step-by-step explanation: heres my question-->  https://brainly.com/question/20473783

MATHH WHIZZES PLZZZ HELPPPPP!!!!!

Answers

Answer:

$7.40

Step-by-step explanation:

785 of 24 is 18.72, 150in = 4.17yrd, 4.117*5 is the minimum whole number that reaches 18.72, 5*1.48=7.40

Answer:

$7.40

Step-by-step explanation:

Put the following list of numbers in order from smallest to largest.
1. first 28.3
2. second 28.15
3. third 27.068
4. fourth 29.94
5. fifth 28.08

Answers

Answer:
27.068
28.08
28.15
28.30
29.94

is this equation linear or exponential
f(x)=2x+1

Answers

Answer:

The equation is linear.

Step-by-step explanation:

Notice that variable x is on the first degree.

Answer:

linear

Step-by-step explanation:

uiwue7uwiiwuw8

Other Questions
Is (1, -7) a solution of y=x-8?Yes Please help me with these questions FAST it's formal and I can't faillllllll!!!!!!, If you had to define ecological succession in your own words in a 140 character text, how would you define it? Dominique's age is 4 years less than twice brother's age b. Dominique is 12 years old. How old is her brother? Write an equation and solve using the replacement set of (6,7,8) pleaseeeeeee helpppppppppp Do a Hybrid CrossFill out the Punnett Square below for this story:Mary has blue eyes (bb) and David has brown eyes (Bb), if David and Mary have four children what will their eye color be? Will all their children have the same eye color? Why or why not.Child 1: Child 2:Child 3: Child 4: Thirteen more than three times a number is 25. What can you infer about the schools educational and social goals, based on Doves experiences? help would be appreciated ** if you could explain thatd be cool but if not thats ok Help me please Im begging u 3) What type of government did the Aztecs have? *A.One kingB. Prime MinisterC.PriestsD. Decentralized government made up of city states, each with their own kingsqueens what is 1256x - 14x + 16x simplified Use the restriction enzyme EcoRi to cut DNAVictim DNA :GGAAG ATTCTACATTACTGACGGACGTGACGTGACCTTCTTAA GATGTAATGACTGCCTGCACTGACTNumber of restriction fragments ( pieces of DNA after digestion) :Size of restriction fragments ( count the number of bases on the top strand of each fragment , listed from largest to smallest ) :Suspect 1 DNA :GGAATTAAGCTTATTG AATTCTTATAG AATTCGGGGCCCAAGCTTATG AATTCAATT CCTTAATTCGAATAACTTAA GAATATCTTAA GCCCCGGGTTCGAATACTTAA GTTAANumber of restriction fragments ( pieces of DNA after digestion) :Size of restriction fragments ( count the number of bases on the top strand of each fragment , listed from largest to smallest ) :Suspect 2 DNA :CCATATAG AATTCAAGCTTAAG AATTCGGGGGAACGTTG AATTCAATTAATTGGGGGTATATCTTAA GTTCGAATTCTTAA GCCCCCTTGCAACTTAA GTTAATTAACCCNumber of restriction fragments ( pieces of DNA after digestion) :Size of restriction fragments ( count the number of bases on the top strand of each fragment , listed from largest to smallest ) :PLEASE HELPPP!!!!I WOULD APPRECIATE A LOT :) list the difference between sdram and dram What is 2/5 divided 1/3 Kaden, Keith, and Kipp compete in a series of daily 3-way races. For each race, the probability that Kaden wins is 1/6, the probability that Keith wins is 1/2, and the probability that Kipp wins is 1/3. On a day that Kaden doesn't win, what is the probability that Keith beats Kipp? a file that serves as a starting point for a new document A dental hygienist is a health-care professional who works alongside a dentist to meet the oral health care needs of patients. Asked by one of her clients who needs to get a cavity filled what the average number of cavities a person gets filled by the time they are 50 years old, the hygienist responds that she will gather and determine not just the average, but also the median and the mode - because she would like to know this information herself. A bit of research turns up the following data table taken from a research project of a graduate student. The graduate student surveyed 20 people aged 50 from around Idaho.Patient ID# Cavities Filled1 12 83 74 95 116 127 78 59 210 011 812 913 714 615 816 917 818 919 820 8a. What is the mean (average) number of cavities a person gets filled by age 50?b. What is the median number of cavities a person gets filled by age 50?c. What is the most often an occurring number of cavities filled in this data set? Solve for n.(33)^2 = n^6 A biologist is recording the loss of fish in a pond. He notes the number of fish, f, in the pond on June 1. On July 1 there were 63 fish in the pond, which is 52 fewer fish than were in the pond on June 1. What is the number of fish in the pond on June 1?Which equation can be used to find the number of fish in the pond on June 1?63f=52f52=63f52=63f63=52 i need help!!!!!!!!!