Answer:
Explanation:As stated above, in adults the principal sites of red cell production, called erythropoiesis, are the marrow spaces of the vertebrae, ribs, breastbone, and pelvis.
HELP ME PLEASEEEE:(((
Answer:
C. Red
Explanation:
Red colour on the map shows the Mid Atlantic Ridge. The Mid-Atlantic Ridge is also called as a mid-ocean ridge. It is an underwater mountain system formed due to plate tectonics. It is created due to a divergent plate boundary that started from 87° N about 333 km to the south of the North Pole which is 54 °S, which is north of the coast of Antarctica. In the picture, the red colour is the line that shows Mid Atlantic Ridge.
Which of the following shows the stage of mitosis in the correct order?
Prophase, prometaphase, metaphase, anaphase, telophase, cytokinesis is the correct order of mitosis. Therefore, option (B) is correct.
Mitosis is a cellular process that ensures the accurate division of a cell's genetic material into two identical daughter cells. It consists of several distinct phases that occur in a specific order.
Interphase: The cell prepares for division by growing, duplicating its DNA, and synthesizing necessary proteins.
Prophase: Chromatin condenses into visible chromosomes, the nuclear membrane disintegrates, and spindle fibers form.
Metaphase: Chromosomes align at the center of the cell, known as the metaphase plate, and attach to spindle fibers at their centromeres.
Anaphase: Sister chromatids separate and are pulled to opposite ends of the cell by the spindle fibers.
Telophase: Chromosomes reach the opposite poles of the cell, and new nuclear membranes form around them. The chromosomes begin to decondense.
Cytokinesis: The cytoplasm divides, leading to the formation of two distinct daughter cells, each containing a complete set of chromosomes.
Learn more about mitosis, here:
https://brainly.com/question/31626745
#SPJ2
Why do animals that are active at night tend to have trouble seeing in color?
help pls *serious ppl only*
Blood type A person marries a blood type B person, both are heterozygous for the trait, what could their offspring be?
AB
B
A
O
all of the above
Answer:
All of the above
Explanation:
What prevents blood from circulating backward in veins?
A.valves
B. capillaries
C. lungs
D. heart
Answer:
A.Valves
Explanation:
The pulmonary vein empties oxygen-rich blood from the lungs into the left atrium. As the atrium contracts, blood flows from your left atrium into your left ventricle through the open mitral valve. When the ventricle is full, the mitral valve shuts. This prevents blood from flowing backward into the atrium while the ventricle contracts.
DNA is a
A. lipid
B. nucleic acid
C. carbohydrate
D. protein
Answer:
B
Explanation:
Answer:
B. nucleic acid
Explanation:
DNA is a type of Nucleic acid.
(a) Describe why DNA replication is said to be a semiconservative process. Explain how random mutations such as those in pathogens with a mutator phenotype may arise in the DNA of an organism.
Explanation:
yan po sana makatulong po
sainyo
Explain the difference in How the tree and the fox get carbohydrates to use for energy
Hey Hey!
Hmm... This seems to be a simple questions. Plants/trees actually make their own carbohydrates through photosynthesis. A fox simply eats food and that is their carbohydrate source. Please mark brianliest<3!
3) In order for an ecosystem to thrive, it needs to exist in a form of harmony and balance between its biotic and abiotic factors. Describe how small changes to both biotic and abiotic components can have major effects on an ecosystem.
Answer:
Changing temperature causes extinction or removal of organism from that place.
Explanation:
Small changes to both biotic and abiotic components can have major effects on an ecosystem because these are the factors on which the ecosystem depends. For example, if the temperature of the ecosystem increases from its limit, it makes the environment unfavourable for the organism so due to this change, the organism migrated to other location otherwise they will die due to unfavourable environment.
What is the microscopic nature of a cell ?
Why nucleus is said to be the controller of cellular activities ?
How is a cell adapted to its small size?
Answer:
No 1 answer They require sophiscated tools. The microscopes help in the study of cells. The molecular study of the cells are performed by the help of electron microscope. So, we can say that cells are microscopic in nature.
Explanation:
No 2 answer The nucleus is the largest and most prominent of a cell's organelles (Figure 3.7). The nucleus is generally considered the control center of the cell because it stores all of the genetic instructions for manufacturing proteins.
No 3 answer Smaller single-celled organisms have a high surface area to volume ratio, which allows them to rely on oxygen and material diffusing into the cell (and wastes diffusing out) in order to survive. The higher the surface area to volume ratio they have, the more effective this process can be.
2. The movement of tectonic plates and the cycling of Earth materials are
the direct result of which of the following *
Nuclear fisson
Solar radiation
Thermal convection
Magnetic attraction
Answer :
Thermal convection
Explanation :
The heat from radioactive processes within the planet's interior causes the plates to move, sometimes toward and sometimes away from each other.
Answer:
Thermal Convection
Explanation:
Just trust me, it was on my quiz for stemscopes.
NO LINKS PLEASE
Why are there always more producers than consumers in an ecosystem?
O A. Plants do not carry out enough photosynthesis to supply the needed oxygen to primary consumers.
O B. The Sun cannot supply enough energy to support many predators.
O C. Energy is lost in food chains so many secondary consumers cannot be supported.
OD. Many consumers would contribute too much carbon dioxide to the carbon cycle.
Answer:
energy is lost in the food chains so many secondary consumers cannot be supported
The arrows in a food chain show: a Who eats who b Heat energy being lost c The movement of energy between organisms d The route of food to the shops
Answer:
c The movement of energy between organisms
Explanation:
Pyramid of energy is a model used to depict the flow of energy from one trophic level or feeding level to the next in an ecosystem. It's a diagram that compares the energy used by organisms at each trophic level of the food chain. The pyramid of energy must never be inverted or turned upside down.
The units used in the construction of pyramids of energy is kilocalories (kcal) or energy per area per time (Jm-²year-¹).
This ultimately implies that, the arrows in a food chain show the movement of energy between organisms such as from producers which are autotrophs or self-feeders such as plants to the tertiary consumers.
Furthermore, a list of the types of organisms in an eco pyramid are;
I. Producers: these are autotrophs or self-feeders such as plants.
II. Primary consumers: these are herbivores that typically feed on plants such as a goat or deer.
III. Secondary consumers: these consists of carnivores that typically feed or eat flesh such as lion, tiger, cheetah, etc.
IV. Tertiary consumers: these are higher predators such as humans that aren't normally fed on by other organisms in the ecosystem.
Answer: The arrows in a food chain show (The movement of energy between organisms). The correct option is C.
Explanation:
In an ecosystem, a food chain shows the transfer of energy and nutrients ( food) from organisms to organisms in a feeding pathway. Instead of giving functional group names such as primary producer, primary consumer and so on, in a good chain, the organism at each step is identified. Thus,
Grass-------> Zebra ---------> lion
(Primary (Primary ( secondary
producer). consumer) consumer)
this is an example of a simple food chain in a grassland ecosystem. This ARROWS represented above shows the direction of energy flow through an ecosystem.
Furthermore, the grass traps solar energy and stores it as chemical energy in the food made during photosynthesis. When eaten by Zebra, which is the primary consumer, the energy stored in the grass is transferred to the consumer. This transfer is inefficient as some of the stored chemical energy is lost as heat. When the zebra is eaten by a Lion,which is the secondary consumer.
We don't know what the first life form was or how it came to be, but the process of reproduction with VARIATION over billions of years is responsible for the diversity of life on Earth today.
A. True
B. False
Answer:
A. True
Explanation:
Yeah, we don't know what the first life form was or how it came to be, but the process of reproduction with VARIATION over billions of years is responsible for the diversity of life on Earth today.
what happens to the energy that is not converted to usable energy in a muscle Cell?
Answer:
The process is called oxidative phosphorylation and it happens inside mitochondria. In the matrix of mitochondria the reactions known as the citric acid or Krebs cycle produce a chemical called NADH. NADH is then used by enzymes embedded in the mitochondrial inner membrane to generate adenosine triphosphate (ATP).
Explanation:
11. When cold temperatures are produced in a chemical reaction, the reaction is
known as
a. exothermic.
b. endothermic.
c. suspension
Answer:
it's known as endothermic reaction
A student combined equal amounts of two solutions one solution has a pH of 2 and the other has a pH of 12 which would most likely be the resulting pH? 1,3,6,11
Answer:
It would be 6
Explanation:
Because high hydrogen concentration plus high hydroxyl concentration forms a neutral solution.
The
store(s) more carbon than the atmosphere.
O rock
trees
oceans
Osoil
Answer:
Oceans
The oceans are a massive carbon sink, and part of the positive reinforcement of the greenhouse gas cycle is that, as the oceans become warmer, then tend to release more carbon dioxide dissolved in the water which in turn drives temperatures warmer.
The
store(s) more carbon than the atmosphere.
trees
soil
Oceans
rock
The oceans store more carbon than the atmosphere. Thus, the correct option is C.
What is Atmosphere?An atmosphere may be defined as an area that is surrounded by layers of gases across a planet or other celestial body.
The oceans are a gigantic carbon sink, and the domain of the positive authorization of the greenhouse gas cycle is that, as the oceans become warmer, they tend to discharge more carbon dioxide disbanded in the water.
Therefore, the correct option for this question is C.
To learn more about Oceans, refer to the link:
https://brainly.com/question/25154137
#SPJ1
which of these animals did NOT benefit from the reintroduction of wolves into Yellowstone?
a. rabbits
2. bears
3. elk
4. beavers
Does anyone know this?
Answer: The correct answer is zygote...blastocyst...embryo...fetus.
Explanation:
The zygote is the single cell that was the result of fertilization.
The blastocyst is the big ball of cells that was the result of differentiation and mitosis.
Then comes the embryo, and then finally, the fetus.
Good Luck <3
the tRNA for GUCAUCGAUCGAUCGGAUGCC
Answer:
CAGUAGCUGCUAGCCUACGG
Explanation:
A and U are opposites
C and G are opposites
so you would do the opposite that would correspond.
How does the skin regulate body temperature?
Group of answer choices
by increasing sweat production
by producing vitamin D
by retaining water
by regulating fat content in the epidermis
How does the skin regulate body temperature?
[tex]\circ \: \: { \underline{ \boxed{ \sf{ \color{green}{Answer.}}}}}∘[/tex]
A. by increasing sweat production. ✔
Explanation:-
The sweat glands present in the skin helps to cool the skin as it produces sweat.Sweat glands keeps the body temperature at approximately 37° C by releasing sweat in a hot environment or during physical exertion.[tex]\bold{ \green{ \star{ \orange{Mystique35}}}}⋆[/tex]
Will give a brainiest for the answer thanks :)
Why do many water animals not have a well developed blood system?
The simplest animals, such as the sponges (Porifera) and rotifers (Rotifera), do not need a circulatory system because diffusion allows adequate exchange of water, nutrients, and waste, as well as dissolved gases. Instead, gases, nutrients, and wastes are exchanged by diffusion.
Answer:
Explanation:
The simplest animals, such as the sponges (Porifera) and rotifers (Rotifera), do not need a circulatory system because diffusion allows adequate exchange of water, nutrients, and waste, as well as dissolved gases. ... Instead, gases, nutrients, and wastes are exchanged by diffusion.
A 9.0 is how many times more powerful than a
4.0 on the Richter scale?
Answer:
It increases 31.7 times between whole number
values.
Explanation:
"That is, the wave amplitude in a level 6 earthquake is 10 times greater than in a level 5 earthquake, and the amplitude increases 100 times between a level 7 earthquake and a level 9 earthquake."
Which of the following is definitely true about the kingdom, Protista.
A. They always have a cell wall
B. They always have a nucleus
C. They are always unicellular
D. They are always heterotrophs
Answer:
B. They always have a nucleus
Explanation:
The organisms belonging to kingdom Protista are single-celled- means they are unicellular and they have a well-defined nucleus enclosed in a nuclear membrane. Hence, they are eukaryotes. So the correct option is B.
Answer:
B. They always have a nucleus
Explanation:
Protista always has a nucleus. So, option (B) is the correct answer.
plant store _____ and other essential nutrients in the vacuole
Answer:
Plant store water and other essential nutrients in the vacuole.
Explanation:
Plant store water and other essential nutrients in the vacuole.
What is herbal medicine?
Herbal medicine is defined as the medicine which is acquired from the various parts of the plants such as flowers, roots, shoots, and leaves. Herbal medicine are costly in compare to normal medicine and because there production is limited and there will be no side effect of herbal medicine in compare to allopathic medicine.
The main difference between herbal medicine and allopathic medicine is that the allopathic medicine is formed from the active or particular part of the plant but in herbal medicine whole plant parts are utilised.Herbal medicine are costly in compare to normal medicine and because there production is limited and there will be no side effect of herbal medicine in compare to allopathic medicine.
Therefore,Plant store water and other essential nutrients in the vacuole.
Learn more about plant here:
https://brainly.com/question/22167412
#SPJ2
How long does it take the moon to rotate on its axis?
about 25.3 days
about 27.3 days
about 30 days
about 2 months
Answer:
27.3 days
Explanation:
The Moon takes 27.3 days to rotate on its axis as the Moon takes 29.5 days to revolve around the Earth. So, the correct option is B.
What is Rotation?Rotation is defined as the circular movement of an object around a central axis where a two-dimensional rotating object has only one possible central axis and can rotate in a clockwise or counterclockwise direction, while a three-dimensional object has an infinite number of possible centers that is axes and rotational directions.
The Moon orbits the Earth in the same direction, completing one orbit relative to the vernal equinox and the stars in about 27.32 days while one orbit relative to the Sun takes about 29.53 days.
Thus, the Moon takes 27.3 days to rotate on its axis. So, the correct option is B.
Learn more about Rotation, here:
https://brainly.com/question/15672596
#SPJ6
