NEED ANSWER FAST! %50 PTS
Explain how the feeling of loneliness acts as an aversive signal that evolved to warn humans they are facing a threat.

Answers

Answer 1

Answer:

i1k2o1k292k29


Related Questions

Most Americans today still get the majority of their information about government and politics from

Answers

Answer:

the amazing world of the internet

Which job is the most likely one to employ a plant breeder A working for company installing B working in a retail store C working for a genetic engineering firm D working as a landscape architect

Answers

c. working for a genetic engineering firm

types of village layouts

Answers

dispersed settlement
linear settlement
polyfocal settlement


i think this is what your asking

John owns three different auto repair shops. In 2016, Store A made a profit of $102,100, Store B made a profit of $200,500, and Store C made a profit of $187.500. In 2017, Store A made a profit of $105,400, Store B made a profit of $189,700, and store C made a profit of $162,400. Which matrix below represents the profit data for John's stores.

Answers

It would be store B I hope this helps

The matrix that represents the profit data for John's stores is [tex]\left[\begin{array}{cc}102,100&105,400&200,500&189,700&187,500 &162,400\end{array}\right][/tex]

How to determine the matrix?

The given parameters can be represented using the following table of values

                 2016                2017

Store A    $102,100            $105,400

Store B    $200,500          $189,700

Store C     $187,500           $162,400

Next, we represent the above the table using a matrix, where the data labels are omitted.

So, we have:

[tex]\left[\begin{array}{cc}102,100&105,400&200,500&189,700&187,500 &162,400\end{array}\right][/tex]

Hence, the matrix that represents the profit data for John's stores is [tex]\left[\begin{array}{cc}102,100&105,400&200,500&189,700&187,500 &162,400\end{array}\right][/tex]

Read more about matrix at:

https://brainly.com/question/94574

#SPJ9


help people with mental or emotional problems adjust to life.

Answers

It’s Clinical Psycology

Answer:

The answer is a clinical psychologist.  

Explanation:

Clinical psychologists assess, diagnose and treat individuals experiencing psychological distress and mental illness. They also perform psychotherapy and develop treatment plans.

Clinical psychologists often work in hospitals, mental health clinics, and private practice. They are trained in a variety of treatment techniques but may specialize in treating certain disorders or working with certain populations. For example, a clinical psychologist might specialize in an area such as substance abuse treatment, child mental health, adult mental health, or geriatric mental health.

While clinical psychologists often work in medical settings, they are not physicians and in most cases cannot prescribe medications.

guys i need help with my math plzz whats the anserw and stop delting i need help with my math homework !!!!
Which expression is equivalent to -15.2-64.1−15.2−64.1?
A.−64.1−(−15.2)
B.−64.1+15.2
C.15.2+(−64.1)
D.−15.2+(−64.1)

plz anserw this!!!

Answers

Answer:

gdrh

fbbchfhfhfhfhfhhf

Selects a strong reason to support argument. Identifies multiple, logical pieces of evidence that support reason. Evidence includes at least one fact, one statistic, and one quote from an expert. Explanations of evidence clearly support reason. Uses a wide variety of credible sources including GVMS databases. please include: Evidence Type of Evidence Source Explanation Prove it! Cut and paste examples from the text here.  Quote from an expert  Fact  Statistic  Anecdote Where did you find this evidence? Include title of article, the place it originated, and the date it was published. Ex: “Russia: Friend, Enemy, or Frenemy?” UpFront Magazine, April 2017 So what? How does this piece of evidence prove your reason is valid/true? Use bullet points. and the class is communications

Answers

i’ll let u know as soon as i get the answer!! i did some work like this i think i can figure it out

Does anybody know the Correct answer to this i'm marking brainliest !! I can't find the subject but this question is from music class .

Answers

Answer:

4)Leap

Explanation:

All of the following are examples of post secondary education except

Answers

Answer:

I don't see any options but military is the correct

Explanation:

Postsecondary options are varied and may include public or private universities, colleges, community colleges, career/technical schools, vocational/trade schools, centers for continuing education, campus transition programs, and apprenticeship programs.

Directions: Identify the different imaginary lines of the globe. Write the letter that
corresponds your answer.
с C
E
1. Equator
2. Latitudes
B
F
3. Longitudes
4. Prime Meridian
LA
5. South Pole
6. North Pole​

Answers

Answer:

The answer is below

Explanation:

1) Equator: The equator is an imaginary line that divides the earth into two equal parts known as the northern hemisphere and southern hemisphere. The equator is a line of latitude.

Line A is the equator

2) Latitude: Latitude are imaginary lines on earth that run from the east to west.

Line B are lines of latitude

3) Longitude: Longitude are imaginary lines on earth that run from the north to south.

Line F is a line of longitude

4) Prime Meridian: The prime meridian is a 0° line of longitude. It serves as a reference for other lines of longitude measurement.

Line E is a prime meridian.

5) South pole: The south pole is at a latitude of 90°S and all the lines of longitude meet there.

Point D is the south pole

6) North pole: The north pole is at a latitude of 90°N and all the lines of longitude meet there.

Point C is the south pole

Why do minor parties have a difficult time succeeding in the political system?

Answers

Answer:

because we have a "first past the post" system

Explanation:

proportional representation would see minor parties better represented in parliament

An example of redlining is a
banker who refuses to loan money for properties in certain sections of a city.
developer who refuses to build in certain sections of a city.
city that refuses to provide services in certain sections of its downtown.
landlord who refuses to maintain property in certain sections of a city.
O police department that refuses to protect certain sections of a city.

Answers

Answer:

Explanation:

The answer choices are:

O banker who refuses to loan money for properties in certain sections of a city.

O developer who refuses to build in certain sections of a city.

O city that refuses to provide services in certain sections of its downtown.

O landlord who refuses to maintain property in certain sections of a city.

O police department that refuses to protect certain sections of a city.

Redlining refers to a banking practice of not offering loan to houses in a certain neighborhood; usually with minorities or low-income residents.  So the answer is: An example of redlining is a  banker who refuses to loan money for properties in certain sections of a city.

Answer:

Explanation:

An example of redlining is a

O banker who refuses to loan money for properties in certain sections of a city.

What are some fun memorization methods? Ones that aren’t boring like flashcards or repeating a word over and over at your desk please haha

Answers

Answer:

play match on quizlet with the words or gravity I think it's called

Which of the following describes a common role played by plants in the carbon cycle? (5 points) Dissolve and store carbon for long periods of time Take carbon from the atmosphere to use to make food Release carbon into the atmosphere through respiration Break down carbon stored in rocks through the process of weathering

Answers

Answer: Release carbon into the atmosphere through respiration

Explanation:

The carbon cycle is the process through which carbon travel from the atmosphere to the Earth and vice versa Carbon can be released into the atmosphere when fossils fuels are burned, organisms die, fire blaze etc.

Respiration produces energy for organisms through the combination of glucose with the oxygen that's gotten from the air. It should be noted that the glucose and the oxygen will then be changed back into energy and carbon dioxide during respiration. In this case, carbon dioxide will then be released into the atmosphere during cellular respiration

Answer:

Take carbon from the atmosphere to use to make food.

Explanation:

The common role plants play is called photosynthesis, taking carbon from the atmosphere to use to make food is the definition of photosynthesis. Plus I got it right o the test!  

ANSWER QUICK!! 50 PTS!!
Describe the four theories of emotion discussed in the text and provide an example for each. Which do you agree with the most and which the least? Explain your answer.

Answers

Answer:

The major theories of emotion can be grouped into three main categories: physiological, neurological, and cognitive. Physiological theories suggest that responses within the body are responsible for emotions. Neurological theories propose that activity within the brain leads to emotional responses

please mark me as brainliest

According to the four theory in the emotions are the based on the physiological, cognitive, James-Lange theory and the neurological.

What is emotions?

The term emotion refers to the human and the animals are to react on the situation. The emotions where the connected to the people are in the reacted as the fear, anxiety, and the happiness. there was the emotional person are the attached on the particular things and the another person.

There are three broad groups of emotion theories: physiological, neurological, and cognitive. According to physiological theories, feelings are caused by responses within the organism. According to neurological theories, brain activity results in emotional reactions. According to cognitive theories, thinking and other mental activities play an important part in the formation of emotions.

As a result, the theories of the emotions are the aforementioned.

Learn more about on emotions, here:

https://brainly.com/question/28464758

#SPJ2

Other Questions
Please help! I dont understand how to solve it with no angle Qu funcin cumple la poltica en los conflictos sociales Say you had the following DNA sequence: ATGCTGCGAAACTTTGGCTGA Let's say there was a mutation that removed one letter (the first C): ATGCTGCGAAACTTTGGCTGA Provide the 6 DNA codons that would be read following the mutation. Are they the same as the original 6 DNA codons that would have been read 1.Name the canan that connects the Red sea to the Mediterranean Sea2.Name the country where coffee was discovered3.Name the system of racial segregation seen in South Africa4What is the term given to the peninsula that forms the easternmost projection of the African continent5Name the precious gem that is the major natural resource of Africa6Name the Savannah region that is the site of the largest mammal migration on Earth A digital signal differs from an analog signal because it a.consists of a current that changes smoothly. b. consists of a current that changes in pulses. c.carries information. d. is used in electronic devices. Write an equation for the line that is parallel to the given line and that passes through the given point. y = 1/2x - 8; (-6, -17). Find the equation of the line that passes through the points A (2, 3) and B (5, -7) how did advancements in technologry help bring a quick end to conflict in the pacific during world war II My School in vanacola In what way was the Third Reich most successful?Strikes only occasionally affected production of goods.Factories and the infrastructure were expanded.The media enthusiastically supported the work of the ruling party.The workplace was open to many individuals. Consider the functionsf(x) = xn and g(x) = xmon the interval [0, 1], where m and n are positive integers and n > m. Find the centroid of the region bounded by f and g. Write 8 as a percentage of 32Plssss helppp Uma mquina trmica ideal opera recebe 450 J de uma fonte de calor e liberta 300J no ambiente. Uma segunda mquina trmica ideal opera recebendo 600J e libertando 450J. Se dividirmos o rendimento da segunda mquina pelo rendimento da primeira mquina, obteremos: A senator introduces a bill by taking it to the president pro tempore, the majority leader, and the minority leader.TrueFalse****If a bill cannot be voted on due to the lack of members present, it is unlikely that the bill will make it to the House floor.True***False Who was Titian most inspired by? 27:28A leader of the Montgomery Bus Boycott who also became the spokesperson for nonviolent protest by AfricanAmericans wasElla Baker.O James Farmer.O Rev. Ralph Abernathy.O Martin Luther King Jr.SubmitSave and ExitMark this and retumContentViewers/AssessmentViewer/Activity Which equation gives the volume of the sphere?O V=2/3(27)O V=4/3(27)O V= 2/3 (27)O V= 4/3 (27) por qu se termina el bombardeo de Hiroshima y nagasaki Explain how the slow recovery of the bald eagle population likely affected the recovery of the salmon population I just wanna kno how yo day goin n who ur top 3 fav rappers