Objective source definition

Answers

Answer 1

Answer:

existing independently of perception or an individual's conceptions

Explanation:


Related Questions

What is a short-term benefit for a company to regularly keeping wages low?
Employees find high job satisfaction.
Companies can expect a high turn-over.
Employees will become demoralized.
The company can keep costs to a minimum.

Answers

Answer:

The company can keep costs to a minimum.

Explanation:

This is the advantage that such a strategy would have for a company in the short-term. A company that regularly keeps wages low is likely to save money initially. However, this strategy is not a successful one in the long term. Such a company would most likely have employees who are unhappy or unsatisfied with their job. It would also lead to a high turn-over due to employees being demoralized.

RL9-10.4 Which of the following is an example of Figurative language

Answers

Answer: D

Explanation:

When the end rhyme changes, the line is given a new

Answers

Answer:

When the end rhyme changes, the line is given a new  scheme.

Explanation:

A rhyme scheme is a specific form of metric notation that describes the sequence of rhymes in an abstract form, that is, the sequence and type of correspondence in a stanza or poem.

Thus, if in a poem the sentences end in a certain letter or group of letters, the sound of which is pronounced in a similar way generating a rhyme, that set of sentences is part of the same rhyme scheme. By cutting that rhyme, and changing the ending letter or letters to follow this pattern, the rhyming scheme is being changed for a new one.

help please ASAP , giving BRAINLIEST

Answers

Answer:

A. it appears he didn't know the full story

Explanation:

its right

Please here is my questions

Find out the Adjective Phrases and replace them by suitable Adjectives in the following sentences:
1. A woman in financial difficulties requested me to help her.
2. Mr. Dayo is a teacher of great reputation.
3. Birds in cages always want to fly.
4. A person without money or friends is seldom respected.
5. A friend in need is a friend indeed.
6. A bird in the hand is worth two in the bush.
7. S stitch in time saves nine.
8. She is a girl of great beauty.
9. Please tell me a story of adventures.
10. The girl with blue eyes is my cousin

Answers

Answer:

1.A penniless woman requested me to help her

2.Mr Dayo is a distinguished teacher

3.Caged birds always want to fly

4..A bankrupt or lonely person is seldom respected

5.A helping friend is a true friend

6.An available bird is worth two unavailable ones

7.A timely stitch saves nine

8.She is an elegant girl

9.Please tell  me an adventurous story

10.The blue-eyed girl is my cousin

Explanation:

An example,in the first sentence ,the adjective phrase was in financial difficulties,which I replaced with penniless and since the adjective cannot come after the woman I had to place it before woman.

In the second sentence,of great reputation was the adjective phrase,which I replaced with the adjective distinguished.

In the last sentence,with blue eyes was the adjective phrase,which I replaced with the adjective blue-eyed

How is the excerpt an example of irony? Harrison

Answers

Answer:

A. Handicapping intelligence contradicts expectations because intelligence is normally considered a positive attribute.

Explanation:

According to a different source, this question refers to the following passage of "Harrison Bergeron":

"And George, while his intelligence was way above normal, had a little mental handicap radio in his ear. He was required by law to wear it at all times. It was tuned to a government transmitter. Every twenty seconds or so, the transmitter would send out some sharp noise to keep people like George from taking unfair advantage of their brains."

A. Handicapping intelligence contradicts expectations because intelligence is normally considered a positive attribute.

B. Handicapping intelligence is pointless because determining whether one’s intelligence is above normal is a matter of opinion.

C. If George were really that intelligent, he would remove the device from his ear.

D. The mental handicap radio is incapable of correcting physical advantages.

Irony is a literary device in which the outcome of the story is the opposite from what the reader would normally expect. In this case, the reader would normally assume that the government would consider intelligence to be a positive quality. Moreover, we would assume that the government would not want to interfere with it. However, in this society, the government wants people to be less intelligent, and goes to great lengths in order to achieve it.



It was my twelfth birthday. Thanks to my over-active imagination, I had convinced myself that my mom was going to get me a new skateboard. I could not contain my excitement. I really needed a new skateboard, and not because I was bored with my old one. My old skateboard was falling apart.

Upon waking up, I ran straight to my mom and asked her to give me my gift. She responded by telling me that I would have to wait until after I got home from school. She went on to say that if she told me what the gift was I would not be able to concentrate on my school work. Those words ensured that I would be so excited about getting my new skateboard that I would be unable to work.

After a whole day of counting down the minutes, I arrived home from school. My mom was nowhere to be found. I called her office but did not get an answer. She did not answer her cell phone either.

Just as my frustration was peaking, my mom pulled into the driveway. She stepped out of the car, asking, "Why are you looking at me like that?"

I excitedly blurted out, "You said I would get my present after school, and it is officially "after school.'"

"Oh, is that all? I assumed that you missed your dear mother," she teased. I later regretted my response. "No, that's not all! It's everything!" When I asked her where my gift was, she pointed at the J.C. Penney bag she held.

She told me, "It's a new suit for you to wear to church."

I muttered in disbelief, "But you said that if you told me about the gift, I would be thinking about it all day long."

My mom responded, "I didn't say you would be thinking about it because it's a great gift."



Questions


Which detail is important and should be included in a summary of this passage?


A.

After a whole day of counting down the minutes, I arrived home from school.


B.

I really needed a new skateboard, and not because I was bored with my old one.


C.

"You said I would get my present after school, and it is officially 'after school.'"


D.

She responded by telling me that I would have to wait until after I got home from school.

Answers

Answer:

B. I really needed a new skateboard, and not because I was bored with my old one.

This is the sentence that you would most likely include in a summary of the story, and it is the most important. For most of the story, the twelve-year-old thinks about a new skateboard, so that's an important detail to include. xD

If you need anything else, I can help.

Answer:

She responded by telling me that I would have to wait until after I got home from school.

Explanation:

Draw a conclusion.
8. The reading suggests that paintings
gain value after the artist dies. Does
Congo's story support that idea? Why
or why not?

Answers

Answer:

it does support that idea

Explanation:

because Congo had created about 400 artworks and art dealers were sure to be looking for more Congos originals!

CORRECT ANSWER GETS MARKED BRAINLIEST!


Read the excerpts from Team Moon and the NASA article.


But now, because the landing was taking far longer than planned, the fuel was almost gone. Mission Control wanted Neil to take as much time as he needed and fly the LM as near empty as possible only because they wanted him to make the landing. But if he ran out of fuel above the surface, in all likelihood the LM would crash onto the moon.



When it comes time to set Eagle down in the Sea of Tranquility, Armstrong improvises, manually piloting the ship past an area littered with boulders. During the final seconds of descent, Eagle's computer is sounding alarms.


A reader can best combine the information in the excerpts to


A. understand that Neil Armstrong had to improvise the landing of the LM, named Eagle, while it was dangerously low on fuel.

B. understand that Neil Armstrong was not in control of the LM, named Eagle, while it was being landed on the moon.

C. understand that Neil Armstrong would crash the LM, named Eagle, if he ran out of fuel above the moon’s surface.

D. understand that Neil Armstrong had to pilot the LM, named Eagle, past an area on the moon littered with boulders.

Answers

Answer:

A

Explanation:

i highlighted important information and saw a few similarities

Answer:  A

Explanation:

10.A theme is a melody associated with
(1 Point)
a TV show or film
a lullaby
a nursery rhyme
a dance
11.In much of Europe, Jewish people were forced to live in ghettos. In this sentence, ghettos means
(1 Point)
certain sections of cities.
high-rise apartment buildings
farms
tents
12.Find a synonym for acclaimed
(1 Point)
described
praised
divided
explained
13.Find a synonym for covet
(1 Point)
steal
regret
envy
adminre
14.Find a synonym for formidable
(1 Point)
experienced
intelligent
intimidaing
competent
15.Find a synonym for momentous
(1 Point)
occasional
momentary
significant
lighthearted
16.Find a synonym for oppressive
(1 Point)
intense
sweltering
harsh
emotional
17.Find a synonym for overwhelmed
(1 Point)
discovered
shouted
assisted
defeated
18.Find a synonym for perceived
(1 Point)
persuaded
sensed
excused
recieved
19.Find a synonym for premiere
(1 Point)
debut
director
success
theather
20.Find a synonym for themeImmersive Reader
(1 Point)
poem
essay
story
novel
Answer all for 32 points

Answers

10: a TV show or film
11: certain sections of cities
12: praised
13: envy
14: intimidating
15: significant
16: harsh
17: defeated
18: sensed
19: debut
20: I didn’t understand the question with the typo??

Which is a strategy that you can use to find the subject of a sentence? A. Cross out all prepositional phrases. B. Turn the sentence into a question. C. Read the sentence out loud. D. none of the above

Answers

Answer:

the answer is D. none of the above

Explanation:

The Answer is D just took the quiz

The battle of boys boasting their supreme strength raged on.
This is an example of which literary device?
A) allusion B) alliteration C) hyperbole D) anapho

Answers

Answer: B alliteration

Explanation:

Because alliteration is the repetition of the same first letter of words like battle boys boasting

Read this excerpt from "The Big Shot." In her most recent test, she asked golfers who had just finished playing to find on a chart a black circle that was the same size as a cup on the green. She says, "What we found was that the golfers who scored better selected larger circles," adding that this suggests "that they perceive the hole as bigger." Golfers who didn't score as well chose smaller circles. Which type of image would best help readers understand the study being described and its conclusion? a photograph of a golf course with a bar graph over it showing the numbers of players who chose each black circle and the average scores of each group a drawing of the study’s black circles, each labeled with the number of players who chose it, and the average score of that group of players a photograph of a golf ball and the black circles on the chart, each labeled with its size, next to a dot plot showing each player’s score and chosen circle a drawing of a golf ball and a chart with different size black circles, each labeled with the number of players that chose it and the size of the circle

Answers

Option (c) or (iii) is the type of illustration that will best help readers grasp the study being discussed and its conclusion.

Which image describes the conclusion of the Big Shot?

A snapshot of a golf ball and the black circles on the chart, each labeled with its size, adjacent to a dot plot indicating each player's score and chosen circle would be the ideal form of visual to help readers understand the study being discussed and its conclusion.

To learn more about "The big shot", refer below

https://brainly.com/question/3473452

Answer: Its C I got it right on my unit test

Explanation: C

what is a term for a news story told without opinion or bias

Answers

Answer:

i think it is objective

Explanation:

objective definition from google: (of a person or their judgment) not influenced by personal feelings or opinions in considering and representing facts.

If the student age variance is 3, what is the standard deviation?

Answers

Answer:9

Explanation:3*3

Which of the following statements is false?
a.
John Drew Barrymore was born 11 years after his older sister, Diana.
b.
Ethel Barrymore, born in 1878, was Maurice Barrymore’s only daughter.
c.
Drew Barrymore was born exactly 100 years after her great-grandfather, Maurice, immigrated to America.
d.
Lionel Barrymore, born in 1878, was Maurice Barrymore’s son.



Please select the best answer from the choices provided


A
B
C
D

Answers

The correct answer is C. Drew Barrymore was born exactly 100 years after her great-grandfather, Maurice, immigrated to America.

Explanation:

The Barrymore family is an important family in the field of acting, which includes famous actors such as John Drew Barrymore, Diana Blanche Barrymore, and Drew Barrymore. In the case of Drew Barrymore, she is one of the youngest actresses of this family and was born on 1975. Besides this, Drew Barrymore is the daughter of John Drew Barrymore who was born in 1932, the granddaughter of John Barrymore who was born in 1882 and the great-granddaughter of Maurice Barrymore who was born in 1849 and migrated to the United States in 1874. This means Drew Barrymore was born 101 years after her great-grandfather Maurice immigrated to America, and therefore it is false she was born exactly 100 years after this event.

Answer:

C.) Drew Barrymore was born exactly 100 years after her great-grandfather, Maurice, immigrated to America.

Explanation:

A diagram is a different from an illustration because:
a. a diagram adds information to the text.
b. a diagram is a visual text feature
c. a diagram is separate from the text.
d. a diagram has parts that are labeled​

Answers

Answer:

A diagram is a different from an illustration because:

A diagram is a visual text feature

hope it helps!

Answer:

B.    Its true.

Explanation:

:)

What relationship do these words have?

statement/question

synonyms
antonyms

Answers

Question: asks something
Statement: normally is the answer to a question
Synonyms: words that mean the same
Antonyms: words that mean the opposite

Answer:

Antonyms

Explanation:

quickly please be correct , thank you so much.

Answers

Answer:

D. He doesn't recognize their authority.

Explanation:

If Tecumseh recognized the white men's authority over his land, then he would not have this response, so A is not correct. B is also not correct because he does express his sentiments toward the situation. And C is definitely not correct because he would not be telling the men that they can return to their own country if he thought their authority over the situation was 'great'.

D.


He did not recognize their authority or what they had to say. In the quotation he says that the white man can return to his own country.

Which sentence uses an intensive pronoun? A) Everyone wanted to see the show together. B) The president himself appeared at the rally. C) Dad said that he would fix the car after lunch. D) They ate all the cookies left over from the party.

Answers

Answer:

b- The president himself appeared at the rally.

Explanation:

intensive pronouns ex;

himself, ourselves, herself, etc.

Answer:

B

Explanation:

Paragraph 17: Doctor Dace,
who could never be counted
on to behave like a father in a
book, shrugged his shoulders
impatiently

Answers

Answer: A



Explanation: Because that paragraph was a bout truth

Which of the following best describes how the narrator describes nature, especially the cold?AThe narrator describes the cold as a pervasive, almost personified force.BThe narrator describes nature constantly changing and unpredictable.CThe narrator describes nature, even the dog, as indifferent to the struggles of the man.DThe narrator describes the cold as merely an element that can be easily conquered by men and fire.

Answers

This question is in reference to the short story "To Build a Fire", by Jack London.

Answer:

The options best suited for the way the narrator describes nature and the cold is:

C. The narrator describes nature, even the dog, as indifferent to the struggles of the man.

Explanation:

"To Build a Fire" is a short story by author Jack London in which a man learns a most valuable lesson at a very high cost. The main character ignores how powerful nature is, thinking too much of his own skills. He is new to the winter at the Yukon region and naive enough to forget his own weaknesses as a human being.

The narrator in the story makes it clear that nature is not concerned with man. Nature has no mind, it simply is, in a powerful manner. It is man who wishes to conquer nature but to no avail. Throughout the story, the man thinks to himself that "it is certainly cold". That's it. Simply put, no exaggeration, no personification.

The dog that accompanies the man, for instance, is merely confused by the man's lack of fear. The dog understands danger better than the man. Notice that it is indifferent toward this man. What concerns it is survival. The same goes for nature. It is relentless, unstoppable. The cold is still cold, even if it kills someone:

Never in the dog’s experience had it known a man  to sit like that in the snow and make no fire. As the evening grew  darker, its eager longing for the fire mastered it. [...] Later, the dog howled loudly. And  still later it moved close to the man and caught the smell of death.  This made the animal back away. A little longer it delayed, howling  under the stars that leaped and danced and shone brightly in the cold  sky. Then it turned and ran along the trail toward the camp it knew,  where there were the other food providers and fire providers.

Which theme is common to the two excerpts

Answers

The answer will be answered if there’s more info, Sorry

I need help with this exercise! Please

Answers

Answer:

A. home sick

B. high

C. high level

Explanation:

For A, another term that could go in for missing your home is home sick, which exist as two separate words that can be combined. Myopic is high which exists in the box. Best can be replaced by high level. Hope this helps.

- What was the likely reason for Anna to be in Yalta?

Answers

Answer:

well we need the text or answer choices... if there are any

Explanation:

The Finland woman refuses to give Gerda something to help
her save Kay because she knows that
there is no way for Kay to be saved.
Gerda's strength comes from within herself.
the reindeer has to share his powers with Gerda.
the Snow-queen must take away the glass splinters from
Kay.

Answers

Answer:There is no way to save Kay.

Explanation:

Just did it :) <3

Answer:

A

Explanation:

Brainliest

which of the following statements about taking notes is not true?

Answers

Answer:

Not enough content

Explanation:

What are some synonyms for job ? ‍♀️

Answers

Answer:

Activity

Task

Business

Profession

Explanation:

Which word in the poem “I Wandered Lonely as a Cloud” by William Wordsworth most clearly represents its subject?

Answers

The question appears to asking about what represents the poem's subject.

First, we can imply what our general topic by the thesis. The thesis is usually the first sentence in a story, and is restated in the conclusion.

The first sentence is "I wandered lonely as a cloud." and the rest of the story details the poem's thesis.

This is clearly highlighting the cloud as the subject.

Your answer is A.) Cloud.

I hope this helps!

Answer:

cloud was incorrect :/

The answer is daffodils!

Explanation:

The stars and the waves compares to the daffodils

The best form of a verb is also known as the

A. Past tense
B. Future tense
C. Present tense
D. Past participle

Answers

Answer:hmmm

Explanation:

Answer. C

Explanation:

Other Questions
EquationsWhat is the solution of the system of linear equations?-3x + 4y = -182x - y = 7(-2,-3)(-2,3)(2, -3)(2, 3) what is the area of the circle when the radius is 5 How does the narrator repeating My favorite at the beginning of every paragraph contribute to the story? (My favorite things by joy cowley) If 14 moles of Oxygen burn how many moles of water are created? *2C2H6+7024CO2 + 6 H2OA) 12 mol H20B) 3.5 mol H20C) 3 mol H20D) 42 mol H20 2x +6 = 8xwhat are the values of x here? can anybody give me some options and some tips for my portfolio poem. for school. free verse poem. Take 2 y2 - 3 y - 5 from y3 - 6 y2 + 5 y . Select the correct answer.A) y3 - 2 y2 + 3 y + 5B) y3 - 4 y2 + 2 y - 5C) y3 - 4 y2 + 2 y + 5D) y3 - 8 y2 + 8 y + 5 How many Liters are in 17.3 moles of Iron? What is the volume of a rectangular prism with a length of 2 inches, a width of an inch & is a quarter of an inch in height? Please help ASAP will mark brainliest Dextra Computing sells merchandise for $15,000 cash on September 30 (cost of merchandise is $12,000). The sales tax law requires Dextra to collect 5% sales tax on every dollar of merchandise sold. Record the entry for the $15,000 sale and its applicable sales tax. Also record the entry that shows the payment of the 5% tax on this sale to the state government on October 15. View transaction list Journal entry worksheet Record the cost of September 30th sales. Note: Enter debits before credits Date General Journal Debit Credit Sep 30 Record entry Clear entry View general journal Is the below sequence DNA or RNA? How do you know?GTTTACAGGCGGCGCAATATCTGATCG John and Ellen bought a big pizza. Ellen ate 2/4 of the pizza and John ate 1/3 of the pizza. How much did they eat all together? How much was left over? (Hint: 12 is the Lowest Common Denominator).(1/4 was wrong plss helppp) The following linear programming problem has been written to plan the production of two products. The company wants to maximize its profits. LaTeX: X_1=X 1 = number of product 1 produced in each batch LaTeX: X_2=X 2 = number of product 2 produced in each batch MAX: LaTeX: 150\:X_1+250\:X_2150 X 1 + 250 X 2 Subject to: LaTeX: 2\:X_1+5\:X_2\le2002 X 1 + 5 X 2 200 LaTeX: 3\:X_1+7\:X_2\le1753 X 1 + 7 X 2 175 LaTeX: X_1,\:X_2\ge0X 1 , X 2 0 How much profit is earned per each unit of product 2 produced? Can someone plz help plz brainliest & points!i need help with math asap, show work too if possible :) Identify the vertex of the function graphed below.A. (1,2)B. (2,-1)C. (3,-2)D. (0,7) Poems are often ambiguous because _____. Which statement best describes the impact of the dust bowl?A. consumers brought more Texas crops when Kansas crops were destroyed B. Farmers on the Great Plains could not grow crops and many left for California C. Farmers increased their use of groundwater to irrigate their crops D. Workers migrated from the cities to the countryside to help grow food If sales tax is 10 percent, and a new palr of sneakers costs$70, how much do you actually have to pay?