Answer:
substitution mutation
Explanation:
The original DNA sequence is: TACTTTAATCCCAAATTTACT
The mutated DNA sequence is: TACTTTAATCCCAAGTTTACT
The mRNA transcribed from the mutated DNA sequence is: AUGAAAUUAGGGUUAAUUAGA
The amino acid sequence encoded by the mRNA is: Met-Lys-Ser-Trp-Lys-Lys-Ser
This is an example of a substitution mutation, in which a single nucleotide in the DNA sequence is changed. In this case, the original DNA sequence contains the nucleotide A at position 13, while the mutated sequence contains the nucleotide G at the same position. This change causes a different mRNA sequence to be transcribed and a different amino acid to be encoded. Substitution mutations can have a variety of effects on gene function, depending on the location and nature of the mutation. Some substitution mutations may have no effect, while others may cause the protein encoded by the gene to function improperly or not at all.
Select the correct answer from each drop-down menu. the planets that reside in the region of the solar system are jupiter, , uranus, and neptune. although these planets are made up of lighter elements, they have a solid core. the atmosphere of all these planets is made up of hydrogen and . in addition to these two elements, the planets neptune and contain methane.
The correct answer from the drop-down menu is (a) the planets that reside in the region of the solar system are Jupiter, Uranus, and Neptune.
Jupiter, Saturn, Uranus, and Neptune are the planets that are found in the solar system's outermost zone. They have a strong core despite the lighter components that make up these planets. Hydrogen and helium make up the planets' atmospheres in all cases. The planets Neptune and Uranus also have methane in them in addition to these two elements.
Uranus and Neptune share a lot in common. It has a solid center the size of Earth covered in a dense fog of water, ammonia, and methane. Hydrogen and helium, together with a small amount of methane, make up the majority of these elements' atmospheres.
The methane in Uranus' upper atmosphere absorbs the Sun's red light while reflecting its blue light back into space.
Learn more about the solar system here:
https://brainly.com/question/11724785
#SPJ4
The planets that reside in the outer region of the solar system are Jupiter, Saturn, Uranus, and Neptune. Although these planets are made up of lighter elements, they have a solid core. The atmosphere of all these planets is made up of hydrogen and helium. In addition to these two elements, the planets Neptune and Jupiter contain methane.
ヾ(•ω•`)o
Krebs, digestive and respiratory system 40 points!!!!!
One molecule of glucose and two molecules of ATP are the reactants of glycolysis, the first stage of cellular respiration (adenosine triphosphate). The energy needed for the reaction to happen is provided by the ATP molecules.
What particular byproducts result from the process of glycolysis?Pyruvate is the end product of glycolysis under aerobic conditions, and lactate under anaerobic conditions. In order to create more energy, pyruvate enters the Krebs cycle.
What is the name of the glycolysis process?Glycolysis is the initial phase of cellular respiration, which occurs in all living things. During aerobic respiration, glycolysis is followed by the Krebs cycle. As fermentation comes after glycolysis, a small quantity of ATP is created by the cells in the absence of oxygen.
To know more about glycolysis visit:-
https://brainly.com/question/14076989
#SPJ1
A food worker has just rinsed a dish after cleaning it.
What should he do next?
a. Scrub the dish
b. Air-dry the dish
c. Sanitize the dish
d. Put soap on the dish
Answer:
C. Sanitize the dish
Explanation:
Sanitizing the dish helps to kill any remaining bacteria or other pathogens that may be present on the dish, which can help to prevent food-borne illness.
how would a trade-off between dispersal ability and competitive ability affect which types of species could colonize small versus large gaps in a community?
Species having high dispersal ability and low competitive ability are able to colonize large gaps in a community.
Colonization, or colonization, constitutes big-scale population movements wherein migrants hold sturdy links with their, or their ancestors, former u. s. a . – by such links, benefit advantage over different inhabitants of the territory.
It occurs whilst one state subjugates some other, conquering its population and exploiting it, regularly at the same time as forcing its own language and cultural values upon its humans.
The 8 powers or international locations maintain and control their sixty-one colonies. The nations nonetheless have colonies in Australia, Denmark, Netherlands, and New Zealand.
Learn more about Colonize here:-brainly.com/question/18365734
#SPJ4
a chemical called endogenous pyrogens may be released from lymphocytes that are responding to a pathogen. what does this compound cause? multiple choice fever activation of nk cells antibody production inflammation
This compound causes fever. Option A.
The main function of the thymus is to train specialized white blood cells called T lymphocytes or T cells. White blood cells migrate from the bone marrow to the thymus. Lymphocytes mature and become specialized T cells in the thymus and are bound by specific antibodies that the immune system produces against them.
Lymphatic occlusion is the blockage of lymphatic vessels that drain fluid from tissues throughout the body and allow immune cells to reach where they are needed. Blockage of lymphatic vessels can cause lymphedema, which is swelling due to blockage of the lymphatic system. Antigens are foreign substances that can provoke an immune response in the body.
Learn more about Endogenous pyrogens here:- https://brainly.com/question/13051710
#SPJ4
Periodic Table Coloring Activity-15 pts
5) If two atoms are in the same group they will have_ properties. If two atoms are in the
same period, they will have
properties.
6) As you go from right to left, metallic properties_
nonmetallic properties,
and
properties.
As you go left to right,
7) Metalloids contain both
8) The periodic table is arranged by increasing
9) In 1869, Dmitri Mendeleev arranged the periodic table by increasing
10) To become stable, atoms want to have a full
decreases
What is it referred to as when two atoms are identical?
Carbon monoxide (CO), which consists of a single carbon atom and a single oxygen atom, is an illustration of a diatomic molecule. It is known as a homonuclear diatomic molecule if the two atoms are from the same element, such as oxygen (O2) and nitrogen (N2).
As we move up the periodic table, fewer shells are present, making it more challenging for an atom to lose electrons.
Because of this, the metallic character gets weaker as you move up a group. As a result, choice three is right.
In a periodic table, the tendency to gain electrons decreases as we move from left to right. The metallic character fades over a period of time as it moves from left to right.
It is the periodic chart that
Learn about Periodic table
Visit:
https://brainly.com/question/7373020
#SPJ1
The amount of plasma that filters into the nephrons is approximately ________ of the total volume.
The amount of plasma that filters into the nephrons is approximately 1/5 of the total volume.
Nephrons main tasks include filtering the blood of all waste products, including solid wastes and excess water, as well as reabsorbing, secreting, and excreting a wide range of compounds.The tiny molecules are transported into the glomerular capsules and proceed through a twisting network of tubules when the blood is forced through the glomerulus under high pressure.The cell found in each tube absorbs various molecules, with the exception of glucose, water, and other advantageous compounds known as the ultrafiltrate. More water is removed from the ultrafiltrate before it leaves the nephrons as the ultrafiltrate molecules become increasingly hypertonic as they go down the tubules.
To know more about nephrons check the below link:
https://brainly.com/question/10114067
#SPJ4
the dna with the gene of interest for a cloning experiment was left on the lab bench overnight (instead of storing it in the freezer). as a result, it was degraded. they didn't know the dna was left out and used it in the experiment. the plasmid, however, was stored correctly. the vector contains a gene for ampicillin resistance. after the transformation procedure, the bacteria were plated on media containing ampicillin. what results are expected from this faulty molecular cloning experiment?
In a molecular cloning procedure, the DNA to be copied is extracted from a target organism and split into smaller DNA fragments in a test tube using enzymes.
These pieces are subsequently joined with vector DNA to produce recombinant DNA molecules. After that, a host organism is given the recombinant DNA (typically an easy-to-grow,strain of E. coli bacteria). Recombinant DNA molecules will be duplicated alongside the host DNA in the resulting population of organisms. These are transgenic or genetically modified organisms because they have foreign DNA pieces. Thus, the term "clone" is frequently used to describe both the bacterial population and the recombinant DNA molecule. In actuality, molecular cloning refers to the scientific techniques utilised to put them together.The idea arose that different DNA sequences could be inserted into a plasmid and that these foreign sequences would be carried into bacteria and digested as part of the plasmid. That is, these plasmids could serve as cloning vectors to carry genes.
Learn more about DNA
https://brainly.com/question/30006059
#SPJ4
1. as you travel up through the atmosphere it gets colder and colder the rate at which it gets colder is called the _______ rate and it is about ____ c per km of altitude
2. the less atmosphere over our heads, the _________ the lower the atmospheric pressure
3 the atmosphere weighs_______ kg per cubic centimeter
the atmosphere keeps the earth warm when light from the sun is reflected back from the earth as heat and trapped in the atmosphere it is called the _________
3. __________ smog occurs when sunlight reacts with chemicals from car exhaust
4. when coal is burned to make electricity it produces sulfur when the sulfur combines with rain to make sulfuric acids it is called _________
As you travel up through the atmosphere it gets colder and colder the rate at which it gets colder is called the "lapse rate" and it is about 6.5°C per km of altitude.
2. The less atmosphere over our heads, the "thinner" the lower the atmospheric pressure.
3. The atmosphere weighs about 1.2 kg per cubic centimeter. The atmosphere keeps the earth warm when light from the sun is reflected back from the earth as heat and trapped in the atmosphere it is called the "greenhouse effect."
3. "Photochemical smog" occurs when sunlight reacts with chemicals from car exhaust.
4. When coal is burned to make electricity it produces sulfur. When the sulfur combines with rain to make sulfuric acids it is called "acid rain."
What is lapse rate?The lapse rate is the rate at which the temperature of the atmosphere decreases with an increase in altitude. It is usually expressed in degrees Celsius per kilometer of altitude.
The lapse rate is important because it determines how the temperature of the atmosphere changes with altitude, which in turn affects the formation of clouds and precipitation. The average lapse rate in the Earth's lower atmosphere is about 6.5°C per kilometer of altitude, but it can vary depending on local weather conditions and other factors.
Therefore, In general, the lapse rate decreases with an increase in humidity and the presence of clouds, and it increases with a decrease in humidity and the absence of clouds.
Learn more about "lapse rate from
https://brainly.com/question/22257655
#SPJ1
name the 8 major terrestrial biomes, and describe each in terms of relative temperature, precipitation. why can the same type of biome occur in areas that are very geographically distant?
Temperate grasslands, temperate forests, boreal forests, Arctic tundra, tropical rainforests, savannas, subtropical deserts, and chaparral are the eight main terrestrial biomes.
Large-scale ecosystems, or biomes, can be distinguished by the temperature ranges and precipitation patterns that are unique to them.The types of flora and animal life that can exist in particular regions are influenced by these two features.The same biome can survive in geographically separate places with equivalent climatic circumstances since each biome is determined by its climate. A biome is a substantial biological community or ecosystem that is home to a range of organisms that may survive in a certain environment, including plants, animals, birds, insects, and people. Based mostly on adaptations, temperature ranges, weather, and climatic circumstances, the enormous variety of ecosystems that make up the world are divided and grouped into several biomes.Refer here to know more about biome:
https://brainly.com/question/1930321
#SPJ4
which pathophysiologic event is associated woth left ventricular failure when te renin angiotensin aldosterone system is activated
Vasoconstriction is the pathophysiologic event that is associated woth left ventricular failure when te renin angiotensin aldosterone system is activated.
Early in the course of heart failure, the RAAS is engaged as a compensatory mechanism, but as the condition worsens, it takes on a harmful function and is in charge of the elevated preload and afterload that characterise clinical heart failure syndrome.
The narrowing (constriction) of blood arteries by tiny muscles in their walls is known as vasoconstriction. As blood arteries close, blood flow is slowed or stopped. Vasoconstriction can range from mild to severe. It might be brought on by a sickness, medication, or psychological issues.
To keep your blood flowing normally and prevent your body from being too chilly, vasoconstriction is necessary. When necessary, it can also cause a rise in blood pressure. Some drugs mimic your body's natural impulses to restrict your blood vessels.
Learn more about renin angiotensin aldosterone system from:
https://brainly.com/question/4519668
#SPJ4
What would be the best design for an experiment that tests how much water expands when frozen?
A. Purchase a small plastic container and mark increments of volume on the outside. Put in 5 ounces of water and place in the freezing compartment of your refrigerator for 8 hours. Compare the end (frozen) volume with the beginning (liquid) volume.
B. Purchase a small plastic container of bottled of water, any brand, commercially
sealed. Mark water line with a marker. Place it in the freezing compartment of your refrigerator for 8 hours. Observe the results.
C. Take a small bowl and fill it half full of water. Mark the level. Place it in a freezing compartment of your refrigerator for 8 hours. Observe the results.
Answer: C
Explanation:
in dna, the two long strands that form a spiral are called what
Binomial nomenclature is the naming convention that provides each species with a scientific name that containing two names. Select the two names that are used in binomial nomenclature.
a. phylum
b. class
c. genus
d. order
e. species
Answer:
genus and species
Explanation:
Binomial Nomenclature Often known as the sequential nomenclature, this systematic method of naming organisms consists of two Latin names, the genus, and the species. All living things, and some viruses, have a scientific name.
in of mice and men, george and lennie share a special relationship. what motif do these characters fit into?
Loneliness, dream ranch, the river setting ,animal imagery motif fits into these characters in of mice and men, george and lennie sharing a special relationship
George and Lennie have a unique friendship in of mice and men. These individuals meet the themes of animal imagery, the river location, the dream ranch, and loneliness. In the novella Of Mice and Men, loneliness plays a significant role in the life of a migratory labourer. In Of Mice and Men, the reader can observe various characters who are impacted by loneliness. After losing his loyal buddy, his dog, Candy is left alone. Because he is a black man living in a segregated 1930s society, Crooks is lonely. Since she is the only female on the ranch and has no company, Curley's wife is lonely. Even though George and Lennie are homeless and have little money,they are optimistic.
For such more questions on Relationship:
brainly.com/question/13615741
#SPJ4
Determine the correct sequence of mRNA and tRNA
The correct sequence of the mRNA is AUG AGA CCG AUC UAA
The correct sequence of the tRNA is UAC UCU GGC UAG AUU
The amino acid sequence of the protein would be Methionine, Arginine, Proline, and Isoleucine.
What is translation?The translation is one of the steps involved in gene expression. During translation, the information encoded in mRNA is translated to proteins. each genetic code is translated into its amino acid and the amino acids are linked by peptide bonds to form the primary structure of proteins.
The tRNA carries the anticodons for each genetic code and when matched, the amino acid encoded is released in the ribosome.
From the illustration, the genetic codes or the mRNA sequence is AUG AGA CCG AUC UAA. Each triplet code represents an amino acid. The anticodon for each, according to the base pairing rule would be as follows:
AUG AGA CCG AUC UAA
UAC UCU GGC UAG AUU
The amino acid for each codon according to the chart would be as follows:
AUG - Methionine
AGA - Arginine
CCG - Proline
AUC - Isoleucine
UAA - stop
More on translation can be found here: https://brainly.com/question/18800216
#SPJ1
outline an optimal treatment plan for julie and explain your reasoning. discuss the tradeoff s encountered during the composition of your plan (consider alternative drug targets and a bone marrow transplant).
The primary medication used to treat CML is a drug named imatinib. It is typically administered quickly after a cancer diagnosis in order to decrease the disease's course and keep it from progressing to an advanced stage.
Reduced formation of aberrant white blood cells is how imatinib functions.
BMT, commonly referred to as a bone marrow transplant as well as hematopoietic stem cell transplant could treat AML for patients of any age. It swaps out harmful stem cells with good blood-forming ones. Many people's diseases can be cured through transplants.
A bone marrow, meaning stem cell, transplant is such kind of therapy for CML where the patient receives transplanted bone marrow from a donor. The first and only recognized treatment that can completely cure CML would be an allogeneic transplant.
To know more about medicine
https://brainly.com/question/819753
#SPJ4
What creates the boundaries for the distribution of a trait within a population?
The variation and distribution of traits in a population depend on genetic and environmental factors.
Different traits can be introduced into an organism by genetic variations that alter gene activity or protein function. If a trait is beneficial and aids an individual's survival and reproduction, the genetic variation is more likely to be passed down to the next generation.
Mutations create new alleles over time, resulting in genetic diversity. Mixing alleles from parents results in new allele combinations in their children. Bacteria and other organisms that can clone themselves can pass on alleles to each other.
Each genotype in a population has a different fitness for that specific environment. In other words, certain genotypes will be preferred, and people with those genotypes will continue to reproduce. Other genotypes will be discouraged: people with those genotypes are less likely to reproduce.
To know more about the Genetic Variations, here
https://brainly.com/question/848479
#SPJ4
why do modern humans have misaligned teeth? group of answer choices the development of agriculture a diet of harder foods the development of larger jaws an increased emphasis on foraging food
The development of agriculture. The introduction of softer, sweeter foods than what our predecessors normally ate has changed the oral environment, which is largely to blame for modern dental diseases.
Genes can play a role in tooth alignment. Some disorders that can run in your family include crowding, jaw size, jaw shape, hyperdontia (having too many teeth), overbites, underbites, Agriculture and poor tooth or palate development. Nine out of ten people have teeth that are slightly out of place or maloccluded, and 75 percent of us have wisdom teeth that are unable to fully erupt. In other words, our teeth don't fit in our jaws.
Learn more about Agriculture
https://brainly.com/question/10104392
#SPJ4
In addition to a promoter, eukaryotic genes have control elements called __________.
In addition to a promoter, eukaryotic genes have control elements called Regulator Gene
Eukaryotic genes:
It is obvious that eukaryotic genes have a different and more complex structure, particularly in the promoter regions and regulatory regions.
Despite significant advancements in gene cloning, sequencing, and the expression of genes in many cell types, comprehension of other genes is still vague, with the exception of a few simple genes.
• The structural characteristics and functional properties of genes transcribed by various enzymes vary.
A. RNA pol-promoter I's structure is as follows:
RNA polymerase-I is the only enzyme capable of transcription of ribosomal RNA genes.
• In the eukaryotic system, ribosomal RNA genes are the most active, highly productive, and frequently transcribed genes.
RRNA makes up more than 90% of all the RNA in eukaryotic cells.
To know more about Eukaryotic genes:
https://brainly.com/question/28297163
#SPJ4
4. What is TRUE about the use of bones to solve crimes?
Children are best identified by
observing ribs and joints.
Adults are best identified using teeth and long bones.
When human bones are found, a crime definitely took place.
The long bones are measured in length and circumference.
The truth about the use of bones to solve crimes is that long bones are measured in length and circumference. That is option D.
What is a bone?A bone is defined as a rigid and hard structure which consists of compact tissues and makes up the musculoskeletal system of the body.
There are different types of bones which include the following:
Long bone: has a long, thin shape. Short bone: has a squat, cubed shape. Flat bone: has a flattened, broad surface. Irregular bone: has a shape that does not conform to the above three types.The long bones of human being can be measured in length and circumference which is an advantage against that of animals and can serve as solution in a crime scene.
Learn more about bones here:
https://brainly.com/question/26323655
#SPJ1
what is the primary substance contained in the inorganic portion of bone tissue? magnesium magnesium calcium phosphate calcium phosphate collagen collagen iron
Collagen is the primary substance contained in the inorganic portion of bone tissue
The primary structural protein in the extracellular matrix that makes up the many connective tissues of the body is collagen. It makes up between 25% and 35% of the protein in a mammal's entire body and is the basic building block of connective tissue. The collagen helix, a triple helix of an extended fibril made of amino acids, is what makes up collagen. It is mostly present in connective tissue, which includes skin, tendons, ligaments, cartilage, and bones.
The main crystalline hydroxyapatite component of the inorganic component is: [Ca3(PO4)2] 3Ca(OH) 2. Type I collagen, which makes up more than 90% of the organic component of bone, has more than 30 different proteins.
To learn more about Collagen refer here:
https://brainly.com/question/3105041
#SPJ4
How would you describe the difference in the motion of the skier from when he starts at the top of the slope to when he is halfway down the hill?
A skier starts at the top of a hill with of potential energy. At the bottom of the hill, she has only of kinetic energy, this is the difference in the motion of the skier from when he starts at the top of the slope to when he is halfway down the hill.
What is potential energy?Potential energy is a type of stored energy that depends on the interactions of various system elements. The potential energy of a spring rises when it is compressed or expanded. If a steel ball is lifted above the ground as opposed to falling to the ground, it has higher potential energy.
Any item that is raised from rest has an energy that may be released at a later time; for this reason, it is referred to as potential energy.
Examples include elevating an item, stretching a spring, and using a battery. The two major forms of energy are potential and kinetic.
Potential energy is lost and kinetic energy, or the energy of motion, is acquired as the skier starts the ascent down the slope. The skier increases speed as he loses height.
To know more about skier refer to:
https://brainly.com/question/24946951
#SPJ1
Diatoms are one of the most common types of phytoplankton in marine habitats. Like plants, diatoms contain chlorophyll and produce glucose from which of the following? Select all that apply.
- Oxygen
- Carbon dioxide
- ATP
- Water
- Sunlight
- Glucose
Carbon dioxide and the sun In maritime settings, diatoms are among the most prevalent phytoplankton species. Chlorophyll and glucose are both found in diatoms, much like in plants.
The right answer is D and B.
What makes glucose and has chlorophyll in it?Chlorophyll and other pigments that are light-sensitive and absorb solar energy are found in photosynthetic cells. Such cells have the capacity to transform solar energy into organic molecules with high energy content, such glucose, in the presence of carbon dioxide.
Which of the following provides the energy required for respiration and the energy accumulated during photosynthesis?During photosynthesis, plants employ light energy to create food molecules, and during cellular respiration, they get energy from the bonds of these food molecules.
To know more about chlorophyll visit:-
https://brainly.com/question/5823662
#SPJ1
species that undergo sexual selection often have males and females that differ dramatically in phenotype, a phenomenon called sexual dimorphism. since sexual dimorphism is a result of selection for the two extremes of a phenotypic trait, what pattern of selection is this?
Option A disruptive is the correct answer. This pattern of selection is disruptive because it favours the two extremes of a phenotypic characteristic, which results in sexual dimorphism.
Sexual dimorphism is the systematic shape difference between individuals of different sexes within the same species. For instance, the male in some species, such as many animals, is bigger than the female. The female of some species, like some spiders, is larger than the male. This sexual dimorphism has been noted in early development studies, childhood, adolescence, and maturity. On average, males' total brain size is around 8%–15% greater than females' (uncorrected for body size).
As a result, we can conclude that Option A disruptive is the best choice. Sexual dimorphism results from selection toward the two extremes of a phenotypic characteristic, hence this pattern of selection is disruptive.
Learn more about sexual dimorphism here:
https://brainly.com/question/7079207
#SPJ4
Complete Question:
Species that undergo sexual selection often have males and females that differ dramatically in phenotype, a phenomenon called sexual dimorphism. Since sexual dimorphism is a result of selection for the two extremes of a phenotypic trait, what pattern of selection is this?
Choose one:
A.disruptive
B.stabilizing
C.directional
scientists believe that perching birds originated on the continents of australia and antarctica. how would these scientists explain the discovery of ancient perching bird fossils in africa?
The concept that dinosaurs were the direct ancestors of birds was backed by new research on ancient specimens as well as by field finds of dinosaur and early bird species.
Numerous traits and behaviours that distinguish modern birds were also present in dinosaur forebears. Theropods were a class of meat-eating dinosaurs from which birds descended. Although birds originated from little theropods rather than gigantic ones like Tyrannosaurus rex, they nonetheless belong to the same group as the dinosaur. The earliest fossilised bird remains date back 150 million years. Since they have a foot structure that enables them to grip branches, many bird species, including the majority of songbirds, are also known as "perching birds." The shape of one toe at the back of the foot works as a pincher, stabilising the perched bird.
The complete question is:
Scientists believe that perching birds originated on the continents of Australia and Antarctica. How would these scientists explain the discovery of ancient perching bird fossils in Africa? A) At one time, the climate in Earth was consistent throughout the planet. B) The fossils may have been moved by man, animals, or Earth’s constructive and destructive processes. C) The birds originated in Africa, but migrated with human populations to Australia and Antarctica to Africa. D) During the life of Pangea, Antarctica, Australia and Africa were neighboring
Learn more about Bird
https://brainly.com/question/21424297
#SPJ4
the n u r s e knows that which organ is primarily responsible for maintaining fluid volume and osmolality? a. liver b. kidneys c. blood vessels d. heart
The kidneys are responsible for maintaining and regulating volume and osmolality.
By adjusting the quantity of sodium and water ejected, the kidneys, in coordination with neurological and endocrine input, control the volume and osmolality of the extracellular fluid. By continuously filtering the blood, the kidneys control the body's fluid and electrolyte balance. This is essential to keep the volume and make-up of osmolality extracellular fluid consistent. This is generally done through modifying salt and water reabsorption, the methods of which vary depending on the segment of the nephron. kidneys adjusting the quantity of sodium and water ejected, the extracellular fluid's volume and osmolality are controlled.
learn more about osmolality here:
https://brainly.com/question/7938474
#SPJ4
many viruses are host specific meaning they only infect a certain type of host. most viruses only infect certain types of cells within tissues. this specificity is called
Most viruses only infect certain types of cells within tissues. This specificity is called tissue tropism.
What is Tissue Tropism?Tissue tropism is defined as the range of cells and tissues of a host which favor the growth of a particular pathogen like virus, bacterium, or parasite. Some bacteria and viruses have a broad tissue tropism which can infect many types of cells and tissues while others can primarily infect one tissue.
It is the ability of a given pathogen to infect a specific location. Organ or tissue tropism defined as the ability of a given pathogen to infect a specific organ or set of organs.
Recognition of the cell surface receptor by the virus particle that determines the host range and tropism of cell and tissue infection is the first step in the virus replication cycle.
Thus, most viruses only infect certain types of cells within tissues. This specificity is called tissue tropism.
Learn more about Tissue tropism, here:
https://brainly.com/question/22044063
#SPJ1
how many of these mutations are conservative, in the sense that an arg codon is changed to a functionally similar lys codon? express your answer as an integer.
Three nucleotide bases called codons are used to encode an amino acid or signal at the start or finish of protein production. An amino acid is represented in the genetic code by 3 nucleotides, whereas there are only 4 bases.
Proteins are constructed from a set of 20 amino acids in a variety of configurations. For every four nucleotides and 20 amino acids, there are 64 potential codon configurations, provided that at least three bases are present.
Given the genetic code's degeneracy, numerous codons encoding the same amino acid are not required because the genetic code carries more information. As there are three base pairs each codon and three DNA base pairs every base pair, there are nine potential substitutions for each DNA base pair.
for arginine, including 6 codons 6×9= 54
∴ There could be 54 mutations for the 6 arginine codons.
To learn more about codons please click on below link
https://brainly.com/question/14280922
#SPJ4
6.) How is "lock and key" used to describe the action of enzymes? (1 point)
Enzymes are able to create gaps in cell walls that allow reactants to enter cells.
Enzymes have a shape that specifically fits the reactants, like a key in a lock.
Enzymes have a shape that specifically fits the products, like a key in a lock.
Enzymes are able to create gaps in cell walls that allow products to leave cells.
Enzymes have a shape that specifically fits the reactants, like a key in a lock used to describe the action of enzymes.
What are the features of enzymes?Enzymes are proteins that help speed up metabolism, or the chemical reactions in our bodies. They build some substances and break others down.
Moreover, enzymes are proteins comprised of amino acids linked together in one or more polypeptide chains. This sequence of amino acids in a polypeptide chain is called the primary structure.
All biological reactions within human cells depend on enzymes. Their power as catalysts enables biological reactions to occur usually in milliseconds.
Learn more about enzymes:
https://brainly.com/question/14953274
#SPJ2