Please help

Environmental resistance can be______.

Please Help Environmental Resistance Can Be______.

Answers

Answer 1

Answer:

c

Explanation:


Related Questions

Glaciers pushing rocks against rocks is an example of

Answers

Answer:

Erosion??

Explanation:

Answer:

Glacial Erosion

Explanation:

A multicellular organism typically begins as a single cell, and then many cell divisions occur to generate the cells of the adult organism. However, these cells are not identical to the original cell, and they are not identical to one another.


What is the most significant cause of cell differentiation in a multicellular organism?

A.
differences in the number of chromosomes per cell
B.
differences in the genetic code used by different cells
C.
differences in the DNA that is copied and distributed among the cells
D.
differences in gene regulation and gene expression among the cells

Answers

Answer:

D

Explanation:

Difference in cell regulation and cell expression. This is embedded in chromosomes which is the blue print of the organism. The chromosomes is like the house plan when you building a house.

The most significant cause of cell differentiation in a multicellular organism is: D. differences in gene regulation and gene expression among the cells.

What is cell differentiation?

Cell differentiation can be defined as a process through which a young, unspecialized cell undergoes various changes in gene expression, so as to become a specialized that is more specific in terms of function.

In a multicellular organism, which is an organism with multiple cells, the most significant cause of cell differentiation is as a result of differences in gene regulation and gene expression among its cells.

Read more on cell differentiation here: https://brainly.com/question/13846411

Which action would be completed by skeletal muscle tissue 1.moving blood
2.increasing the heartbeat, or 3. kicking a soccer ball

Answers

Answer:

Kicking a soccer ball

Explanation:

Answer:

Kicking a soccer ball

Explanation:because moving blood and having a heartbeat arent in need of a skeletal system

The Seven Sisters are seven stars located more than 400 light-years away in the Taurus constellation and they can be seen here with Venus and another constellation, Orion. Why do these stars seem so small compared to our Sun, also a star?
A) Our Sun is much larger than any of the Seven Sisters.
B) Our Sun is much closer to Earth than the Seven Sisters.
C) The Seven Sisters are ancient stars; the Sun is a young star.
D) Stars found in constellations are much older and smaller than any other stars.

Answers

Answer:

The reason why these stars seem so small compared to our Sun is:

B) Our Sun is much closer to Earth than the Seven Sisters.

Explanation:

The reason behind this is that the sun is at a distance of the earth of 0.000016004 light-years. While the seven stars are at a distance of 400 light-years. Making them so far away that their size is reduced because in physics object size is altered by the perspective of the watcher or observer. Meaning that a ball the size of a car can be seen by our eyes as small as a bean if it is at the proper distance.

All living organisms are composed of what?​

Answers

All living organisms are composed of one or more cells.So, your answer would be Cell.

hope it helps!

WILL MARK BRAINIEST!!!! PLZ!!!
Which system of equations is equivalent to the following system?

4x + y = 4
2x + 7y = 28

4x + y = 4
−2x − 7y = 28
4x + y = 4
−8x − 28y = 112
−28x − 7y = −28
2x + 7y = 28
−8x − 2y = 8
2x + 7y = 28

Answers

Answer:

D.

Explanation:

Answer:

D

Explanation:

burning fossil fuels, it makes the Earth colder.
What percent of the atmosphere is carbon dioxide?
A.4%
B.0.4%
C.40%
D.0.04%

Answers

Answer:

B i took the test

Explanation:

Answer: D

Explanation: Only 0.04% of the atmosphere is carbon dioxide.

A 30 kg object has 3 forces acting on it - one 40 N force to the right, one 20 N force to the right, and one 30 N force to the left. What is the acceleration of the object?

A. 1.0 m/s2 to the right
B. 0 m/s2
C. 1.6 m/s2 to the right
D. 3 m/s2 to the left

Answers

Answer:

Thats not biology , that's physics . Net force = F1+F2-F3=40+20-30=60-30=30

F=ma.

30=30a

a=30/30

a=1m/s^2

Tracey was learning about structural organization in animals. What level of structural
organization BEST describes an egg?
A. a cell
B. a tissue
C. a system
D. an organ​

Answers

Answer:

A

Explanation:

Egg cell

The level of structural organization which best describes an egg is: A. a cell.

A cell can be defined as the fundamental (basic) structural, functional, and smallest unit of life, that is typically found in all living organisms such as animals.

The structure of an egg is similar to those of cells found in living organism, which are structurally layered with various cell organelles.

An egg shell is selectively permeable because it acts as an outer membrane just like in living cells to prevent unwanted materials from going into the egg.

In conclusion, the level of structural organization in animals cells can best be describe by using an egg.

Read more: https://brainly.com/question/19559847

How is the organism in bread used?

Answers

Answer:

yeast

Explanation:

i think............................

I'm not sure

What percentage of Japan’s population is between the ages of 0–4 years?

Answers

Answer:

looks like about 8% to me

40 to 44 percent of people are in the range of 0 to 4 years.

What is the population?

A population is a group of different people. There are three different types of population such as rapid growth, slow growth, and negative growth.

In rapid growth, the population will grow rapidly. While slow growth population grows very slowly. In negative growth population growth is negative.

In the population graph, male and female growth is shown. The darker color in the population shows males and the lighter color shows females population.

Therefore, 40 to 44 percent of people are in the range of 0 to 4 years.

To learn more about the population, refer to the link:

https://brainly.com/question/27991860

#SPJ2

Please help out! It would be very nice !!

Answers

Answer:D

Explanation:

Cell wall provides structure and protection

Answer:

D is the answer to the question

Place the appropriate terms into the table

Answers

Answer:

Kindly, provide us with a table, thank you! :)

Explanation:

Can we see the table lol? :)

. Why is the carpel considered female and the stamen male?​

Answers

Answer:  A carpel is the female reproductive part of the flower, interpreted as modified leaves that bear structures called ovules, inside which the egg cells ultimately form and composed of ovary, style and stigma. Stamen, the male reproductive part of a flower, consisting of a long slender stalk and the pollen-producing anther.

Explanation:

Biogeochemical cycles _______.

Answers

Answer:a biogeochemical cycle or substance turnover or cycling of substances is a pathway by which a chemical substance moves through biotic (biosphere) and abiotic (lithosphere, atmosphere, and hydrosphere) compartments of Earth.

Explanation:

A biogeochemical cycle is one of several natural cycles, in which conserved matter moves through the biotic and abiotic parts of an ecosystem

Which answer choice correctly lists the flow of food through the GI tract (gastrointestinal tract) of the digestive system?

mouth-- stomach-- small intestine-- large intestine-- rectum

rectum-- large intestine--- small intestine--- stomach--- esophagus-- mouth

mouth-- esophagus-- stomach-- small intestine--- large intestine--- rectum

mouth-- stomach-- small intestine-- esophagus--- large intestine-- rectum

Answers

This is hard ........!!!!!!

Answer:

mouth--esophagus--stomach--small intestine---large intestine---rectum

Explanation:

State the three parts of the cell theory.

Answers

Answer:

The three parts of the cell theory are: cells are the smallest unit of life; all cells come from preexisting cells; and living thing is made up of one or more cell.


Is the below sequence DNA or RNA? How do you know?
GTTTACAGGCGGCGCAATATCTGATCG

Answers

The answer is DNA I know because I know

Answer: DNA

Explanation: DNA has Thymine, Guanine, Cytosine, and Adenine.

RNA has all of those except for adenine which is replaced with Uracil.


The landform pictured above is _____, which has formed out of _____ and _____.
O A. a glacier, snow; ice
B. a glacier; ocean water, snow
O C. a mountain; snow; ice
OD. an iceberg; ocean water, snow

Answers

Answer: a glacier; snow; ice

Explanation:

Just did it and it was right

Earthworms, small insects, and microorganisms live in the soil and break down dead plants and animals. What would happen to an ecosystem if this process was compromised?
A.
The population of green plants in the ecosystem would increase.
B.
There would be more energy available to consumers in the ecosystem.
C.
The soil quality of the ecosystem would dramatically improve.
D.
The carrying capacity of the ecosystem would be limited.

Answers

Answer: D

Explanation:

Since the Earthworms, small insects, and microorganisms live in the soil and break down dead plants and animals. They end up playing a vital role in the ecosystem, if this were to be compromised nothing good would come form it Disease, competition, predator-prey interaction, resource use and the number of populations in an ecosystem all affect carrying capacity. If Earthworms, small insects, and microorganisms couldn't break down the the dead material and return it to the soil, then surely the carrying capacity would be drastically effected.

b. Why is it possible to move the object that way?

Answers

there’s is no question there’s only an answer there’s nothing to explain

Answer: Because force gives an object energy to move in a certain direction. The distance that object travels all depends on the amount of force used and the amount of friction the object intakes.

The pattern of natural selection where BOTH of the extreme versions of a trait are more advantageous than the average, so a population evolves in both directions away from the average.

Answers

Answer:

Stabilizing Variation.

Explanation:

This is the type of variation that occurs when genetic diversity decreases as the population of organism in a particular population based on a specific trait.

Organisms with varied or specific  traits within the population are selected against by the selection pressure,  with little chances of reproduction, while organisms in between, ( with least variation of  this particular traits) which are within the narrow range, survive to reproduce.Thus, this gives  rise to narrow population  of these  particular organisms,(stabilizing variation) which are therefore naturally selected.

Therefore, the variation of the organisms in this population is kept  close to the  centre of  the same  mean value.

1. Summarize the scientific information that leads to conservation in each of the articles.
2. What social issues affected the problem or its solution in each of the stories?
3. How did economics delay scientists' first attempts for conservation in each story?
4. Describe the political actions that led to successful conservation in both stories.

Answers

Answer:

Explanation:

BY USING FOREST WISELY;

It was learnt that people are cutting trees at an worrying rate.This problem is disturbing because ;

1)Those trees are responsible for releasing of oxygen and they made up at least a quarter of the world population.

2) Those trees of the world make up of portion land species by more than forth or fifth portion.

There are also economic implications as a result of trees been cut down, when there is no availability bot trees , it could result to situation whereby there would be scarce of resources for industries as well as

hike price of paper in market, regardless of this trees are needed for manufacturing of important materials such as usage in making houses and others developments or growth

Therefore, all the afformentioned economic concern result in economics delay scientists' first attempts.

COMMUNITY CONSERVATION;

It was learnt that there is to the forest that those gorilla habitated, those human being that reside in those region reside there so they can practice their farming because their is available land there. They also reside there because of housing.

These gorillas were affected as a result of the destruction made to their habitat as well as the activities of the poachers that hunt them for production of the and skin.

There are adverse effect of the obliteration of the gorilla from on the society, it can result to having reduction in tourism in country such as

Uganda as well as Rwanda, as result of this the means of livelihood of people in that part could be affected because there would be Reduction in profit making. Hence the reason behind the increase in number gorillas in the region, because they know they know that those gorilla influence the number of tourist that comes there and the revenue that is generated through this tourism.

The article 'By using Forest Wisely' can be summarised as:

People are cutting trees at the wrong rate and trees play a crucial role in an ecosystem.

The trees produce oxygen and they made up at least a quarter of the world population.

The trees occupy the fourth or fifth portion of the land organisms.

In the absence of trees, the ecosystem will fail and the organisms dependent on them will eventually die.

The resources available from the trees will be scarce and the factories and industries that are dependent on trees will no longer be available.

Trees are required for manufacturing important materials.

The article 'Community Conservation' can be summarised as:

In the article, it was mentioned that the human populace urbanized the land region where gorillas were habituating.

The humans occupied the space to practice farming and make houses.

The population of the gorillas was disturbed and diminished.

The hunting of gorillas by poachers was also reduced.

The people of Uganda and Rwanda also suffered reduction tourism and conservation of wildlife.

Gorillas influence the number of tourists, therefore, the destruction of their habitats led to a reduction in profit-making.

Therefore, all the mentioned economic concerns result in economics delaying scientists' first attempts.

To know more about forest conservation, refer to the following link:

https://brainly.com/question/16505239

Can somebody help with those 3 problems please

Answers

Answer:

first one is option A

second one option B

third is26 N

Explanation:

1.the law here is every action has an equal and opposite......

2. only unbalanced forces move objects from rest or of uniform motion

3.net force is the sum of forces ,if forces are in the same direction

hope this helps plz mark me brainliest

2) Option A.
Force is directly proportional to the mass. As the mass of the fuel deceases as the fuel is burnt, the force also decreases as force is directly proportional to mass, and as the force decreases, the acceleration decreases as acceleration is also directly proportional to the force, and the shuttle may eventually come to a stop due to the increasing deceleration. However, initially if the forces are kept balanced as the space shuttle and the gases exert an equal amount of force on each other in the directions opposite to each other, the object will keep on moving upwards in a constant velocity as the amount of force is also kept constant.


3) Option B.
The motion will definitely change when the forces acting on an object are unbalanced-it will start to move, accelerate or decelerate or change its direction in the direction of the net force. The object will not move at all or continue moving with the same velocity and in the same direction if the forces acting on it are balanced or zero.

4) When the forces are unbalanced and are acting on an object in the same direction, the net force will be found by finding the sum of those forces.
Net force=17+9=26 N.

I really, really hope this helps! And please mark it as brainliest.

Drag each description to the correct type of succession.

vacant parking lot for many years

Primary succession

Secondary succession

abandoned baseball field

recently cooled lava field

rocky hill under a melted glacier

clear-cut forest

1) Intro

Done

ivity

Answers

Answer:

1) vacant parking lot for many years (secondary succession)

2) abandoned baseball field (secondary succession)

3) recently cooled lava field (primary succession)

4) rocky hill under a melted glacier (primary succession)

5) clear-cut forest (secondary succession)

Explanation:

Succession in ecology is the gradual encroachment of life on a given ecosystem.

Primary succession involve a new never-before colonized region like a new lava deposit or land hidden under glacial sheets. Secondary succession is the encroachment of life on an area formerly harboring life but had experience a disturbance like wildfire, agricultural activities, logging etc.

Answer:

PRIMARY SUCCESSION (recently cooled lava field) and (rocky hill under a melted glacier). SECONDARY SUCCESSION (vacant parking lot for many years) (abandoned baseball field) and (clear-cut forest.

Explanation:

it's correct

PLS HELP ME!!!!!!!!!!!

Answers

Answer:

From the mouse

Explanation:

It is directly gaining energy from the mous because the mouse is what gives the snake energy and if the snake directly consume it, it will get energy from it.

I need to list the order of traits from sponges to mammals in which they appear from an evolutionary standpoint. I don't know how to find the correct order

Answers

Answer:

please put a picture of the work you have to do so i can help you

Explanation:

Which of the following delivers oxygen to the body?
Mark all that apply
Arteries
Veins
Capillaries
Hemoglobin

Answers

I think arteries, capillaries, and hemoglobin delivers oxygen to the body. So all except veins because veins carry blood to the heart, not the body.

A virus is ________ a cell.

A)bigger than
b) the same size as
C)smaller than
d)another word for

Answers

Answer:

smaller than

Explanation:

But they're nothing compared to the giants of the cellular world. ... And viruses are smaller again — they're about a hundredth the size of our cells. So we're about 100,000 times bigger than our cells, a million times bigger than bacteria, and 10 million times bigger than your average virus

Hope this helps <3

DNA is a molecule that stores____information in the cells

Answers

Answer: instructions

Explanation: trust me

Answer:

genetic

Explanation:

Other Questions
Personification or Hyperbole. The test was a piece of cake It was my twelfth birthday. Thanks to my over-active imagination, I had convinced myself that my mom was going to get me a new skateboard. I could not contain my excitement. I really needed a new skateboard, and not because I was bored with my old one. My old skateboard was falling apart. Upon waking up, I ran straight to my mom and asked her to give me my gift. She responded by telling me that I would have to wait until after I got home from school. She went on to say that if she told me what the gift was I would not be able to concentrate on my school work. Those words ensured that I would be so excited about getting my new skateboard that I would be unable to work. After a whole day of counting down the minutes, I arrived home from school. My mom was nowhere to be found. I called her office but did not get an answer. She did not answer her cell phone either. Just as my frustration was peaking, my mom pulled into the driveway. She stepped out of the car, asking, "Why are you looking at me like that?" I excitedly blurted out, "You said I would get my present after school, and it is officially "after school.'" "Oh, is that all? I assumed that you missed your dear mother," she teased. I later regretted my response. "No, that's not all! It's everything!" When I asked her where my gift was, she pointed at the J.C. Penney bag she held. She told me, "It's a new suit for you to wear to church." I muttered in disbelief, "But you said that if you told me about the gift, I would be thinking about it all day long." My mom responded, "I didn't say you would be thinking about it because it's a great gift."QuestionsWhich detail is important and should be included in a summary of this passage? A. After a whole day of counting down the minutes, I arrived home from school. B. I really needed a new skateboard, and not because I was bored with my old one. C. "You said I would get my present after school, and it is officially 'after school.'" D. She responded by telling me that I would have to wait until after I got home from school. :Felix has a bag of 6 yellow marbles and 6 green marbles. He picks a marble and then puts it back 26 times. The results are shown in the table.OutcomeTallyYellow15Green11What is the percent error of pulling a yellow marble in Felixs experiment?A13.3%B23.1%C42.3%D57.7% Read the passage from Mami and Papi. I wrapped my legs around her and buried my face under her chin. It felt so good to have Mai so close, so warm, swathed by her softness, her smell of wood smoke and oregano. Which phrases create a tone of contentment? Select all correct answers. swathed by her softness wood smoke and oregano felt so good* under her chin Please help! Choose all that apply. Why is a boxing ring square? What causes a molecule to have a net dipole moment?A. The presence of only nonpolar bonds in the moleculeB. The presence of Van der Waals forcesC. The presence of a net charge that does not cancel outD. The presence of both covalent and ionic bonds in the molecule PLEAS HELPWhich helped Japan rise to become an economic power after World War II?a trade agreement with Chinathe U.S. occupation and the Korean Wara military alliance with South Koreathe establishment of a command economy Graph: y = 12 - 41 + 2 In his speech, Stalin calls hitler a ruthless cannibal. What type of audience appeal is he using?Telos Logos Ethos Pathos A car used 1/64 of a gallon of gas to drive 1/4 of a mile. At this rate, how many miles can a car travel using 1 gallon of gas? HURRY HELP!!!! WILL GIVE 20 POINTS!!! Help please need help Sam conducted a survey to determine your favorite flavor of ice cream is his hometown. 15 of the 50 people he surveyed liked strawberry best. How many of the 3,500 residents in the town would you expect to like strawberry best Epithelial tissue _____. A. covers the body inside and out B. sends messages to and from the brain C. provides support for the body D. makes body parts move 2/5 of it is 22.\I need help PLS What is the value of tan(60)?O300NV3B60326C Question 3- Please help. Find the area of the sector for the image below: 560=5___tens =_____tens =______ Unscramble the following 5 names the signed the Declaration of Independence:jhon madsanijamneb likarnfnlumsae saadmhonj cakocnhsamotht serffjone