PLEASE HELP DUE IN 20MINUTES!!!!

Instructions:You will be given five questions inviting you to do something or go somewhere.For each question,complete the following steps:
1.Respond to EACH question with a positive AND negative response
2.When you respond in the negative,you must give a reason for declining,or offer another choice of date,time and/or activity as suited for the question.
(Do not give the same reason for declining five times)

 PLEASE HELP DUE IN 20MINUTES!!!!Instructions:You Will Be Given Five Questions Inviting You To Do Something

Answers

Answer 1

Answer:

¿Puedes ir al museo hoy?

Si, puedo ir hoy al museo

No, no puedo ir hoy al museo pues tengo mucha tarea por hacer.

     2. ¿Quieres ir al cine el viernes?

Si, quiero ir el viernes al cine

No, no quiero ir al cine el viernes porque tengo otro compromiso que previamente acepté.

      3. ¿Puedes ir al parque mañana?

Si, puedo ir al parque mañana

No, no puedo ir porque mañana tengo que salir de la ciudad y regresare hasta pasado mañana.

       4. ¿Puedes ir a la fiesta de Miguel?

Si, puedo ir a la fiesta de Miguel

No, no puedo ni quiero ir a la fiesta de Miguel porque estoy enemistado con él.

       5. ¿Quieres ir a cenar este fin de semana?

Si, quiero ir a cenar este fin de semana.

No, no quiero ir a cenar este fin de semana porque me quiero dormir temprano, estos días me he estado desvelado por mi trabajo.


Related Questions

Ella lo __________. ​ Question 7 options: hice hizo

Answers

Answer:

Hizo if u need any help with spanish just comment here or in my questions

Explanation:

Ella lo hizo is the correct answer.

Mi escuela Fill in the blanks Activity
DUE January 8th 8:00 AM
Instructions
Read the school's statistical information to complete the paragraph below. Write out the Spanish words for numbers.
Estadística de la escuela
2.500 estudiantes en total

24 nacionalidades diferentes

432 computadoras

14 españoles

1.500 libros

126 especialidades

Answers

Answer:

School statistics 2,500 students in total 24 different nationalities 432 computers 14 Spanish 1,500 books 126 specialties

Do you need it to be translated in English?

Answer:

dos mil quinientos estudiantes

veinticuatro nacionalidades diferentes

cuatrocientos treinta y dos computadoras

catorce españoles

mil quinientos libros

ciento veintiséis

Explanation:

You just have to write out the numbers in Spanish and follow the noun after it! Hope this helped! :)

el chofer
La abogada.
La persona que corta el pelo.
La persona que conduce
La guía turistica

Answers

Answer:

the co pilot?

the lawyer

the barber

the driver

the tourist guide

Explanation:

I know Spanish and English

1. The driver
2. The lawyer
3. The person who curta hair
4. The person who drive
5. The tourist guide

que es un guion de cortometraje?

Answers

Answer:

All of the lines of the characters on a piece of paper from a  short film

Explanation:

please help me with all the questions maybee??​

Answers

Answer:

Sandra y Pablo van al gimnasioYo voy todos los días a la escuelaSandra, Sarita y yo, ¿Adónde iremos en la tarde?Todas las tardes tú vas a la biblioteca

Answer:

^     ^

OwO

U   U

Explanation:

sandra y pablo van a gimnasio.

yo voy a la escuela todos los días

¿adonde vamos sandra, sarita y yo en la tarde¿

tu vas a la biblioteca todas las tardes.

Fill in the blank, be sure to accent correctly.
Write the verb (one word) but you must remember to change the endings so that it makes sense.


You (formal) get a high grade.

Answers

didn’t understand the first part but you formal is usted :)

-Er and -ir verb conjugations have the same endings except in the _____ and _____ forms.


ustedes, vosotros

yo, vosotros

nosotros, usted (el, ella)

nosotros, vosotros

Answers

Answer:

Nostoros and Vosotros :)

Explanation:

      Er        

Nosotros    -emos

Vosotros     -éis

     Ir        

Nosotros     -imos

Vosotros      -ís

Compre muchas cosas Ayer. Ahora no tengo Dinero solo me____ Cinco dolares.

Answers

Answer:

I bought a lot of things Yesterday. Now I have no money, only me____ Five dollars.

A= quedan

Please mark brainliest

solo me quedan cinco dolares

Tres consecuencias del pecado del Rey Salomón?

Answers

Answer:

Sus pecados incluyeron la idolatría, casarse con mujeres extranjeras y, en última instancia, alejarse de Yahweh, y eso llevó a que el reino se partiera en dos durante el reinado de su hijo Roboam.

Explanation:

hola

Complete the following questions using the appropriate interrogative word

Answers

Answer:

what?.....mmm......,.....

take a picture of the question please lol

... sino una. Hay una muchacha
misteriosa en la fiesta. Nadie conoce
a la muchacha. Ella se sienta en el
sofá y no habla con nadie.
in english

Answers

...Only one. There’s mysterious girls at the party. No one knows her. She sits on the sofa and doesn’t talk to anyone

Read the selection and the question, and then choose the option that best answers the question.

Si se da usted un golpe en la espalda, puede escuchar las recomendaciones del doctor:


Cuídese mejor si quiere sanar.
Descanse por una semana.
Lave la herida bien con agua para no tener picor.
No cubra la herida.


According to the text, what would not be a good idea?

- Air the wound
-Apply more water as needed
-Going back to work today
-Relaxing for seven days

Answers

Answer:

-Going back to work today.

Explanation:

According to the text, what would not be a good idea?

-Going back to work today.

C . Going back to work today !!

Decide whether the sentence is grammatically CORRECT or INCORRECT as written.

¿Tienes una falda nueva?

Answers

Answer:

yes

do you have a new skirt

The sentence is grammatically correct.

Accent marks show you where to put empasis on a word. true or false


for Spanish ​

Answers

The sentence is true
True because it’s right
Other Questions
A 7-pack of tickets to the zoo costs $78.61. What is the unit price? can someone help me understand this better on what she means by this with procedures A little girl is looking to select one crayon and one coloring book to do some drawing. She has 6 different colored crayons and 3 coloring books. How many different combinations of crayons and coloring books can she make if she selects one crayon and one coloring book to use? The table represents a function.What is f(-2)?0 -3-6-2f(x)314-2O-1O 1O 3 The 12 students in the Environmental Club represent 20% of the students in the seventh grade. How many students are in the seventh grade? In 1965 King and his wife, Coretta Scott King, led demonstrators on ahistoric 54-mile march that took five days, from where to where? HELPPPPPPPPPPPPPPP!!!!!!!!!!! BRAINLIEST IS ON THE LINE!!!!!!!!!!!!!!!!!Write a summary for Macbeth Act 1 Scene 2. What is the answer to question 7, NH4C2H3O2 what country has not experienced balkanization? PLS HELP FAST, IM FAILING LOLWhat is true about life under slavery?A. Slave owners discouraged slaves from adopting elements of whitecultureB. Slave owners did not pay slaves for their work,c. Enslaved African Americans had equal rights to those of whitepeopleD. Slaves had a great deal of freedom other than choosing where towork. Match the expression with an equivalent expression 6( n + 4 ) = 3(2(8-2x4)+25divided by 5 )-(2(8 divided by 4x2)-7(7-2x3) can you please help me:) Please help 4 questions for 10 points!!!------------------------------------------------------------1) Which expression is equivalent to 4(23)?4(20+3)4(2+3)4(2+13)4(20+30)..................................................................................................2. Which expressions are equivalent to 4(42)?Select each correct answer.4(20+22)4(40+2)4(4+20)4(4+2).......................................................................................................3.Which expression shows how 645 can be rewritten using the distributive property?640+6206+205640+6564+65...............................................................................4.Tori uses the greatest common factor and the distributive property to rewrite this sum:24 + 84What expression does Tori write?2(24+42)12(2+7)24(1+4)4(6+21).....................................................................my last one got deleted.... paid rent of Rs.25000 by cheque. make journal entry write the code for RNA from this DNA STRAND :AAAAAATTTTTTCCCGGGGTTTATATATC RIP grandsonhow does earths crust change earths surface y32c-4-3 -2 -1-1+1 2 3 4-2+-3+-4+41What is the slope of the line? Explain why the Hitler youth had only mixed success among the young German people. You may use the following in your answer comradeship (friendship), compulsory membership. hi...need help....thank you..