PLEASE HELP!!! I WILL GIVE BRAINLIEST!!!
How did the acquisitions of Oregon and the Mexican Cession relate to the idea of manifest destiny?
Why were some people opposed to the War with Mexico?
What does the phrase "sea to shining sea" mean?
Compare the different ways land was acquired by the United States in the period of manifest destiny from 1844 to 1853. Think about the acquisitions of the Oregon Territory and lands in the Southwest.

Answers

Answer 1

Answer:

It contributed to manifest destiny because now the US finished off getting lands in the West, from sea to shining sea

Both countries would lose their land. How did the acquisitions of Oregon and the Mexican cession contribute to manifest destiny? It contributed to manifest destiny because now the US finished off getting lands in the West, from sea to shining sea


Related Questions

pls restate, answer, and add details tysssm!

Answers

Answer:

stop cheating

Explanation:

PLEASE HELP ASAP!!!

look at the photos and answer the question correctly please

I’ll mark brainliest if you do it right

Answers

B or C, hope that helps
I believe it’s C i don’t know for sure tho

PLEASE HELP ASAP!!

A student is comparing the standards of living between the four countries listed below. What other factors would be the most important for the student to add?
A) Available housing and birth rates
B) Military strength and international aid rates
C) Foreign investment and U.N. membership
D) Literacy rates and geography

Answers

The correct answer is b
the correct answer is b

pls restate, answer, and add details tysssm!

Answers

Answer:

Due to the poor sanitation of the internment camps, deadly diseases such as whooping cough, measles and dysentery spread among the Cherokee. What helped the Cherokee survive on the trail of tears was the hunt for food. If they did not hunt for food, a whole lot more Indians would have died

Explanation:

The Cherokee people called this journey the "Trail of Tears," because of its devastating effects. The migrants faced hunger, disease, and exhaustion on the forced march. Over 4,000 out of 15,000 of the Cherokees died. This picture, The Trail of Tears, was painted by Robert Lindneux in 1942.

Why did reformers want to pass the Seventeenth Amendment?
A: To pay for new Government
B: To give citizen a greater say in choosing their representatives
C: To protect woman and children from problems caused by alcohol
D: To give woman the equal rights they deserved

Answers

Answer:

A: To pay for new Government

Explanation:

Answer:

I hope this helped you, have a great day :)

Explanation:

The answer is B they wanted to get more senators in office. It gave each state more senators.

Why might the Pope have wanted to keep Italy from unifying under the leadership of a single king
a-He believed a king may challenge his authority and power.
b-He believed that merchants would make better rulers than kings
c-He feared he would not be able to control a king.
d-Both A and C
e-Both A and B

Answers

Answer:

C. He feared he would not be able to control a king

i’m pretty sure the answer is C

what is one major challenge caused by a poor balance of trade?

Answers

its currency weaken, whilst those with a trade surplus will see its currency strengthen.

Hope that helps :)
Currency will weaken , those with trade surplus will see their currency strengthen

Which of the following led to the development of the Black Power Movement?

A. Watts Riots
B. assassination of Malcolm X
C. lack of enforcement of Civil Rights Act
D. enforcement of voter qualification tests

Answers

Answer:

B. assassination of Malcolm X

Explanation:

Malcolm X, born as Malcolm Little, and whose full official name was El-Hajj Malik El-Shabazz, was a speaker, religious minister and American activist. He was an advocate for the rights of African Americans, a man who harshly accused white Americans of their crimes against their black compatriots. Instead, his detractors accused him of preaching racism and violence. He has been described as one of the most influential African-Americans in American history. After the death of his father and his mother was hospitalized in a psychiatric hospital, Malcolm spent a period of his youth in prison for interacting with the world of organized crime. When he regained his freedom, he traveled extensively throughout Africa, the Middle East and even visited the Soviet Union. These trips changed his vision of the world and the struggle for civil liberties. He founded the Muslim Mosque, Inc., an Islamic organization, and the secular Organization of African-American Unity. Less than a year after leaving the Nation of Islam, Malcolm X was killed before giving a speech in New York.

Hope this helps

How did the invention of the plow change the lives of the Sumerians of Mesopotamia?

Answers

Plows created easier methods of farming for sumerians. With better farming technology, the sumerian empire expanded due to a crop surplus.
Sumerian farmers' invention of the plow helped them provide their city-states with a stable food supply

What was Galileo Galilei's personality like? How did he act around others?

Answers

Hehe ........................

China is geographically divided into ___________.

Tibet and the China Plain
Han China and Mongal China
Upper and Lower China
Inner and Outer China

Answers

A. Tibet and the China plain

I did this with my younger brother and he got it right :)
Tibet and the china plain

Complete the sentence. Remember to spell correctly.

______is the ability to understand something.

Answers

hey there Intuitive is the ability to understand something <3 :)
The answer is cognition.

(Repost) Which individual was appointed Governor by the Georgia state legislature?
A. Dr. Martin Luther King, Jr.
B. Benjamin Mays
C. Herman Talmadge
D. Eugene Talmadge

Answers

it’s Benjamin Mays! Thank you and bye!

What are the causes of demographic change (explain them)

Answers

Explanation:

Causes of demographic change. Rapid rates of urban growth were caused initially by migration. ... The pace of migration continued to slow during the 1970s and fell markedly during the 1980s. Migration explained around half of Santiago's growth during the 1960s but only 15 per cent between 1982 and 1992.

Congress tried to permanently protect civil rights for all African American by passing-
A) Black Codes
B) Civil rights act of 1866
C) Fourteenth Amendment
D) Fifteenth Amendment

Answers

B. Civil rights act of 1866

The Civil Rights Act of 1866 was an attempt by Congress to permanently preserve the civil rights of all African Americans. Hence, option (B) is the proper answer.

What do you know about the African American?

African Americans, also known as Americans and Americans, are a group of people who identify as white Americans but who may have some African ancestry. In general, those who were born in the United States and are considered to be  are considered to be so.

Following White Americans in terms of size, African Americans are the second-largest racial group in the United States. Following Hispanic and Latino Americans, they are the third-largest ethnic group.

Most African Americans are descended from slaves who lived within the borders of the current United States.  The majority of African Americans have some European heritage and are of West/Central African descent; some also have Native American and other ancestry.

Learn more about the African American, from :

brainly.com/question/24318057

#SPJ3

PLZZZZZZZZ HELP ITS DUE TMR

Answers

Answer:

Is best known as the consort and close companion of the great Athenian statesman pericles.

Answer:

D

Because Ancient Greek theology was polytheistic, based on the assumption that there were many gods and goddesses, as well as a range of lesser supernatural beings of various types. There was a hierarchy of deities, with Zeus, the king of the gods, having a level of control over all the others, although he was not

Decribe the impact that pericles had on Greece. Name one lasting contribution from his time.


What was Socrates´ nickname? Why


who fought in the Peloponnesian War? Who Won?

Answers

Answer:

Pericles transformed his city alliances into an empire and graced its Acropolis with the famous Parthenon.

Socrateś nickname was Gadfly because he was sent to the gods to act as a "gadfly"

The Peloponnesian War was fought between Athens and Sparta in Ancient Greece. Soon Sparta won the war in 404 BC.

name me some (un canon) DB, DBZ, DBGT, DBS guys. and tell me what therefrom or what they do, etc. (MOST "VALID" ANSWERS WILL GET BRANLIEST if done for points you get REPORTED)

Answers

Answer:

Pilaf Gang. 4.2 Red Ribbon Army. 4.3 King Piccolo. 4.4 Garlic Jr. 4.5 Frieza. 4.5.1 Zarbon and Dodoria. 4.5.2 Ginyu Force. 4.5.3 Nappa.

PLS HELLP THIS IS A TEST GRADE AND I CAN'T FAIL 20 POINT
What was one reason why the area where Mesopotamia was created is called the Fertile Crescent

A. Surrounding deserts made trade difficult.
B. seasonal flooding created rich soil
C. harsh winters made farming difficult.
D. Large mountains protected the area from storms

Answers

It’s B. The flooding from the surrounding rivers (from Tigris and Euphrates) brought silt into the land which helped the soil be rich.
Therefore , fertilized soil.
I believe it is b hope this helps , sorry if u get it wrong :(

Cause and effect
what is the effect
Rebuilt Athens after Persians burned it.

Answers

Answer:

Under Pericles, Athens was rebuilt. He erected new temples, monuments, and statues throughout the city."

Explanation:

The effect is that athens was rebuilt

Which of the following marches resulted in the passage of the voting rights act of 1965?
a. March on Birmingham
b. March on Selma
c. March on Washington DC
d. March on Jackson

Answers

Answer:

I got B. March on Selma..........

I got B aswell as the other guy

In a fictional presidential election year, economic growth is moving slowly and unemployment is high. Consumer prices are above average and increasing faster than normal. Survey results reveal that consumer confidence is low.Which qualifications for office a candidate would most likely emphasize in such an electoral climate?

A. success in building and developing businesses.

B. recognized by academic peers for theories on economic growth.

C. executive political experience and strong relationships with industry

D.military leadership experience with no previous connection to politics.

Answers

Answer: i think it is C

Explanation:

Answer:

A

Explanation:

Think about the contest described in the Article. How did the contest work? What did it show? Do you think that computers will be able to write poetry as well as people one day? Explain. Use facts and details from the Article to back up your answer.

Type your answer in the text box below.

Answers

Answer:

the answer is

Explanation:

Currently the answer is Yes! One can see examples on Bot or Not web pages in links below where one is invited to guess whether poems are written by a robot or a poet. There are poem-generating programs. There are also other web sites featuring examples of computer poetry.

Write an ACE response to the following question: "How did Petrarch contribute to the Renaissance Period?"

Thx if you help :/

Answers

Explanation:

Petrarch was a devoted classical scholar who is considered the "Father of Humanism," a philosophy that helped spark the Renaissance. Petrarch's writing includes well-known odes to Laura, his idealized love. His writing was also used to shape the modern Italian language.

In what ways has Istanbul connected Europe and Asia?

Please say it in like a short paragraph like 2-5 sentences il mark brainliest

Answers

you you you you you you are not getting an answer from me because I don't the answer to this?

During the era of the Silk Road, merchants from Europe would go through Istanbul to parts of Asia to trade for raw materials and/or merchandise. Some people prefer the land travel than sea voyage so Istanbul was definitely at their favour.

What were the main reasons for the Mexican Revolution?

Answers

Answer:

1- Despotic Government of Porfirio Díaz. Porfirio Díaz was a dictator who directed Mexico between 1877 and 1880, and later from 1884 to 1911.

2- Progress based on foreign capital.  

3- Absence of labor law.  

4- Land Disposal to Workers.  

5- Great gap of classes.  

6- Corruption.  

7- Denial of democracy

Explanation:

Answer:

The dictatorship-like rule of Porfirio Diaz for over 30 years.Exploitation and poor treatment of workers.Great disparity between rich and poor.

Explanation:

What crop can grow in rocky soil? ( Think of fast food)

Answers

Aloe Vera

Anemone

Catchfly


What are the different kinds of protists?

Answers

archaeplasitda
SAR
ciliophora
excavata
amoebozoa
hacrobia
hemimastigophora
apusoza
opisthokonta
plz mark me brainliest
Animal-like protists are called protozoa. Most consist of a single cell. ...
Plant-like protists are called algae. They include single-celled diatoms and multicellular seaweed. ...
Fungus-like protists are molds. They are absorptive feeders, found on decaying organic matter.

Why do you think the Space Race was so important in the Cold War? Why was winning so important?
Please answer in at least four sentences.

Answers

During the Cold War, the Soviet Union and the U.S.A had a lot of tension. They fought over everything, sometimes it was due to communism, trust, and other times, one of them just wanted to be better than the other. Then rockets came along, and the Space Race began. Whoever made a rocket reach outer space and land a man on the moon was bound to be the best out there. The United States and the Soviet Union took this as a chance to prove that they're better than each other. Although Russia (the Soviet Union) had the lead, the U.S knew they couldn't give up, so they continued to work extremely hard and took the lead, got a rocket in outer space, and landed a man on the moon. This was extremely important because the U.S was then known for having the strongest military, the best scientists, the best research, and overall, the strongest country.

The Space Race was considered important because it showed the world which country had the best science, technology, and economic system. After World War II both the United States and the Soviet Union realized how important rocket research would be to the military.

True or false
Pericles gave a speech reminding Spartans why it was worth fighting for democracy.

Answers

Answer:

FALSE: The Spartan navy defeated the weak Athenian army. Pericles gave a speech reminding Spartans why it was worth fighting for democracy.

Answer:

i believe it is false.

Explanation:

Other Questions
Which statement best describes a difference between a molecule of DNA and a molecule of RNA? A)DNA contains genetic informationwhile RNA does not B)RNA contains the letter in place of the letter T in DNA C)DNA has 1 strand, while RNA has 2 D)RNA uses the letter C. while DNA does not Why should police be able to use peoples DNA without consent? NEED HELP WITH THESE f(x)=x^2-x+1g(x) = 5 - 3xEvaluate the following.1) f(-1)2)g( -8)3)f( 1)4) g(5)5) f(3)6) g(-3) What is the relationship between tissues and organs?A. Tissues are made from a single, functional type of organ.B. Organs are made from a single, functional type of tissue.C. Organs are made from tissues with a similar structure and function.D. Tissues are made from organs with a similar structure and function. What is Isolated system Which describes the translation of ABCD to A'B'C'D'.A)translation 3 units right and 6 units uptranslation 6 units right and 3 units uptranslation 3 units left and 6 units downD)translation 6 units left and 3 units down The reticular formation ________.A) sets the rate of respiratory movementsB) contains nuclei and centers that regulate vital autonomic nervous system functionsC) relays somatic information to the ventral posterior nuclei of the thalamusD) regulates heart rate and force of contraction, and distribution of blood flowE) relays information from the spinal cord, the red nuclei, other midbrain centers, and the cerebral cortex to the vermis of the cerebellum Read the sentences.I want to be in London right now. I really want to see Big Ben and Buckingham Palace.Which sentence uses the subjunctive mood to express the ideas in the sentences?Going to London to see Big Ben and Buckingham Palace is a dream of mine.Going to London to see Big Ben and Buckingham Palace is a dream of mine. , ,I will go to London right now, and I will see Big Ben and Buckingham Palace.I will go to London right now, and I will see Big Ben and Buckingham Palace. , ,If I can get to London, I will see Big Ben and Buckingham Palace.If I can get to London, I will see Big Ben and Buckingham Palace. , ,If I were in London right now, I would go see Big Ben and Buckingham Palace.If I were in London right now, I would go see Big Ben and Buckingham Palace. , , Find the x and y intercept of this equation: -2x + 8y =4 write your solutions as a point in the form (x,y) How many repeats are there for this STR? Refer to the following DNA sequence to answer the questions: CTAGAAGCTTAAAGCTTCATCATCATCATCATCATCATTTAAGCTTCAAAGCTT At one time, dinosaurs were rulers of the earth. What are the nouns? Hello, I need help in this part of chemistry, I need the chemical names of the following four:1) B and F32) Se and I23) As2 and Se3ASAP! Please,,, 25 ft 8 yd 11 in.Which is greater? NO SCAM LINKS. please reply ASAP PLEASEEEE I'LL GIVE YOU BRAINLIEST!!Which is the best definition of air pressure? *1 pointthe weight of the air pressing on everything in the environmentthe amount of precipitation in a certain areathe type of clouds in the atmospherethe amount of water vapor in the air Can I have some help with this math? Pls hurry, I will mark brainliest Evaluate the expression 4 25 . A human resources manager selected a random sample of 200 workers who donate to charity. The following table shows the distribution of the 200 workers. Count Type of worker Management Other white collar 96 50 S Blue collar 54 The manager conducts a goodness-of-fit test to determine whether the proportions of workers of these types are identical to the population proportions of workers donating to charity, which are 50 percent for management, 30 percent for other white-collar workers, and 20 percent for blue-collar workers. Which of the following statements must be true about the sample?A. The expected number of blue-collar workers donating to charity is less than 30. B. The expected number of management workers donating to charity is 100. C. The expected numbers of other white collar and blue-collar workers donating to charity are the same. D. The expected number of other white-collar workers donating to charity is 50 E. The combined expected numbers of other white collar and blue-collar workers donating to charity is greater than the expected number of management workers donating to charity. a = 8: b = ; C = 10. Can someone help me I have to find the missing angles