please help! I will mark as branliest if you help

Please Help! I Will Mark As Branliest If You Help

Answers

Answer 1

Answer:

B.180°

Step-by-step explanation:

The sum of supplementary angles are always equal to 180, as you can see, the angles form a half circle which is 360/2. Hope this helps :)

Answer 2

Answer:

180

Step-by-step explanation:

Supplementary angles sum to 180 degrees


Related Questions

what is a = 1/2 (b-c) if b is the subject

Answers

Answer:

b = 2a + c

Step-by-step explanation:

Given

a = [tex]\frac{1}{2}[/tex] (b - c)

Multiply both sides by 2 to clear the fraction

2a = b - c ( add c to both sides )

2a + c = b

Alicia buys a 8-pound bag of rocks for a fish tank. She uses 3 1/8 pounds for a large fish bowl. How much is left? (Rename the 8 pound bag of rocks. Then subtract to find the correct answer.)

Answers

Answer:

4 7/8

Step-by-step explanation:

Total pound=8

Total used=3 1/8

Leftover=?

8-3 1/8

=8-25/8

L.C.M of 8 and 25/8 is 8

=.64-25 /8

=39/8

=4 7/8

need help with question 40!!!!

Answers

Answer:

0.84

Step-by-step explanation:

You got number 38 wrong. It should be 0.625

So number 39's answer should be the code.

0.84

sallys cup cake shop sold a total of 63 cupcakes yesterday and 32 of those had sprinkles how many cupcakes were sold without sprinkles

Answers

Answer:

31

Step-by-step explanation:

63-32=31

A circular table top has an area of 324 square inches. Which
measurement is closest to the radius of the table top in inches?

Answers

Answer:

10 inches (10.19)

Step-by-step explanation:

what is the perimeter of a semi-circle with a diameter of 14 units

Answers

Answer:

35.98

Step-by-step explanation:

To find the perimeter take 1/2 of the circumference plus the length of the diameter

P = 1/2 * pi *d + d

  =1/2 pi 14 +14

  = 7pi +14

Letting pi = 3.14

      7(3.14) + 14

   21.98 +14

        35.98

All rectangles have four right angles. Which quadrilateral is always a rectangle?
A) parallelogram
B) rhombus
C) square
D) trapezoid

Answers

Answer:

a

Step-by-step explanation:

A rectangle has two pairs of opposite sides parallel, and four right angles. It is also a parallelogram, since it has two pairs of parallel sides. A square has two pairs of parallel sides, four right angles, and all four sides are equal.

Answer:

A

Step-by-step explanation:

I need help with this, I don't understand how to do this.

Answers

Simple..A cyrcle first of all is a 360 degree angle...as a result

X=360-115-105-60

X=80 degrees

The coordinates of point A on a grid are (−4, 3). Point A is reflected across the y-axis to obtain point B. The coordinates of point B are (___, 3).

Answers

(4,3). When you reflect across the y axis, the X changes from negative (4) to positive (4)

Carlos needs 1.7 meters of wire for one project and 0.8 meters of wire for another project shade the model to represent the total amount of wire Carlos needs each full row represent 1.0 meters

Answers

Answer:

Step-by-step explanation:

Given that ;

Carlos needs 1.7 meters of wire for one project    &

0.8 meters of wire for another project

we are to shade the model to represent the total amount of wire Carlos needs .

NOW;

For both projects ; Carlos needs ( 1.7 + 0.8) meters of wire =  2.5 meters of wire

In  the  attached files below. the first picture shows the diagram attached to the question and the second one shows the shading of the model which represent the total amount of wire Carlos needs.

(9+m)(-m+9) in standard form

Answers

-9m+81-m^2+9m = 81 - m^2 (final answer since -9m and 9m cancels each other out)

Smh, what is this. If you answer this, please add a prove it statement. Thank you.​

Answers

28 slices
10 1/2 divided by 3/8 is 28
28 times 3/8 equals 10 1/2

Can I drink some nice internet juice

Answers

Answer: Um sure you can

What’s the answer????

Answers

Answer:

B. b = (24 x 16) - 8

Step-by-step explanation:

I chose this answer because there are 24 boxes with 16 baseballs in each of them. Pedro only used 8 of these baseballs, which means he didn't use (24 x 16) - 8 balls.

If this answer is correct, please make me Brainliest!

i need help answering

Answers

Answer:c

Step-by-step explanation:

Which term best describes two events that together include all of the outcomes in the sample space
a) Complementary
B) Unlikely
C) Independent
D)Disjoint

Answers

Answer:

Complementary

Step-by-step explanation:

When 2 things are complementary, they take up all given space.

When it's unlikely, it isn't all probability

Independent means they don't affect each other.

Disjoint means mutually exclusive.

Find the surface area of the prism.

Answers

Answer: ph+2b

Step-by-step explanation:

Answer:

920 ft²

Step-by-step explanation:

2 triangles + 3 rectangles

2(½×15×8) + 20(17+8+15)

120 + 800

920

Frankie puts £4000 in a bank account for 5 years with a 7.5% rate of interest. How much will be in the
account at the end of that time?

Answers

Answer:5500

Step-by-step explanation:

A submarine is 150 below sea level while an airplane is 375 above sea level. What is the difference between the height of the submarine and the airplane?

Answers

Answer:

[tex] D= 375 - (-150) m = 375m +150 m= 525 m[/tex]

So then the distance between the submarine and the airplace is 525 m

Step-by-step explanation:

For this case we know that the submarine is 150 m below the sea level and the airplane is 375 m above the sea level and we want to find the difference between the heights and we got:

[tex] D= 375 - (-150) m = 375m +150 m= 525 m[/tex]

So then the distance between the submarine and the airplace is 525 m

Ms.Sheppard cuts 1/2 of a piece of paper. She uses 1/6 of the piece to make a flower. What fraction of the sheet of paper does she use to make the flower?

Answers

Answer:

She uses [tex]\frac{1}{12}[/tex] of the sheet of paper to make the flower.

Step-by-step explanation:

She cuts 1/2 of a piece of paper.

Of what was cut, she used 1/6 to make a piece.

What fraction of the sheet of paper does she use to make the flower?

A sixth of one half. So

[tex]\frac{1}{6}*\frac{1}{2} = \frac{1}{12}[/tex]

She uses [tex]\frac{1}{12}[/tex] of the sheet of paper to make the flower.

A spinner has 5 equal sections numbered 1 to 5. What is the probability of the spinner stopping on a number that is a multiple of 2 or is less than 3?

HELPPPP!!!

Answers

Answer:

0.6

Step-by-step explanation:

Given that the spinner has 5 equal sections numbered 1 to 5.

Total Sample Space, n(S)=5

Multiples of 2 in 1 to 5 are: {2,4}

Number less than  than 3 are:{1,2}

Since we are required to find the probability of the spinner stopping on a number that is a multiple of 2 or is less than 3, we take the union of both sets.

{2,4} [tex]\cup[/tex] {1,2} ={1,2,4}

Number of Outcomes=3

Therefore,

Probability of the spinner stopping on a number that is a multiple of 2 or is less than 3  [tex]=\dfrac{3}{5}=0.6[/tex]

The elevation at the summit of Mount Whitney is 4,418 meters above sea level. Climbers begin at a trail head that has an elevation of 2,550 meters above sea level. What is the change in elevation, to the nearest foot, between the trail head and the summit?

(1 foot =0.3048 meters) *
A. 1868 ft
B. 569 ft
C. 6,128 ft
D. 6,129 ft

Answers

Answer:

D

Step-by-step explanation:

Firstly, to answer this question, we need to calculate the change in elevation.

Let’s just think of the question as, the distance from the foot of the mountain to the top is 4,418 meters. Now we have climbers starting at a height of 2,550 meters. We now need to know the difference or the distance to which they have climbed.

To calculate this is quite straightforward, all we need do is to subtract the starting point from the end position.

Mathematically that would be 4,418 - 2,550 = 1,868 meters

Now our answer need be in foot. we have a conversion system given in the question already.

1 foot = 0.3048 meters

x foot = 1,868 meters

x = 1,868/0.3048

x = 6,128.6 feet which is approximately 6,129 feet

a box cost $2.48, but it is on sale for $1.49. How much do you save on one box when bought on sale? Now how much would you save if you bought a second box?

Answers

Answer:

1. $0.99

2. $1.98

Step-by-step explanation:

1. From the question we have

Cost of box = $2.48

Selling price = $1.49

That is the box is discounted from $2.48 to $1.49

Therefore, amount saved = $2.48 - $1.49 = $0.99

2. The amount saved from buying a second box is hence;

2 × $0.99 = $1.98

Hence, as the number of boxes bought increases, the amount saved increases

Answer:

The answers to both questions are

1. You save $0.99 on the box when it is purchased on sale

This is calculated by subtracting on-sale price from pre-sale price:

$2.48-$1.49 = $0.99

2. Total amount saved when a second box is purchased on-sale price is derived by multiplying the amount saved on-sale purchase by two:

$0.99 x 2 (boxes)

$0.99 x 2 = $1.98

Cheers!

I need help pls answer as fast as posible

Answers

Answer:

1/8

Step-by-step explanation:

Answer:

1/7

Step-by-step explanation:

divide 6/42

Ursula surveyed 50 classmates about their favorite ice cream flavors. Each classmate chose one flavor. The results are shown in the circle graph.
Favorite Ice Cream Flavors

How many more of Ursula’s classmates chose chocolate than chose vanilla?

Answers

Answer:

8

Step-by-step explanation:

Vanillas percentage is 26%

26% of 50 is 13

Chocolates percentage is 42%

42% of 50 is 21

21-13=8

Using proportions, it is found that 8 more of Ursula’s classmates chose chocolate than chose vanilla.

In total, there are 50 students.

42% choose chocolate, hence:

[tex]0.42(50) = 21[/tex]

That is, 21 choose chocolate.

The sum is 100%, hence the percentage that choose vanilla is:

[tex]x + 14 + 18 + 42 = 100[/tex]

[tex]x = 100 - 74[/tex]

[tex]x = 26[/tex]

26%, out of 50, hence:

[tex]0.26(50) = 13[/tex]

13 choose vanilla.

21 - 13 = 8.

8 more of Ursula’s classmates chose chocolate than chose vanilla.

To learn more about proportions, you can check https://brainly.com/question/24372153

-8x+2y=12 in slope intercept form

Answers

Answer:

y= -4x + 3

Step-by-step explanation:

Answer:

y = 4x + 6

Step-by-step explanation:

He volume V (in cubic feet) of a right cylinder with a height of 5 feet and radius r (in feet) is given by V=5πr2. Solve the formula for r. Then find the radius of the cylinder when the volume is 770 cubic feet. Round your answer to the whole number.

Answers

Answer:

[tex] 770 = 5\pi r^2[/tex]

If we divide both sides by [tex] 5\pi[/tex] we got:

[tex] \frac{770}{5\pi} = r^2 [/tex]

And taking square root we got:

[tex] r = \sqrt{\frac{770}{5\pi}}= 7.001 ft[/tex]

And rounded to the nearest whole number we got 7 ft

Step-by-step explanation:

For this case we know that the hieght of a right cylinder is 5 ft and the volume is given by:

[tex] V = 5 \pi r^2 [/tex]

And we know that the volume [tex] V = 770 ft^3[/tex] and we want to solve for r so we can set up the following equation:

[tex] 770 = 5\pi r^2[/tex]

If we divide both sides by [tex] 5\pi[/tex] we got:

[tex] \frac{770}{5\pi} = r^2 [/tex]

And taking square root we got:

[tex] r = \sqrt{\frac{770}{5\pi}}= 7.001 ft[/tex]

And rounded to the nearest whole number we got 7 ft

BALLOON The angle of depression from a hot air balloon in the air to a person on the ground is 41°. If the person steps back 12 feet, the new angle of depression is 25°. If the person is 6 feet tall, how far off the ground is the hot air balloon?

Answers

Answer:

16.06 ft

Step-by-step explanation:

The figure is attached below.

In triangle ACB:

[tex]tan(41)=\frac{x}{y} \\x=ytan(41)[/tex]

In triangle ADB:

[tex]tan(25)=\frac{x}{y+10} \\(y+10)tan(41)=x[/tex]

Therefore equating both equations gives:

[tex]ytan(41) = (y+10)tan(25)\\ytan(41) = ytan(25)+10tan(25)\\ytan(41)-ytan(25)=10tan(25)\\y(tan(41)-tan(25))=10tan(25)\\y=\frac{10tan(25)}{(tan(41)-tan(25)} =11.5715ft[/tex]

Therefore x = 11.5715*tan(41) = 10.06 ft

The distance of the jot air balloon to ground = 10.06 + 6 = 16.06 ft

Write a real-world problem that could be solved with the inequality 23m + 4 > 96 Solve the problem with work shown. Write a sentence that explains the solution using the context from the real-world problem.

Answers

Answer:

The given inequality is

[tex]23m + 4 > 96[/tex]

Where [tex]m[/tex] represents minutes.

A problem that can be modeled by this inequality is:

Lucy earn $23 per minute, with an extra $4 due to punctuality, which must give more than $96 a day so she can make a living with that job. How many minutes does she need to work?

To solve the problem, we just solve the expression for [tex]m[/tex]

[tex]23m +4 > 96\\23m > 96-4\\23m > 92\\m > \frac{92}{23}\\ m > 4[/tex]

Therefore, Lucy needs to work more than 4 minutes in order to make a living with that job.

1 3 4 21
+ = + =
7 4



Answers

Answer:

i tried so i hope this helps you

Other Questions
EquationsWhat is the solution of the system of linear equations?-3x + 4y = -182x - y = 7(-2,-3)(-2,3)(2, -3)(2, 3) what is the area of the circle when the radius is 5 How does the narrator repeating My favorite at the beginning of every paragraph contribute to the story? (My favorite things by joy cowley) If 14 moles of Oxygen burn how many moles of water are created? *2C2H6+7024CO2 + 6 H2OA) 12 mol H20B) 3.5 mol H20C) 3 mol H20D) 42 mol H20 2x +6 = 8xwhat are the values of x here? can anybody give me some options and some tips for my portfolio poem. for school. free verse poem. Take 2 y2 - 3 y - 5 from y3 - 6 y2 + 5 y . Select the correct answer.A) y3 - 2 y2 + 3 y + 5B) y3 - 4 y2 + 2 y - 5C) y3 - 4 y2 + 2 y + 5D) y3 - 8 y2 + 8 y + 5 How many Liters are in 17.3 moles of Iron? What is the volume of a rectangular prism with a length of 2 inches, a width of an inch & is a quarter of an inch in height? Please help ASAP will mark brainliest Dextra Computing sells merchandise for $15,000 cash on September 30 (cost of merchandise is $12,000). The sales tax law requires Dextra to collect 5% sales tax on every dollar of merchandise sold. Record the entry for the $15,000 sale and its applicable sales tax. Also record the entry that shows the payment of the 5% tax on this sale to the state government on October 15. View transaction list Journal entry worksheet Record the cost of September 30th sales. Note: Enter debits before credits Date General Journal Debit Credit Sep 30 Record entry Clear entry View general journal Is the below sequence DNA or RNA? How do you know?GTTTACAGGCGGCGCAATATCTGATCG John and Ellen bought a big pizza. Ellen ate 2/4 of the pizza and John ate 1/3 of the pizza. How much did they eat all together? How much was left over? (Hint: 12 is the Lowest Common Denominator).(1/4 was wrong plss helppp) The following linear programming problem has been written to plan the production of two products. The company wants to maximize its profits. LaTeX: X_1=X 1 = number of product 1 produced in each batch LaTeX: X_2=X 2 = number of product 2 produced in each batch MAX: LaTeX: 150\:X_1+250\:X_2150 X 1 + 250 X 2 Subject to: LaTeX: 2\:X_1+5\:X_2\le2002 X 1 + 5 X 2 200 LaTeX: 3\:X_1+7\:X_2\le1753 X 1 + 7 X 2 175 LaTeX: X_1,\:X_2\ge0X 1 , X 2 0 How much profit is earned per each unit of product 2 produced? brainliest & points!i need help with math asap, show work too if possible :) Identify the vertex of the function graphed below.A. (1,2)B. (2,-1)C. (3,-2)D. (0,7) Poems are often ambiguous because _____. Which statement best describes the impact of the dust bowl?A. consumers brought more Texas crops when Kansas crops were destroyed B. Farmers on the Great Plains could not grow crops and many left for California C. Farmers increased their use of groundwater to irrigate their crops D. Workers migrated from the cities to the countryside to help grow food She is the singer to watch. The infinitive in this sentence is _____ and it is working as a(n) _____ .a. the singer, adjectiveb. to watch, adverbc. to watch, adjectived. the singer, adverb Which statement is the correct solution?