Plz do 3,2❤️ Plzzzzz urgent

Answer:

Explanation:

1.During glycolysis,four molecules of ATP are formed,and two are expended to cause the initial phosphorylation of glucose to get the process going.This gives a net gain of two molecules of ATP

For every glucose molecule that undergoes cellular respiration, the citric acid cycle is carried out twice; this is because glycolysis (the first stage of aerobic respiration) produces two pyruvate molecules per glucose molecule. During pyruvate oxidation (the second stage of aerobic respiration), each pyruvate molecule is converted into one molecule of acetyl-CoA—the input into the citric acid cycle. Therefore, for every glucose molecule, two acetyl-CoA molecules are produced. Each of the two acetyl-CoA molecules goes once through the citric acid cycle.

The citric acid cycle begins with the fusion of acetyl-CoA and oxaloacetate to form citric acid. For each acetyl-CoA molecule, the products of the citric acid cycle are two carbon dioxide molecules, three NADH molecules, one FADH2 molecule, and one GTP/ATP molecule. Therefore, for every glucose molecule (which generates two acetyl-CoA molecules), the citric acid cycle yields four carbon dioxide molecules, six NADH molecules, two FADH2 molecules, and two GTP/ATP molecules. The citric acid cycle also regenerates oxaloacetate, the molecule that starts the cycle.

While the ATP yield of the citric acid cycle is modest, the generation of coenzymes NADH and FADH2 is critical for ATP production in the final stage of cellular respiration, oxidative phosphorylation. These coenzymes act as electron carriers and donate their electrons to the electron transport chain, ultimately driving the production of most of the ATP produced by cellular respiration.

Answer:

The probability that their first child will both be ab/ab = 41%.

Explanation:

Available data:

The recombination frequency is given by the distance between genes. We have to know that 1% of recombinations = 1 map unit = 1cm.

Recombination frequency = 0.18

Man: AaBb

Gametes) AB Parental

                 ab Parental

                 Ab Recombinant

                 aB recombinant

18 centi morgan = 18 % of recombination in total  

                            = % aB + % Ab  

                            = 9% aB + 9% Ab

       100% - 18% = 82% of parental in total  

                           = % of AB + % ab  

                           = 41% AB + 41% ab

The frequency for each gamete is:

AB 41%

ab 41%

Ab 9%

aB 9%

Cross: man x woman

Parental)          AaBb           x          aabb

Gametes) AB, Ab, aB, ab        ab, ab, ab, ab

Punnett square)     AB ( 41%)       Ab (9%)      aB (9%)       ab (41%)

                   ab      AaBb               Aabb          aaBb            aabb

                   ab      AaBb               Aabb          aaBb            aabb

                   ab      AaBb               Aabb          aaBb            aabb

                   ab      AaBb               Aabb          aaBb            aabb

F1) 41% of the progeny is expected to be AaBb

     9% of the progeny is expected to be Aabb

     9% of the progeny is expected to be aaBb

     41% of the progeny is expected to be aabb

Answer:

Sessile organisms benefit from lower energy expenditure than motile creatures and can thus subsist on relatively low amounts of food, as they have a low metabolic rate.

Answer:

Codons after the mutation are not exactly the same as before mutation, because one base was deleted, changing the sequence of codons.

Codons before mutation:  ATG   TGC   GAA   ACT   TTG   GCT

Only the first one (ATG) might coincide with one of the codons before mutation.

Explanation:

Genetic information for the aminoacids assembly during the protein synthesis is stored in short sequences of three nucleotides named codons in the DNI or mRNA. Each of the codons represents one of the 20 amino acids used to build the protein. There are a total of 64 codons. 61 codify amino acids, one of these amino acids is also the start point of protein synthesis, and the left three codons are stopping translation points.

The Sequence before mutation ATGCTGCGAAACTTTGGCTGA

Codons: ATG   CTG   CGA   AAC   TTT   GGC   TGA

The Sequence after mutation ATGTGCGAAACTTTGGCTGA

Codons: ATG   TGC   GAA   ACT   TTG   GCT

Only the first one (ATG) might coincide with one of the codons before mutation.

Answer:

The chemical compounds that break down the insects are most likely BIOLOGICAL CATALYSTS. Venus Flytrap is a kind of carnivorous plant.9

hope it helps

Answer:

Due to presence on opposite side of the globe.

Explanation:

My model support the claim that  the Northern and Southern Hemispheres  have different seasons due to present on different location on the globe. The seasons in the Northern Hemisphere are different and opposite of those in the Southern Hemisphere. Seasons occur because Earth is tilted on its axis. This tilting causes summer in one location whereas winter in other location. The Earth's tilt causes the Southern Hemisphere to lean towards the Sun during summer season of Southern Hemisphere while on the other hand, it is winter season in the Northern Hemisphere which leans away from the Sun.

Answer: The right lung is shorter and wider than the left lung, and the left lung occupies a smaller volume than the right.

The lung houses structures of both the conducting and respiratory zones.

The left lung consists of three lobes.

The lungs exchange respiratory gases across a very large epithelial surface area—about 70 square meters

Explanation:

Answer: D. Although the British ultimately won the battle, they suffered heavy casualties.

Explanation: Even though they lost, the colonial forces were able to inflict a substantial amount of damage resulting in lots of casualties.

Answer:

1) GPP is the energy spent staying alive

Explanation:

Gross primary productivity is the energy that is spent by the organism to staying alive because energy is required by the organism for doing activities that is necessary for the survival. Gross primary productivity refers as the rate at which solar energy is captured in sugar molecules during the process of  photosynthesis. Producers such as plants use some of this energy for metabolism and cellular respiration as well as some for growth and building tissues.

Answer:

Our solar system and everything in it was created at roughly the same time.

Explanation:

The Big Bang theory

The Moon is about 4.51 billion years old – significantly older than previously thought. Previous studies had suggested that it formed about 150 million years after the solar system.

Eventually, erosion can break a crater down to virtually nothing. The Moon has almost no erosion because it has no atmosphere. That means it has no wind, it has no weather, and it certainly has no plants. Almost nothing can remove marks on its surface once they are made.

The Earth formed over 4.6 billion years ago out of a mixture of dust and gas around the young sun. It grew larger thanks to countless collisions between dust particles, asteroids, and other growing planets, including one last giant impact that threw enough rock, gas, and dust into space to form the moon.

Learn more about solar system here

https://brainly.com/question/1286910

#SPJ2

Answer:

The statement 'b. both occur only in reproductive cells' is true

Answer:

Simple carbohydrates are broken down quickly by the body to be used as energy. Simple carbohydrates are found naturally in foods such as fruits, milk, and milk products. They are also found in processed and refined sugars such as candy, table sugar, syrups, and soft drinks.

Answer:

the company has also announced plans

Answer:

Los autosomas o cromosomas autosómicos han sido ordenados de acuerdo a la morfología que poseen. ... Cada par de cromosomas son homólogos, es decir, contienen genes idénticos, con la misma ubicación a lo largo de cada cromosoma (locus). Ambos codifican para las mismas características genéticas.

Un autosoma es cualquier de los cromosomas, excepto los cromosomas sexuales. Los humanos tienen 22 pares de autosomas y un par de cromosomas sexuales (el par número 23, formado en las mujeres por dos cromosomas X y, en los hombres, un cromosoma X y un cromosoma Y).

The only thing you can do now is to try do the necessary pre-causion, which are;

Answer:

the answer is C. Marine protection, research and sanctuaries Act.

Answer:

variation is the answer that is genetic variation

Answer:

Chemotropism

Explanation:

Answer:

way of seeling and product that he/ she is seeling

Answer:

The products of mitosis are two diploid cells, whereas the products of meiosis are four haploid cells. -Mitosis and meiosis both begin with duplicated chromosomes. -In mitosis the daughter cells are genetically identical, but in meiosis the daughter cells are genetically varied.

Explanation:

Answer:

3) passive transport

Explanation:

Passive transport is a type of cellular transport that does not require the use of energy to move substances (i.e., ions and molecules) across biological membranes. Passive transport uses concentration gradients to move substances across cell membranes, thereby transporting them from regions of high concentration to regions of low concentration. Passive transport can be divided into 1-osmosis (i.e., movement of solvents), 2-diffusion (i.e., movement of solutes), and 3-facilitated diffusion (i.e., movement of molecules with help of protein channels or carriers), and 4-filtration (i.e., movement of water by using a pressure gradient).

Answer: moves particles from on area of low concentration to an area of high concentration

Explanation: Active transport differs from passive transport because active transport

can only move particles into the cell.

does not require energy to transport particles.

moves particles from an area of low concentration to an area of high concentration.

depends on the random movements of particles to carry them across the membrane.

EDG2023

Answer:

1) erodes

2)deposits

Explanation:

Answer:

D. Weight varies with location, but mass does not vary

Explanation:

Weight can be defined as the force acting on a body or an object as a result of gravity.

Mathematically, the weight of an object is given by the formula;

[tex] Weight = mg [/tex]

Where;

Mass can be defined as a measure of the amount of matter an object or a body comprises of. The standard unit of measurement of the mass of an object or a body is kilograms.

Irrespective of the location of an object or a body at a given moment in time, the mass (amount of matter that they're made up of) is constant. This ultimately implies that, whether you're in the moon, space, earth or any other place, your mass remains the same (constant).

Hence, the statement that correctly compares mass and weight is that, weight varies with location, but mass does not vary. This is simply because acceleration due to gravity changes with location i.e its value varies with the planets.

Answer:

In the seed is the energy required for a seedling to push up out of the ground comes from food stored in the seed.

Answer:

When this happens, gas may leak from the vehicle, having an effect on fuel economy, and potentially leading to a dangerous fire or explosion. If gasoline is leaking from the gas tank, you should be able to notice the leak underneath the rear of the vehicle accompanied by a noticeable smell.So that obviously has tank or cylinder is a leaking gasoline.

Explanation:

mark me as brainliest if it helped you >•<

Answer:

Hi, there your answer is D.Crossing Over

Hope This Helps

PLZ CORRECT ME IF I AM WRONG :)

Explanation:

Answer:

All the answers are there in the photo

Answer:

Fight initiation distance (FID) is the distance at which an animal will start to move away from an approaching threat such as a trail user.

hope this helps<3