Refer to the following selected financial information from McCormick, LLC. Compute the company's days' sales in inventory for Year 2. (Use 365 days a year.) Year 2 Year 1 Cash $ 38,900 $ 33,650 Short-term investments 104,000 67,000 Accounts receivable, net 92,500 86,500 Merchandise inventory 128,000 132,000 Prepaid expenses 13,500 11,100 Plant assets 395,000 345,000 Accounts payable 106,400 114,800 Net sales 718,000 683,000 Cost of goods sold 397,000 382,000

Answers

Answer 1

Answer:

47.0 days

Explanation:

As per the given question the solution of company's days' sales in inventory is provided below:-

Company's days sales uncollected for year 2 = Total number of days in a year × Accounts receivables ÷ Net sales

= 365 × $92,500 ÷ $718,000

= 365 × 0.1289

= 47.0 days

So, we have calculated the Company's days sales uncollected for year 2 by putting the values into the formula.


Related Questions

What accounting assumption, principle, or constraint would Target Corporation use in each of the situations below? (a) Target was involved in litigation over the last year. This litigation is disclosed in the financial statements. select an option (b) Target allocates the cost of its depreciable assets over the life it expects to receive revenue from these assets. select an option (c) Target records the purchase of a new Dell PC at its cash equivalent price. select an option

Answers

Answer:

a. ASC 450 (previously recognized as SFAS 5) includes the declaration of a risk in proceedings and there is at minimum a "fair probability" that a loss has been sustained, and the report must provide an estimation of the probable damage or extent of damage or a declaration that this very calculation is not practicable.

b. Three specific criteria dictate however much depreciation they can subtract: (1) the real estate value, (2) the property rehabilitation time and (3) the form of depreciation utilized. You can't actually subtract as an benefit the lease or interest contributions, or the cost of furniture, decorations and appliances. The depreciation will only be deducted on the specific property used during leasing purposes.

c. For overclockers as well as operation in the federation the Computer is still the obvious winner. If you want to change hardware to maintain the cutting edge of your program, then a Laptop is the way forward. Further software must be installed for the PC like a large and ever-growing free software computer collection. Even so, thanks to an embedded tool named "Boot camp," you can install a Windows ® operating system on a Mac along with PC applications

 

Assume that on February 1, Procter & Gamble (P&G) paid $674,400 in advance for 2 years’ insurance coverage. Prepare P&G’s February 1 journal entry and the annual adjusting entry on June 30. (Credit account titles are automatically indented when amount is entered. Do not indent manually. If no entry is required, select "No entry" for the account titles and enter 0 for the amounts. Record journal entries in the order presented in the problem.)

Answers

Answer:

February 1

Dr. Prepaid Insurance  $674,400

Cr. Cash                        $674,400

June 30

Dr. Insurance Expense $140,500

Cr. Prepaid Insurance   $140,500

Explanation:

Prepaid Expenses are those expense which have not been accrued yet but the payment against the future expense is made in advance.

On February 1 all the insurance is paid in advance so, it will be recorded in the prepaid insurance account.

On June 30 only 5 months are accrued in respect of Prepaid Insurance, So, the Insurance Expense of 5 months should be recorded and transferred from the prepaid insurance account.

Accrued Insurance Expense = $674,400 x 5/24 = $140,500

The balance sheets for Plasma Screens Corporation and additional information are provided below. PLASMA SCREENS CORPORATION Balance Sheets December 31, 2021 and 2020 2021 2020 Assets Current assets: Cash $ 242,000 $ 130,000 Accounts receivable 98,000 102,000 Inventory 105,000 90,000 Investments 5,000 3,000 Long-term assets: Land 580,000 580,000 Equipment 890,000 770,000 Less: Accumulated depreciation (528,000 ) (368,000 ) Total assets $ 1,392,000 $ 1,307,000 Liabilities and Stockholders' Equity Current liabilities: Accounts payable $ 109,000 $ 95,000 Interest payable 7,000 13,000 Income tax payable 9,000 6,000 Long-term liabilities: Notes payable 110,000 220,000 Stockholders' equity: Common stock 800,000 800,000 Retained earnings 357,000 173,000 Total liabilities and stockholders' equity $ 1,392,000 $ 1,307,000 Additional information for 2021: Net income is $184,000. Sales on account are $1,890,000. Cost of goods sold is $1,394,250. Required: 1. Calculate the following risk ratios for 2021:

Answers

Answer and Explanation:

The risk ratios are calculated below:

1.  Account Receivable Turnover

= Net credit Sales ÷ Average Accounts Receivable

= $1,890,000 ÷ (($98,000 + $102,000) ÷ 2)

= $1,890,000 ÷ $100,000

= 18.9 times

It shows the relation between the net credit sales and the average account receivable

2. Inventory Turnover = Cost of Goods Sold ÷ Average Inventory

= $1394250 ÷ (($105,000 + $90,000) ÷ 2)

= $1,394,250 ÷ $97,500

= 14.3 times

It shows the relation between the cost of goods sold and the average inventory

c.  Current Ratio = Current assets ÷ Current Liabilities

= ($242,000 + $98,000 + $105,000 + $5,000) ÷ ($109,000 + $7,000 + $9,000)

= $450,000 ÷ $125,000

= 3.6 times

It shows the relation between the current assets and the current liabilities

d.  Acid Test Ratio = Liquid assets ÷ Current Liabilities

= ($450,000 - $105,000) ÷ ($125,000 )

= $345,000 ÷ $125,000

= 2.76 times

It shows the relation between the liquid assets which do not involved prepaid assets, inventory, etc and the current liabilities

e. Debt to Equity = Debt ÷ Equity

= ($109,000 + $7,000 + $9,000 + $110,000) ÷  ($800,000  + $357,000 )

= $235,000 ÷ $1,157,000

= 0.203              

It shows the relation between the debt and equity

The risk ratios are determined as follows:

1.  Account Receivable Turnover

= Net credit Sales ÷ Average Accounts Receivable

= $1,890,000 ÷ (($98,000 + $102,000) ÷ 2)

= $1,890,000 ÷ $100,000

= 18.9 times

It represents the relationship between the net credit sales and the average account receivable.

2. Inventory Turnover = Cost of Goods Sold ÷ Average Inventory

= $1394250 ÷ (($105,000 + $90,000) ÷ 2)

= $1,394,250 ÷ $97,500

= 14.3 times

It represents the relationship between the cost of goods sold and the average inventory.

c.  Current Ratio = Current assets ÷ Current Liabilities

= ($242,000 + $98,000 + $105,000 + $5,000) ÷ ($109,000 + $7,000 + $9,000)  

= $450,000 ÷ $125,000  

= 3.6 times

It represents the relationship between the current assets and the current liabilities.

d.  Acid Test Ratio = Liquid assets ÷ Current Liabilities

= ($450,000 - $105,000) ÷ ($125,000 )

= $345,000 ÷ $125,000

= 2.76 times

It represents the relationship between the liquid assets in which it does include prepaid assets, inventory, etc and the current liabilities.

e. Debt to Equity = Debt ÷ Equity

= ($109,000 + $7,000 + $9,000 + $110,000) ÷  ($800,000  + $357,000 )

= $235,000 ÷ $1,157,000

= 0.203              

It represents the relationship between the debt and equity.

Learn more: brainly.com/question/19682087

In this assignment, you will develop a more personalized understanding of the Balanced Scorecard concept and see how your vision and mission can be linked to your goals and objectives. Using the S-M-A-R-T tools in section 6.7 of Chapter 6 in the text, create your own list of goals and objectives.

Create 4 to 5 S-M-A-R-T goals and objectives and demonstrate how they link to your Strategy Diamond and personal vision and mission statements.​

Answers

Explanation:

The following are my SMART goals:-

Specific

1. I want to be physically fit within 6 months on order to be able to run a marathon in less than 3 hours.

2. I want to become a manager in my current organization from my current position as an assistant manager within the next 3 years in order to be able lead a team.

3. I want to be a lovable dad to my daughter in the next 3 months so that I can spend more quality time with her.

4. I want to become an amazing husband to my wife by spending more quality time with her and also taking her on vacations in the next 6 months.

Measurable

1. I would start my training from next week. Initially I would run 3 to 5 kilometers with walk breaks.

2. I would talk to my boss next week to ask for more responsibilities and also to ask him to let me know what is required to get promoted.

3. I would start leaving office early by being more efficient and effective in the office. I will also take my daughter on walks and play with her for 1 hour daily.

4. I would come back from office early and spend time with my wife.

Attainable

1. I will talk to other marathoners to know whether my goal is attainable and will also research about it.

2. I will talk to my colleagues whom are managers about what they did to get promoted.

3. I will talk to other dads to know whether my goal is attainable.

4. I will talk to other husbands that are successful.

Realistic

When I start measuring my progress weekly and getting a feedback from people whom I admire, then I would know how realistic my goals are.

Timely

I have given a time frame for the attainment of all these goals which is very vital.

For implementing these goals, I m going to use the Plan-Do-Act-Dare cycle.

Since my objective is to become a well rounded person in my personal and also my professional life, the above steps will surely help me in becoming that person.

The strategy diamond will consist of:-

1. Arenas- Professional and Personal

2. Vehicles- Focus and hard work

3. Differentiation- Being different and unique from others.

4. Staging- Speed of initiatives

Also, there should be an economic logic binding this.

Teall Corporation has a standard cost system in which it applies manufacturing overhead to products on the basis of standard machine-hours (MHs). The company has provided the following data for the most recent month: Budgeted level of activity 9,000 MHs Actual level of activity 9,100 MHs Standard variable manufacturing overhead rate $ 6.20 per MH Budgeted fixed manufacturing overhead cost $ 55,000 Actual total variable manufacturing overhead $ 56,600 Actual total fixed manufacturing overhead $ 59,500 What was the fixed manufacturing overhead budget variance for the month?

Answers

Answer:

$4,500 U

Explanation:

Teall Corporation

Budget variance = Actual fixed overhead cost − Budgeted fixed overhead cost

Actual total fixed manufacturing overhead $ 59,500

Less Budgeted fixed manufacturing overhead cost $ 55,000

Fixed manufacturing overhead budget variance for the month $4,500 U

Therefore the fixed manufacturing overhead budget variance for the month is $4,500 U

Sheffield Co. is building a new hockey arena at a cost of $2,630,000. It received a downpayment of $520,000 from local businesses to support the project, and now needs to borrow $2,110,000 to complete the project. It therefore decides to issue $2,110,000 of 12%, 10-year bonds. These bonds were issued on January 1, 2019, and pay interest annually on each January 1. The bonds yield 11%. Sheffield paid $50,000 in bond issue costs related to the bond sale.
Required:
(a) Prepare the journal entry to record the issuance of the bonds and the related bond issue costs incurred on January 1, 2019.
(b) Prepare a bond amortization schedule up to and including January 1, 2023, using the effective-interest method.

Answers

Answer:

Explanation:

a.

Prepare the journal entry to record the issuance of the bonds on January 1, 2019.

Accounting homework question answer, step 1, image 1

Accounting homework question answer, step 1, image 2

Step 2

b.

Prepare a bond amortization schedule up to and including January 1, 2023, using the effective-interest method.

The file attached below has the calculations

Chiasso Co. reported a retained earnings balance of $200,000 at December 31, 2020. In September 2021, Chiasso determined that insurance premiums of $30,000 for the three-year period beginning January 1, 2020, had been paid and fully expensed in 2020. Chiasso has a 25% income tax rate. What amount should C report as adjusted beginning retained earnings in its 2021 statement of retained earnings?

Answers

Answer:

$215,000

Explanation:

Retained Earning is an equity account and its balance is credit in nature. It is the accumulated balance of all the prior year's income / losses after paying all the dividend. This balance can be used for the dividend payment or reinvestment in the business.

Any prior years adjustment in the revenue and expense will be recorded in the retained earning because it carry the accumulated profit all the prior years.

The premium on insurance for only one year should be recorded, but premium of 3 years is expense in 2020, from which there is an advance premium of 2 years.

Adjustment Value = $30,000 x 2/3 x (1-0.25) = $15,000

The adjustment should be added in the retained earning balance as it was expensed earlier.

Adjusted retained earning balance = $200,000 + $15,000 = $215,000

The following materials standards have been established for a particular product: Standard quantity per unit of output 5.3 pounds Standard price $ 14.10 per pound The following data pertain to operations concerning the product for the last month: Actual materials purchased 6,150 pounds Actual cost of materials purchased $ 63,780 Actual materials used in production 5,650 pounds Actual output 790 units The direct materials purchases variance is computed when the materials are purchased. What is the materials quantity variance for the month?The following materials standards have been established for a particular product: Standard quantity per unit of output 5.3 pounds Standard price $ 14.10 per pound The following data pertain to operations concerning the product for the last month: Actual materials purchased 6,150 pounds Actual cost of materials purchased $ 63,780 Actual materials used in production 5,650 pounds Actual output 790 units The direct materials purchases variance is computed when the materials are purchased. What is the materials quantity variance for the month?

Answers

Answer:

Direct material quantity variance= $20,628.3

Explanation:

Giving the following information:

Standard quantity per unit of output 5.3 pounds

Standard price $14.10 per pound

Actual materials used in production 5,650 pounds

Actual output 790 units

To calculate the direct material quantity variance, we need to use the following formula.

Direct material quantity variance= (standard quantity - actual quantity)*standard price

Direct material quantity variance= (5.3*790 - 5,650)*14.1

Direct material quantity variance= $20,628.3

The Donut Stop acquired equipment for $10,000. The company uses straight-line depreciation and estimates a residual value of $2,000 and a four-year service life. At the end of the second year, the company estimates that the equipment will be useful for four additional years, for a total service life of six years rather than the original four. At the same time, the company also changed the estimated residual value to $1,000 from the original estimate of $2,000. Calculate how much The Donut Stop should record each year for depreciation in years 3 to 6.

Answers

Answer:

Cost of Equipment: $10,000

Less Accumulated Depreciation ($10,000 - $2,000 / 4*2):   $4,000

= Book Value (End of Year 2):     $6,000

Less New Residual Value:       $-1,000

= New Depreciated Cost: $5,000

Remaining Service Life:  4

Annual Depreciation in Years 3 to 6 ($5,000 / 4):  $1,250

Rembrandt Paint Company had the following income statement items for the year ended December 31, 2021 ($ in thousands): Sales revenue $ 24,000 Cost of goods sold $ 13,500 Interest revenue 220 Selling and administrative expense 3,100 Interest expense 420 Restructuring costs 1,400 In addition, during the year the company completed the disposal of its plastics business and incurred a loss from operations of $2.2 million and a gain on disposal of the component’s assets of $3.2 million. 600,000 shares of common stock were outstanding throughout 2021. Income tax expense has not yet been recorded. The income tax rate is 25% on all items of income (loss). Required: Prepare a multiple-step income statement for 2021, including EPS disclosures. (Amounts to be deducted should be indicated with a minus sign. Enter your answers in thousands except earnings per share. Round EPS answers to 2 decimal places.)

Answers

Answer:

          Rembrandt Paint CompanyIncome Statement - December 31, 2021

Sales revenues                                                        $24,000,000

- Cost of goods sold                                               ($13,500,000)

Gross margin                                                           $10,500,000

Operating expenses:

- Selling and adm. expenses             ($420,000)

- Restructuring costs                        ($1,400,000)

Total operating expenses                                        ($1,820,000)

Income from operations                                          $8,620,000

Other revenue and expenses:

Gain on sales of assets                   $3,200,000  

Interest revenue                                 $220,000

Loss from discontinued oper.       ($2,200,000)

Interest expense                               ($420,000)

Total other revenue and expenses                             $800,000

Net income pre-tax                                                   $9,420,000

Income taxes (25%)                                                  ($2,355,000)

Net income after taxes                                             $7,065,000

Shares outstanding                                                        600,000

Earnings per share (EPS)                                                    $11.78

   

Paolucci Corporation's relevant range of activity is 8,400 units to 17,000 units. When it produces and sells 12,700 units, its average costs per unit are as follows: Average Cost per Unit Direct materials $ 7.10 Direct labor $ 4.00 Variable manufacturing overhead $ 2.00 Fixed manufacturing overhead $ 3.60 Fixed selling expense $ 1.30 Fixed administrative expense $ 0.60 Sales commissions $ 1.25 Variable administrative expense $ 0.50 If 11,700 units are sold, the variable cost per unit sold is closest to:

Answers

Answer:

The variable cost per unit sold is closest to $14.85

Explanation:

In order to calculate the variable cost per unit sold we would have to use the following formula:

Total variable cost per unit=(Direct materials+Direct labor+Variable manufacturing overheads+Sales commissions+Variable adminsitrative expenses)

Therefore,Total variable cost per unit=$7.10+$4.00+$2.00+$1.25+$0.50

Total variable cost per unit=$14.85

The variable cost per unit sold is closest to $14.85

When China reformed state-owned enterprises, it tried a new approach to choosing managers: it put managerial jobs up for auction. The bids for the jobs consisted of promises of future profit streams that the managers would generate and then deliver to the state. In cases where the incumbent manager was the winning bidder, firm productivity tended to increase dramatically. When outside bidders won, there was little productivity improvement. If incumbent managers were not generally more qualified, how can you explain this result?

Answers

Answer: The explanation is provided below

Explanation:

An outsider tend to overbid with a eye to get the job while, an insider manager bids a realistic performance that is achievable. An insider manager understands the factors which affect the organization's performance and then tries to take control of the factors.

People make or break organizations and there is a greater chance of the insider getting the support and cooperation of the employees in comparision to outside bidders. Also, an insider manager has a prospective that is long term with regard to his or her association with the enterprise while an outsider may come and then realize that he doesn't like the organization and then leave for a better enterprise.

Therefore internal managers are a better prospect of being given the responsibility to manage the enterprise.

Answer:

Explanation:

A stranger tends to bid excessively  to get the job. In contrast, the internal manager offers realistic, achievable performance. The internal manager understands the factors that influence the organization's performance and tries to take control of it. There is a greater chance that an insider will get employee support and cooperation than strangers . Insider manager has been in the organisation for and already know the rules that guide the company, The Dos ans Donts.. A stranger have lilttle or no knowledge about how the company is run and  can choose to stay or  he will go to a better company. Therefore, internal managers are in good position for   taking responsibility for running the welfare and activites of a company.

For the cost and price functions below, find



a. the number, q, of units that produces maximum profit



b. the price, p, per unit that produces maximum profit



c. the maximum profit, P.



C(q) = 70 + 17q



p = 77 - 2q

Answers

Answer:

a) The number, q, of units that produces maximum profit = 15

b) The price, p, per unit that produces maximum profit = 47 (currency not giben in the question)

c) Maximum Profit = P = 380 (currency not given in the question).

Explanation:

The cost function and price per unit function are given respectively as

C(q) = 70 + 17q

p = 77 - 2q

where q = quantity or number of units

a.) the number, q, of units that produces maximum profit

Total cost = C(q) = 70 + 17q

Revenue = (price per unit) × (Number of units) = p × q = (77 - 2q) × q = (77q - 2q²)

Profits = P(q) = (Revenue) - (Total Cost)

P(q) = (77q - 2q²) - (70 + 17q)

P(q) = -2q² + 60q - 70

To maximize the profits, we just obtain the point where the profit function reaches a Maximum.

At the maximum of a function, (dP/dq) = 0 and (d²P/dq²) < 0

Profit = P(q) = -2q² + 60q - 70

(dP/dq) = -4q + 60

At maximum point,

(dP/dq) = -4q + 60 = 0

q = (60/4) = 15

(d²P/dQ²) = -4 < 0 (hence, showing that the this point corresponds to a maximum point truly)

Hence, the number, q, of units that produces maximum profit = 15.

b.) the price, p, per unit that produces maximum profit

The price per unit is given as

p = 77 - 2q

Maximum profit occurs at q = 15

p = 77 - (2×15) = 47

Hence, the price, p, per unit that produces maximum profit = 47 (currency not given in the question)

c.) the maximum profit, P.

The Profit function is given as

Profit = P(q) = -2q² + 60q - 70

At maximum Profit, q = 15

Maximum Profit = P(15)

= -2(15²) + 60(15) - 70

= 380 (currency not given in the question).

Hope this Helps!!!

A) The number, q, of units that produce maximum profit is = 15

B) The price, p, per unit that creates maximum profit is = 47

C) Maximum Profit is = P = 380

What is the cost and price function?

When The cost procedure and price per unit procedure are presented respectively as:

C(q) is = 70 + 17q

p is = 77 - 2q

where that q is = quantity or number of units

a.) When the number, q, of units that produce maximum profit

The Total cost is = C(q) = 70 + 17q

When the Revenue is = (price per unit) × (Number of units) that is = p × q = (77 - 2q) × q is = (77q - 2q²)

After that Profits is = P(q) = (Revenue) - (Total Cost)

Then P(q) is = (77q - 2q²) - (70 + 17q)

Now, P(q) is = -2q² + 60q - 70

When To maximize the profits, Then we just obtain the point where the profit function reaches a Maximum.

When At the maximum of a function, (dP/dq) is = 0 and (d²P/dq²) < 0

Profit is = P(q) = -2q² + 60q - 70

(dP/dq) is = -4q + 60

Then At maximum point are:

(dP/dq) is = -4q + 60 = 0

After that, q = (60/4) = 15

Then (d²P/dQ²) = -4 < 0 (hence, showing that this point corresponds to a maximum point truly)

Therefore, the number, q, of units that produce maximum profit is = 15.

b.) When the price, p, per unit that produces maximum profit

The price per unit is given as

p is = 77 - 2q

Then Maximum profit occurs at q is = 15

p is = 77 - (2×15) = 47

Therefore, the price, p, per unit that produces maximum profit is = 47 (currency not provided in the question)

c.) When the maximum profit, P.

The Profit function is given as

Profit is = P(q) = -2q² + 60q - 70

Then At maximum Profit, q = 15

So, The Maximum Profit is = P(15)

Then = -2(15²) + 60(15) - 70

Therefore, = 380 (currency not given in the question).

Find more information Cost and price function here:

https://brainly.com/question/17185609

19. Jay is a member of Klondike Coffee, LLC, a limited liability company. Jay is liable for Klondike's debts a. in proportion to the total number of members. b. to the extent of his investment in the firm. c. to the extent that the other members do not pay the debts. d. to the full extent.

Answers

Answer: . b. to the extent of his investment in the firm.

Explanation:

In a Limited Liability Company, the legal characteristics of the company is that the owners be liable for debts only up to the amount of capital that they invested. That is where the name comes from because the liability that the owners can take on are limited.

For instance, if in the above scenario Klondike went bankrupt and owed people $3,000. If all Jay had invested was $1,000, the maximum amount that can be taken from Jay is his $1,000 capital and nothing more.

Offenbach & Son has just made its sales forecasts and its marketing department estimates that the company will sell 232,200 units during the coming year. In the past, management has maintained inventories of finished goods at approximately one month’s sales. The inventory at the start of the budget period is 15,600 units. Sales occur evenly throughout the year. Required: Estimate the production level required for the coming year to meet these objectives.

Answers

Answer:

Production= 235,950 units

Explanation:

Giving the following information:

Sales= 232,200 units during the coming year.

Desired ending inventory= one month's sales

Beginning inventory= 15,600 units.

First, we need to calculate the desired ending inventory:

Desired ending inventory= 232,200/12= 19,350

Now, we can determine the production for the year:

Production= sales + desired ending inventory - beginning inventory

Production= 232,200 + 19,350 - 15,600

Production= 235,950 units

Depreciation by Two Methods A storage tank acquired at the beginning of the fiscal year at a cost of $80,000 has an estimated residual value of $4,000 and an estimated useful life of 20 years. a. Determine the amount of annual depreciation by the straight-line method. $ b. Determine the amount of depreciation for the first and second years computed by the double-declining-balance method. Do not round the double-declining balance rate. If required, round your answers to the nearest dollar.

Answers

Answer:

a. Annual depreciation = $3,800

b. First year depreciation is $8,000' while second year depreciation is $7,200.

Explanation:

a. Determine the amount of annual depreciation by the straight-line method.

Depreciable amount = $80,000 - $4,000 = $76,000

Annual depreciation = $76,000 / 20 = $3,800

b. Determine the amount of depreciation for the first and second years computed by the double-declining-balance method. Do not round the double-declining balance rate. If required, round your answers to the nearest dollar.

Straight line depreciation rate = 1 / 20 = 0.05, or 5%

Double declining depreciation rate = 5% * 2 = 10%

First year depreciation = $80,000 * 10% = $8,000

Second year depreciation = ($80,000 - $8,000) * 10% = $7,200

The Red Wolf Society, a nongovernmental not-for-profit organization, receives numerous contributed hours from volunteers during its busy season. Tom, a clerk at the local government utility’s office, volunteered ten hours per week for 8 weeks transferring wolf food from the port to the wolf shelter. His rate of pay at the utility office is $20 per hour, and the prevailing wage rate for laborers is $15 per hour. What amount of contribution revenue should Red Wolf Society record for this service? Multiple Choice $1,200 $400 $1,600 $0

Answers

Answer:

$1,600

Explanation:

Revenue is recognized as and when the control of a good or service is transferred to the customer.

Total Hours = 10 hours × 8 weeks

                    = 80 hours

Use the rate of pay at the utility office to determine the contribution revenue for Red Wolf Society

Revenue = 80 hours × $20 per hour

               = $1,600

Schwiesow Corporation has provided the following information: Cost per Unit Cost per Period Direct materials $ 7.05 Direct labor $ 3.50 Variable manufacturing overhead $ 1.65 Fixed manufacturing overhead $ 11,000 Sales commissions $ 1.00 Variable administrative expense $ 0.40 Fixed selling and administrative expense $ 5,500 If the selling price is $18.70 per unit, the contribution margin per unit sold is closest to:

Answers

Answer:

The contribution margin per unit is $5.1

Explanation:

The contribution margin per unit is the amount from selling price per unit after deducting all the related variable costs per unit. This is the amount that each product contributes towards covering the fixed costs.

Contribution margin per unit:

Selling price per unit                              18.7

Less : Variable cost per unit

Direct material                                       (7.05)

Direct labor                                             (3.5)

Variable manufacturing Overhead       (1.65)

Sales commission                                  (1.00)

Variable Admin expense                      (0.40)

Contribution margin per unit                  5.1

(Ignore income taxes in this problem) The management of Serpas Corporation is considering the purchase of a machine that would cost $180,000, would last for 5 years, and would have no salvage value. The machine would reduce labor and other costs by $46,000 per year. The company requires a minimum pretax return of 13% on all investment projects. The net present value of the proposed project is closest to:

Answers

Answer:

-$18,207

Explanation:

Net present value is the Net value all cash inflows and outflows in present value term. All the cash flows are discounted using a required rate of return.

Net Present Value = Initial Investment + Present value of reduced Labor and other costs

Net Present value = -$180,000 + $46,000( 1 - ( 1 + 13% )^-5 / 13% )

Net Present value = -$180,000 +  161,793

Net Present value = -$18,207

Fixed expenses are $384,000 per month. The company is currently selling 6,000 units per month. The marketing manager would like to introduce sales commissions as an incentive for the sales staff. The marketing manager has proposed a commission of $9 per unit. In exchange, the sales staff would accept a decrease in their salaries of $46,000 per month. (This is the company's savings for the entire sales staff.) The marketing manager predicts that introducing this sales incentive would increase monthly sales by 500 units. What should be the overall effect on the company's monthly net operating income of this change?

Answers

Answer:

A reduction of $12,500 in net operating income

Explanation:

The net operating income/loss is the difference between the sales and the total costs.

The change in the company's net operating income is the net of the increased commission and the total decrease in salaries. The commission is a variable cost that is dependent on the total number of units sold.

Hence the overall effect on the company's monthly net operating income of this change

= $46,000 - ($9 * 6500)

= ($12,500)

Suire Corporation is considering dropping product D14E. Data from the company's accounting system appear below: Sales $ 600,000 Variable expenses $ 241,000 Fixed manufacturing expenses $ 232,000 Fixed selling and administrative expenses $ 180,000 All fixed expenses of the company are fully allocated to products in the company's accounting system. Further investigation has revealed that $192,500 of the fixed manufacturing expenses and $107,500 of the fixed selling and administrative expenses are avoidable if product D14E is discontinued. Required: a. According to the company's accounting system, what is the net operating income earned by product D14E

Answers

Answer:

$127,000

Explanation:

Suire Corporation Net operating income

Sales $ 600,000

Variable Costs $ 241,000

Contribution Margin $ 359,000

Fixed Expenses $232,000

Net Operating Income $127,000

On January 1, 2017, Shamrock Inc. issued $400,000 of 7%, 5-year bonds at par. Interest is payable semiannually on July 1 and January 1. Prepare journal entries to record the following. (Credit account titles are automatically indented when the amount is entered. Do not indent manually. If no entry is required, select "No Entry" for the account titles and enter 0 for the amounts. Record journal entries in the order presented in the problem.) (a) The issuance of the bonds. (b) The payment of interest on July 1. (c) The accrual of interest on December 31.

Answers

Answer and Explanation:

The journal entries are shown below:

On Jan 1

Cash $400,000

           To Bonds payable  $400,000

(Being the bond is issued for cash)

For recording this we debited the cash as it increased the assets and at the same time it increased the liabilities so the bond payable is credited

On July 1

Interest expense  $14,000

             To Cash  $14,000

(Being the payment of interest is recorded)

The computation is shown below:

= $400,000 × 7% × 6 months ÷ 12 months

= $14,000

For recording this we debited the expenses as it increased the expenses and at the same time it decreased the assets so the cash is credited

On Dec 31

Interest expense $14,000

           To Interest payable $14,000

(Being the accrual of interest is recorded)

For recording this we debited the expenses as it increased the expenses and at the same time it increased the liabilities so the interest payable is credited

Garison Music Emporium carries a wide variety of musical instruments, sound reproduction equipment, recorded music, and sheet music. Garison uses two sales promotion techniques— warranties and premiums— to attract customers.
Below is the information to answer the required question.
a. Musical instruments and sound equipment are sold with a one- year warranty for replacement of parts and labor. The estimated warranty cost, based on past experience, is 2% of sales.
b. The premium is offered on the recorded and sheet music. Customers receive a coupon for each dollar spent on recorded music or sheet music. Customers may exchange 200 coupons and $ 20 for a CD player. Garison pays $ 32 for each CD player and estimates that 60% of the coupons given to customers will be redeemed.
c. Garison’s total sales for 2010 were $ 7,200,000—$ 5,700,000 from musical instruments and sound reproduction equipment and $ 1,500,000 from recorded music and sheet music.
d. Replacement parts and labor for warranty work totaled $ 164,000 during 2010.
e. A total of 6,500 CD players used in the premium program were purchased during the year and there were 1,200,000 coupons redeemed in 2010.
f. The accrual method is used by Garison to account for the warranty and premium costs for financial reporting purposes.
The balances in the accounts related to warranties and premiums on January 1, 2010, were as shown below.
Inventory of Premium CD Players $ 37,600
Estimated Premium Claims Outstanding 44,800
Estimated Liability from Warranties 136,000
Question:
(a) Garison Music Emporium is preparing its financial statements for the year ended December 31, 2010. Determine the amounts that will be shown on the 2010 financial statements for the following.
(1) Warranty Expense -
(2) Estimated Liability from Warranties -
(3) Premium Expense -
(4) Inventory of Premium CD Players -
(5) Estimated Premium Claims Outstanding -

Answers

Answer:

Explanation:

(a)

Given:

Warranty exp = 2% of musical instrument & sound equipment

Calculation:

Warranty exp = Warranty exp * 5,424,000

Warranty exp = 2% * 5,424,000

Warranty exp = 108,480

(b)

Warranty liability as on December 2017 = Opening Balance + Warranty Expense - Warranty Claim

Warranty liability as on December 2017 = 138,000 + 108,480 - 156,400

Warranty liability as on December 2017 = $90,080

(c)

The customer receives one coupon for each dollar spend 2,138,000 only 50% coupon will be redeemed.

Exp provision liability created = 50% * 2,138,000

Exp provision liability created = 1,069,000

Customer can exchange 200 coupon & $30 for MP3 player which is purchase for 42 that mean 200 coupon will be for 12 i.e. (42-30) value of coupon will be

12

200

= 0.06.

Value of 1,069,000 coupon = 1,069,000 * 0.06

Value of 1,069,000 coupon = 64,140

(d)

1,138,000 coupons had been redeemed during the year each MP3 player required 200 coupons.

N

o

o

f

M

P

3

p

l

a

y

e

r

o

f

f

e

r

e

d

=

1

,

138

,

000

200

N

o

o

f

M

P

3

p

l

a

y

e

r

o

f

f

e

r

e

d

=

5

,

690

M

P

3

p

l

a

y

e

r

Cost = 5,690 * 42

Cost = 238,980

Inventory Premium = Opening Balance + Purchases - Utilized Redeemed Coupon

Inventory Premium = 39,210 + (7,010 * 42) - 238,980

Inventory Premium = 39,210 + 294,420 - 238,980

Inventory Premium = $94,650

(e)

Premium liability balance = Opening Balance + Premium Exp Provision - Coupon Redeemed

Premium liability balance = 41,670 + 64,140 - (1,138,000 * 0.06)

Premium liability balance = 41,670 + 64,140 - 68,280

Premium liability balance = 37,530

Which of the following statement(s) is(are) true regarding municipal bonds? I) A municipal bond is a debt obligation issued by state or local governments. II) A municipal bond is a debt obligation issued by the federal government. III) The interest income from a municipal bond is exempt from federal income taxation. IV) The interest income from a municipal bond is exempt from state and local taxation in the issuing state.

Answers

Answer:

I, III and IV Only.

Explanation:

A municipal bond is explained to be a debt obligation issued by a nonprofit organization, a private-sector corporation or another public entity using the loan for public projects such as constructing schools, hospitals and highways.

A municipal bond is categorized based on the source of its interest payments and principal repayments. A bond can be structured in different ways offering various benefits, risks and tax treatments. Income generated by a municipal bond may be taxable.

Answer: I) A municipal bond is a debt obligation issued by state or local governments.

III) The interest income from a municipal bond is exempt from federal income taxation.

IV) The interest income from a municipal bond is exempt from state and local taxation in the issuing state.

Explanation:

A municipal bond is usually a debt security issued by a state, or local government to finance its capital expenditures, which usually includes the construction of Roads, Bridges or Institutions( schools ). They can be considered as loans that an investor gives to local governments. This kind of bonds are exempted from federal taxes and most state and local taxes, Which makes them very attractive to interested individuals who are on high income tax brackets.

Bramble Company purchased equipment on January 1, 2018 at a total invoice cost of $347000; additional costs of $5000 for freight and $32000 for installation were incurred. The equipment has an estimated salvage value of $11000 and an estimated useful life of five years. The amount of accumulated depreciation at December 31, 2019 if the straight-line method of depreciation is used is:__________
a. $153600.
b. $136400.
c. $134400.
d. $149200.

Answers

Answer:

d. $149200.

Explanation:

Depreciation is a method used in expensing the cost of an asset.

Deprecation expense using the straight line method = (Cost of asset - Salvage value) / useful life

Cost of asset = $347,000 + $5,000 + $32,000 = $384,000

( $384,000 - $11,000) / 5 = $74,600

Deprecation expense each year would be $74,600.

Accumulated depreciation in 2019 would be the sum of deprecation expense in 2018 and 2019

$74,600 × 2 = $149,200

I hope my answer helps you

Current liabilities are obligations that are reasonably expected to be paid from Existing Creation of Other Current Assets Current Liabilities a. No No b. Yes Yes c. Yes No d. No Yes

Answers

Answer:

The answer is option C) Yes No

Explanation:

Current liabilities are obligations that are reasonably expected to be paid from Existing Creation of Other Current Assets and not current liabilities.

This is because, Current liabilities are short term liabilities due within a year. They include accounts payable, short term debt and overdraft. This means that payment can only be generated by current assets.

Current assets are also short term assets with a life span of on year. They include accounts receivable an cash.

Therefore, Yes, Current liabilities are obligations that are reasonably expected to be paid from Existing Creation of Other Current Assets.

And No, Current liabilities are obligations that are not expected to be paid from Existing Creation of Other Current Liabilities.

Mcfarlain Corporation is presently making part U98 that is used in one of its products. A total of 18,000 units of this part are produced and used every year. The company's Accounting Department reports the following costs of producing the part at this level of activity: Per Unit Direct materials $ 4.70 Direct labor $ 4.20 Variable overhead $ 1.70 Supervisor's salary $ 5.10 Depreciation of special equipment $ 5.10 Allocated general overhead $ 5.50 An outside supplier has offered to produce and sell the part to the company for $22.80 each. If this offer is accepted, the supervisor's salary and all of the variable costs, including direct labor, can be avoided. The special equipment used to make the part was purchased many years ago and has no salvage value or other use. The allocated general overhead represents fixed costs of the entire company, none of which would be avoided if the part were purchased instead of produced internally. In addition to the facts given above, assume that the space used to produce part U98 could be used to make more of one of the company's other products, generating an additional segment margin of $73,100 per year for that product. What would be the financial advantage (disadvantage) of buying part U98 from the outside supplier and using the freed space to make more of the other product

Answers

Answer:

company's net profit will decrease by $54,700

Explanation:

the avoidable costs of producing part U98 are:

direct materials = $4.70direct labor = $4.20variable overhead = $1.70supervisor's salary = $5.10total cost per unit = $15.70

avoidable cost of producing 18,000 units = 18,000 x $15.70 = $282,600

depreciation of special equipment and fixed overhead costs are not avoidable.

revenue generated by using the spare plant area = $73,100

total relevant savings and additional revenue = $355,700

if you purchase the product from a vendor, total costs will be:

purchase price = 18,000 x $22.80 = $410,400

Since the total cost of purchasing the parts is higher than the relevant savings and additional revenue, then the company's net profit will decrease by = $410,400 - $355,700 = $54,700

Indigo Incorporated factored $135,100 of accounts receivable with Sweet Factors Inc. on a without-recourse basis. Sweet assesses a 3% finance charge of the amount of accounts receivable and retains an amount equal to 7% of accounts receivable for possible adjustments. Prepare the journal entry for Indigo Incorporated and Sweet Factors to record the factoring of the accounts receivable to Sweet.

Answers

Answer:

Indigo Incorporated Journal entrie

Dr Cash 121,590

Dr Due from Factor 9,457

Dr Loss on Sale of Receivable 4,053

Cr Accounts Receivable 135,100

Sweet Factors Inc

Dr Account Receivable 135,100

Cr Due to Customer 9,457

Cr Finance Revenue 4,053

Cr Cash 121,590

Explanation:

Indigo Incorporated Journal entries

Dr Cash 121,590

Dr Due from Factor 9,457

Dr Loss on Sale of Receivable 4,053

Cr Accounts Receivable 135,100

Sweet Factors Inc

Dr Account Receivable 135,100

Cr Due to Customer 9,457

Cr Finance Revenue 4,053

Cr Cash 121,590

Due from Factor = 7% x $135,100 = $9,457

Loss on Sale of Receivables = 3% x $135,100= $4,053

Majer Corporation makes a product with the following standard costs: Standard Quantity or Hours Standard Price or Rate Standard Cost Per Unit Direct materials 6.2 ounces $ 4.00 per ounce $ 24.80 Direct labor 0.5 hours $ 17.00 per hour $ 8.50 Variable overhead 0.5 hours $ 4.00 per hour $ 2.00 The company reported the following results concerning this product in February. Originally budgeted output 4,900 units Actual output 5,000 units Raw materials used in production 30,200 ounces Actual direct labor-hours 2,080 hours Purchases of raw materials 32,600 ounces Actual price of raw materials $ 67.10 per ounce Actual direct labor rate $ 57.60 per hour Actual variable overhead rate $ 5.80 per hour The company applies variable overhead on the basis of direct labor-hours. The direct materials purchases variance is computed when the materials are purchased. The variable overhead efficiency variance for February is:

Answers

Answer:

Variable overhead efficiency variance $1,680  Favorable

Explanation:

Variable overhead efficiency variance:  Variable overhead efficiency variance aims to determine whether or not their exist savings or extra cost incurred on variable overhead as a result of workers being faster or slower that expected.

Since the variable overhead is charged using labour hours, any amount by which the actual labour hours differ from the standard allowable hours would result in a variance

                                                                                                      Hours

5000 units should have taken (5000×0.5 hours)                    2,500

but did take                                                                                 2,080  

Labour hours variance                                                                 420  favorable

Standard variable overhead rate                                             ×$ 4.00 per hour

Variable overhead efficiency variance                                   $1,680  Favorable

                 

                                                             

Stephanie wants to save for her daughter's education. Tuition costs $12,000 per year in today's dollars. Her daughter was born today and will go to school starting at age 18. She will go to school for 5 years. Stephanie can earn 12% on her investments and tuition inflation is 6%. How much must Stephanie save at the end of each year if she wants to make her last savings payment at the beginning of her daughter's first year of college

Answers

Answer:

Annual deposit= $3,463.37

Explanation:

Giving the following information:

Tuition costs $12,000 per year in today's dollars.

Number of years= 18

She will go to school for 5 years.

Stephanie can earn 12% on her investments and tuition inflation is 6%.

First, we need to calculate the cost of each year and the total cost.

FV= PV*(1+i)^n

Year 1= 12,000*1.06^18= 34,252.07

Year 2= 34,252.07*1.06= 36,307.12

Year 3= 38,485.55

Year 4= 40,794.68

Year 5= 43,242.36

Total= 193,081.78

Now, we can determine the annual deposit required:

FV= {A*[(1+i)^n-1]}/i

A= annual deposit

Isolating A:

A= (FV*i)/{[(1+i)^n]-1}

A= (193,081.78*0.12) / [1.12^18)-1]

A= 3,463.37

Other Questions
can anybody give me some options and some tips for my portfolio poem. for school. free verse poem. Take 2 y2 - 3 y - 5 from y3 - 6 y2 + 5 y . Select the correct answer.A) y3 - 2 y2 + 3 y + 5B) y3 - 4 y2 + 2 y - 5C) y3 - 4 y2 + 2 y + 5D) y3 - 8 y2 + 8 y + 5 How many Liters are in 17.3 moles of Iron? What is the volume of a rectangular prism with a length of 2 inches, a width of an inch & is a quarter of an inch in height? Is the below sequence DNA or RNA? How do you know?GTTTACAGGCGGCGCAATATCTGATCG Identify the vertex of the function graphed below.A. (1,2)B. (2,-1)C. (3,-2)D. (0,7) Davi has 75 flower seeds. He wants to plant the seeds in pots so that every seed is planted, and every pot hasthe same number of seeds. In the 1994 elections, Republicans won a clearmajority in states. The landform pictured above is _____, which has formed out of _____ and _____.O A. a glacier, snow; iceB. a glacier; ocean water, snowO C. a mountain; snow; iceOD. an iceberg; ocean water, snow Help asap!!! GIVING BRAINLIST cual es la actitud de las personas de ua comunidad del mundo hispanoblante que te sea familiar con respecto a las personas que se visten de una forma diferente? Question: Is it...ABCD Which characteristic of the father had the MOST influence on the action of the plot?A)angerB)courageC)fearD)gratitude A pink crayon is made with 12\text{ mL}12 mL12, start text, space, m, L, end text of red wax for every 5\text{ mL}5 mL5, start text, space, m, L, end text of white wax Can you help me please What was the effect of Thomas Paine's pamphlet Common Sense?A. It argued that women should be given the right to vote.B. It persuaded colonists to abolish slavery.C. It explained the benefits of westward expansion.D. It encouraged colonists to fight for independence. 1. Summarize the scientific information that leads to conservation in each of the articles.2. What social issues affected the problem or its solution in each of the stories?3. How did economics delay scientists' first attempts for conservation in each story?4. Describe the political actions that led to successful conservation in both stories. Which trend in hominid evolution can be supported by fossil evidence?Walking uprightUse of toolsIncreased intelligenceDecorating cave walls Find the hypotenuse of each Isosceles right triangle when the legs are of the given measure.Given = 6squareroot2 Select the correct navigational path to create the function syntax to use the IF function.Click the Formula tab on the ribbon and look in the ???'gallerySelect the range of cells.Then, begin the formula with the ????? click ?????. and click OK.Add the arguments into the boxes for Logical Test, Value_if_True, and Value_if_False.