Medicine High School

Size-wise, your heart occupies about_____ of the space in your upper chest.

A. 1/10th
B. 1/4th
C. 1/2
D. 1.20th

Answers

Answer 1

Answer:b

Explanation:

Answer 2

Size-wise, your heart occupies about 1/4th of the space in your upper chest. Hence option B is correct.

What is heart?

Heart is defined as an organ that pumps blood throughout your body and is around the size of your fist. It is composed of numerous tissue layers. The core of your circulatory system is your heart. The heart is an important organ. It is a muscle that helps your body's blood flow throughout. The blood that your heart pumps provides your body with the oxygen and nutrition it needs to function.

The human heart is located in the mediastinum, which is a portion of the thoracic cavity located medially between the lungs. Low oxygen blood is taken from the body and pushed through the right atrium to the right ventricle. The blood with less oxygen is sent to the lungs via the right ventricle. Blood that is rich in oxygen is drawn from the lungs and pumped to the left ventricle by the left atrium.

Thus, size-wise, your heart occupies about 1/4th of the space in your upper chest. Hence option B is correct.

To learn more about heart, refer to the link below:

https://brainly.com/question/16566688

#SPJ2

Related Questions

Which structure is correctly described as exhibiting bilateral symmetry
O fingers that are distal to the arm
O an eye on each side of the sagittal plane
O a bely button along the medial area of the body
O the head in the upper portion of the transverse plane

Answers

An eye on each side of the sagittal plate
2./ B. an eye on each side of the sagittarius plane

Use the restriction enzyme EcoRi to cut DNAVictim DNA :
GGAAG ATTCTACATTACTGACGGACGTGACGTGA
CCTTCTTAA GATGTAATGACTGCCTGCACTGACT
Number of restriction fragments ( pieces of DNA after digestion) :
Size of restriction fragments ( count the number of bases on the top strand of each fragment , listed from largest to smallest ) :

Suspect 1 DNA :
GGAATTAAGCTTATTG AATTCTTATAG AATTCGGGGCCCAAGCTTATG AATTCAATT CCTTAATTCGAATAACTTAA GAATATCTTAA GCCCCGGGTTCGAATACTTAA GTTAA
Number of restriction fragments ( pieces of DNA after digestion) :
Size of restriction fragments ( count the number of bases on the top strand of each fragment , listed from largest to smallest ) :

Suspect 2 DNA :
CCATATAG AATTCAAGCTTAAG AATTCGGGGGAACGTTG AATTCAATTAATTGGG
GGTATATCTTAA GTTCGAATTCTTAA GCCCCCTTGCAACTTAA GTTAATTAACCC
Number of restriction fragments ( pieces of DNA after digestion) :
Size of restriction fragments ( count the number of bases on the top strand of each fragment , listed from largest to smallest ) :


PLEASE HELPPP!!!!
I WOULD APPRECIATE A LOT :)

Answers

Answer:

i put an answer but someone deleted it

Explanation:

NAME THIS SONG AND ARTIST
Karma police
Arrest this man
He talks in maths
He buzzes like a fridge
He's like a detuned radio
Karma police
Arrest this girl
Her Hitler hairdo
Is making me feel ill
And we have crashed her party
This is what you'll get
This is what you'll get
This is what you'll get
When you mess with us
Karma police
I've given all I can
It's not enough
I've given all I can
But we're still on the payroll
This is what you'll get
This is what you'll get
This is what you'll get
When you mess with us
For a minute there
I lost myself, I lost myself
Phew, for a minute there
I lost myself, I lost myself
For a minute there
I lost myself, I lost myself
Phew, for a minute there
I lost myself, I lost myself

Answers

it’s karma police by radiohead c:
KARMA POLICE BY RADIOOOO HEADDDD

why are technical schools established?​

Answers

It established vocational education as acceptable training for certain future professionals who wouldn't need bachelor's degrees to do their jobs, such as plumbers, mechanics, and factory workers. They completed their training in focused vocational programs associated with high schools.
Other Questions
what spread so quick during the summer months making so many people ill that plantation owners would leave their estates during the summer? This is why Carolina would often be referred to as a hospital in the autumn True or False: The date line of a balance sheet depicts a specific day and not a period of time. please help ill give brainliest ok so the open circle lines are like im pretty sure where u put it and what direction its like the number you put it on is not a solution so where do I put the line and what direction does it go in and which line do I put pleaseee helps theres like 2 more questions In some experiments on the pain of being rejected, participants played a ball-tossing game while their brains were being scanned in an fMRI. Those excluded during the game showed increased activity in areas of the brain involved in the experience of pain. However, when they were given __________, these regions did not show heightened activity. Which best describes the space race?OA.an official challenge from President Kennedy to Soviet leader Khrushchev to put a man on the moon by the end of theOB.Oc.OD.decadean unofficial competition between the United State and the Soviet Union for preeminence in space technologyan official exercise invented by President Kennedy to train astronautsan unofficial competition between different departments of NASA to develop new space technologyResetNext Which of the following could work in this sentence? (Check all that apply)"El profesor est __________ cuando los estudiantes sacan buenas notas."enojadoemocionadotristecontentoHEEEELP The 1985 Mexico City earthquake measured a magnitude 8.0 on the Richter scale. The Richter scale uses the function M (I) = log (StartFraction I Over I Subscript 0 Baseline EndFraction). Which equation relates the intensity of the 1985 earthquake, I, with the intensity of the threshold quake, Io?A.) I = 810(Io)B.) Io = 810(I)C.) I = 108(Io)D.) Io = 108(I) Position vectors u and v have terminal points of (-6, 3) and (4, -2), respectively. Find the resulting terminal point of 2v - u. (14, -7) (2, 1) (14, 1)(2, -7) What do you get when you cross an electric eel and a sponge puzzle time riddle What value is true of x makes this equation true 0.7x-5=0.2x+1 Please help me with these what is 45% of 7/10:) During a basketball game, the coach needs to select a player to make the free throw after a technical foul on the other team. There is a 68% chance that the coach will select you and a 26% chance that the coach will select your friend. What is the probability that you or your friend is selected to make the free throw? When a text has a meaning that is stated directly, that is an example of the _____ meaning of the text.explicitinferred implied connotative What lesson does "Evil Robot Monkey" teach by Mary Robinette Kowal? Find the factors of 200m2 - 800n2. What are the functions of the cerebral cortex, cerebellum, and brainstem? what is bacteria camel ? Students in a science class investigated how the speed of sound changes with the air temperature outside. The data are shown in the scatterplot.Based on the scatterplot, what is the best prediction of the speed of sound when the air temperature is 45C?350 m/s 355 m/s360 m/s 365 m/s PLZ if your gonna answer plz answer know because it's due todayHistorian #1:Claim: The Founding Fathers wrote the Declaration of Independence because . . .Evidence:Historian #2:Claim: The Founding Fathers wrote the Declaration of Independence because . . .Evidence: