TACTTAGAGGCACCACATGGGCCTTGCACT to mRNA

Answers

Answer 1

Answer:

I don't know the answer

Explanation:

is is this even a question cos I don't think so.


Related Questions

___is a process that tells cells to stop dividing if they touch each other.

Answers

Answer:

Contact inhibition

The pathophysiology of osteomalacia involves a. collagen breakdown in the bone matrix. b. inadequate mineralization in the osteoid. c. crowding of cells in the osteoid. d. increased osteoclast activity.

Answers

Answer:

The correct answer is - b. inadequate mineralization in the osteoid.

Explanation:

Osteomalacia is a condition where the bones become weak and soft, this bone softening is occurred due to mainly vitamin D deficiency that also causes rickets. It leads to insufficient or inadequate mineralization in the osteoid.

This conditing when takes place in kids and young adult leads to curve or bowing during the growth period. In this case, bones are very prone or easily fractured.

If two hybrid tall pea plants are crossed what is the probability that the offspring will have the tall phenotype?

Answers

Answer:

There is a high probability that the Pea plant will have a High phenotype!

Explanation:

Because both "parent plants" are tall, this will cause the offspring to also be tall, this will be because it in it's genes or in other words DNA too be strong.

Which activity can be accomplished using the genetic code?
O A polypeptide can be made into mRNA
. DNA can be made into mRNA
O RNA can be copied before mitosis.
O mRNA can be made into tRNA

Answers

Answer:

DNA can be made into mRNA

Explanation:

look at the picture

Answers

Answer:

What was the question of it

Which description represents a medium?
a - energy that moves with a wave
b-midway point through a wave
c- a wave that can travel through a vacuum
d- material through which waves can travel​

Answers

The answer is b
Midway point through a wave

Lab: Natural Selection answer in the link pls 50 points and

Answers

We cannot see the image, tell me in the comments what you want me to answer maybe i can help you.

A large bowl contains a mixture of soil and iron powder. What would be the best way to separate the iron powder from the soil?​

Answers

Answer:

Add magnet to the bowl, cover the bowl, and shake well

Explanation:

Anything with MAGNET

Why is your body going through physical and chemical changes?

Answers

Answer:

(MY) body is only going through chemical changes because of my digestive juices, my saliva, and brain functions.

Explanation:

{MY} body isn't going through many physical changes other than my body slowly breaking down on a nuclear level every day slowly just like everybody else that's why nobody dies of old age, its just the teardown of their body eventaully giving out

from his monohybrid crosses, Mendel developed his first law

Answers

Answer:

Im confused but if your asking for Medel's first law it would be states that for the pair of alleles an individual has of some gene (or at some genetic locus), one is a copy of a randomly chosen one in the father of the individual, and the other if a copy of a randomly chosen one in the mother, and that a randomly chosen one will be copied

Explanation:

Question 20 of 26
How many daughter cells does mitosis produce?
A) 2.
B) 4
C) 23
D) 46

Answers

The answer is 4. Hope this helps

Answer:

A) 2.

I hope it helps :)

Explanation:

During mitosis, a eukaryotic cell undergoes a carefully coordinated nuclear division that results in the formation of two genetically identical daughter cells. Mitosis itself consists of five active steps, or phases: prophase, prometaphase, metaphase, anaphase, and telophase.

What is the medical term for the process or procedure that destroys or inhibits disease-causing microorganisms to prevent infection:

Answers

Answer: Sterilization.

Explanation:

Sterilization is the process that kills, or deactivates all forms of life so then a product is considered free of viable microorganisms. This process must be designed, validated and carried out to ensure that it is capable of eliminating the microbial load of the product.

Since sterility cannot be demonstrated without causing the complete destruction of the products, sterility is considered when the probability of a product being contaminated is acceptably remote. A critical product is considered sterile when the probability of a microorganism being present in an active or latent form is equal to or less than 1 in 1,000,000 (sterility safety factor 10^-6).

Agents that kill microorganisms are called microbicides or more commonly called "germicides". If the agent kills bacteria, it is called a bactericide. And if it kills fungi, then it is called a fungicide. It is important to consider than after an exposure of the sterilized object to the air or its surroundings, it will have become contaminated again with microorganisms.

Examples of sterilization include physical methods and chemical methods. Physical methods include:

Wet heat (in steam autoclave) Dry heat (in sterilization oven) Radiation (gamma radiatio, electron beam, X-ray, ultraviolet, microwave, white light)

Chemical methods include a variety of chemicals in liquid and vapor form, for example:

Hydrogen peroxideChlorine dioxideOzone gasesEthylene oxidePropylene oxidePeracetic acid

Volcanoes can form near coastal regions where an oceanic plate [blank] below a continental plate

Answers

Answer:

Subducts

Explanation:

According to Merriam Webster and TheFreeDictionary, the definition of subduct is "A geologic process in which one edge of one crustal plate is forced below the edge of another." Since this sentence indicates that an oceanic plate sinks under the continental plate, therefore I believe the fill-in-the-blank word would be 'subducts' or a similar word.

What is and example of an molecule
Muscle tissue
Protein
Stomach
Unicellular organism

Answers

An example of an molecule is Protein

1. What is an operon?

a. The binding site for a repressor PRO.

b. Any group of genes responsible for the metabolism of lactose in a prokaryotes or eukaryotes.

c. A cluster of genes under the control of a promoter.

d. A regulatory gene.

Answers

Answer:

The answer is D

Explanation:

Answer: c! I think, hope this helped

You have adopted a gray mouse, which you know is a wild type phenotype. When crossed with a white mouse, your gray mouse has a first litter of 3 gray mice and 2 white mice. In the second litter, you observe 3 gray mice and 4 white mice. What is the probable genotype of your gray mouse

Answers

Assuming the white phenotype is recessive. white: gg
I think the gray mouse is Gg because the offspring were pretty equally distributed in terms of color. See the punnet square below.
g g
G| Gg Gg
g| gg gg

If the Gray phenotype is recessive, then gray: ww but only if white is Ww because its about 50% chance for both.

Which type of cell are found in the leaves of a tree?
O eukaryotic animal
O chloroplastic
O prokaryotic
O eukaryotic plant

Answers

Answer:

Palisade parenchyma cells

Explanation:

Palisade parenchyma cells are elogated cells located in many leaves just below the epidermal tissue. Spongy mesophyll cells occur below the one or two layers of palisade cells. Ray parenchyma cells occur in wood rays, the structures that transport materials laterally within a woody stem.

Answer:

eukaryotic plant

Explanation:Unit 2 Test: Cells

The F1 mother of these progeny (F2) resulted from a cross between two flies from true breeding lines (P generation). What are the genotypes of these two lines

Answers

The question is incomplete. The complete question is :

In fruit flies, the recessive pr and cn mutations cause brown and bright-red eyes, respectively (wild-type flies have brick-red eyes). The double mutant pr cn combination has orange eyes. A female who has wild-type eyes is crossed to an orange-eyed male. Their progeny have the following distribution of eye colors:

wild-type8

brown241

bright-red239

orange12

500

The F1 mother of these progeny (F2) resulted from a cross between two flies from true breeding lines (P generation). What are the genotypes of these two lines ?

Answer:

prprcn+cn+ and pr+pr+cncn

Explanation:

Progeny is the offspring or descendants of any animal, plant, human or a species.

In the context, it is given that the cn mutation and recessive pr in the fruit flies makes brown and bright red color eyes. And the double mutant of pr and cn combination makes orange eyes. An oragne eye males is crossed with a female having a wild type eyes. Now for this, the F1 mother of the progeny F2 which results from the cross of two flies, the genotypes is " prprcn+cn+ and pr+pr+cncn. "

The Earth is ________________of years old

Answers

Answer:

the earth is 4.543 billion years old

The time it takes an object to go around another object (one year) is

Answers

Answer:

365 days

Explanation:

The mass of a cylinder of beetroot was 2.5 g. If its final
mass was 2.7 g, what was the
increase in mass in per cent?

Answers

Answer: The percent increase in the mass of cylinder of beetroot is 8%.

Explanation:

To calculate the percent increase in the mass of cylinder, we use the equation:

[tex]\%\text{ increase in mass}=\frac{\text{Final mass - Initial mass}}{\text{Initial mass}}\times 100[/tex]

We are given:

Final mass of the cylinder = 2.7 g

Initial mass of the cylinder = 2.5 g

Putting values in above equation, we get:

[tex]\%\text{ increase in mass}=\frac{2.7-2.5}{2.5}\times 100\\\\\%\text{ increase in mass}=8\%[/tex]

Hence, the percent increase in the mass of cylinder of beetroot is 8%.

CAN SOMEONE PLEASE HELP ME WITH THIS SCIENCE QUESTION I WILL MARK YOU BRAINLIEST THANK YOU

Answers

Answer:

The answer is

A. methane

Choose all the answers that apply.
Eukaryotes _____.

are always multicellular
are always unicellular
may have evolved from prokaryotes
have membrane-bound organelles
have a true nucleus
are more primitive than prokaryotes

Answers

Answer:

3 answers

Explanation:

may have evolved from prokaryotes

have membrane bound organelles

have a true nucleus

Hope it helps.....

Which two structures are found at the outside of the cell?

Answers

Answer:

All cells share common components: (1) a plasma membrane, an outer covering that separates the cell's interior from its surrounding environment; (2) cytoplasm, consisting of a jelly-like region within the cell in which other cellular components are found; (3) DNA, the genetic material of the cell.

Select the intended meaning of the idiom in the following sentence.
The President's announcement made Washington tremble.
O The people in the government grew anxious.
O The earth shook while the President spoke.

Answers

The people were anxious

giving brainiest
Scientists find fossils of a wide variety of dinosaur species throughout Mesozoic rocks, which date from approximately 250 million to 65 million years ago. Above the Mesozoic rocks lie Cenozoic rocks, which date from approximately 65 million years ago to the present day. No dinosaur fossils exist in the overlying Cenozoic rocks.


What is the most likely explanation for the lack of dinosaur fossils in Cenozoic rocks?

A. The dinosaurs' biological diversity increased in the Cenozoic Era.

B. Dinosaurs adapted in the Cenozoic Era so that their bodies could no longer be preserved as fossils.

C. There was a mass extinction of dinosaur species at the end of the Mesozoic Era.

D. There was a mass extinction of dinosaur species at the end of the Cenozoic Era.

Answers

Answer:

C

there awasw a mass extinction of dinosaur species at the end of the Mesozoic.

Explanation:

C

Have A Great One!

Answer:

it D

Explanation:

plss helppp!!

Which of the following is an example of indirect evidence about Earth's
layers?
A. rock samples obtained by drilling
B. mantle rocks produced by volcanoes
C. changes observed in seismic wave data
D. data gathered from high-pressure lab experiments

Answers

Answer: I believe the answer would be C -- Changes observed in seismic wave data.

Explanation:

Geologists use rock samples as direct evidence about earth's layers, and they  use seismic waves as indirect evidence to study the Earth’s structure.

I hope this helps!

The health department is responsible to make sure there are written directions for critical control point procedures.
True
False

Answers

Answer:

I think it's true...

Explanation:

Answer:

True

Explanation:

edge2021

ALOT OF POINTS PLEASE HELP :)

How did humankind discover the presence of DNA?

Answers

Answer:

The real breakthrough in understanding DNA, however, came with the discovery of its structure in 1953. The discovery of the structure of DNA is often credited to James Watson and Francis Crick.

Explanation:

Challenge: Make another comparison.
Earth's outer layer is like

Answers

Earths outter layer is like the glass on a lightbulb because it keeps the inside of the lightbulb straight, and also protects you from getting electrocuted (sry if this is wrong, i tried my best to try to help) :))
Other Questions
(Fahrenheit 451) The novel was a warning to society at the time it was written. write an essay (400-500 words) about how the novel can still be used as a warning today. be sure to mention what the novel is warning us about find the probability that a number chosen at random from the integers between 5 and 16 inclusive is a multiple of 3 or a mutiple of 2 Read each statement carefully. Choose the word or phrase that best completes each sentence. All Aztec children were expected to . When it came to parenting, women were expected to take care of . A common part of Aztec family life was . Promotional discounts are given to stores by manufacturers to place their products in preferred locations in the store and to display their products in a ski manufacturer sells a local ski shop 35 pairs of their new store window: skis for $7000, which is a discount of $2,625. What is the percentage of the discount given to the store? (Round your answer to the nearest whole percent.) Solve 3x - 4 2 or 2x + 11 -1.please help Jadas lawn mowing service charges $28 per hour plus a $20 fee to cover gas for the mower. Mais lawn service charges $16 per hour, but a $44 fee. For how many hours will Jadas service be cheaper than Mais? I will play basketball. This is a _____ goal. a) neither b) broad c) SMART15 POINTS AND BRAINLIEST According to Edgar Allan Poe what is the definition of poetry? Could someone pls help me Which of the following statements best describes the relationship between the environment and the collective health of the world? A. The environment does not affect our health. B. When the environment is damaged, our health improves. C. What is good for the environment is good for our health. D. Our collective health is not related to the health of the environment. Please select the best answer from the choices provided. A B C D Mark this and return A middle-school art teacher, Ms. Velez, and her students are turning the schools gymnasium into a student art museum for the day.Ms. Velez types a program for the event and writes: "The most popular art museum in the world, the Louvre, has approximately 9,300,000 visitors each year. About 1,900,000 of those visitors are young people age 18 to 25." 1) How would you write the two numbers above in scientific notation? (2 points)2) BONUS: Approximately what percent of visitors to the Louvre are young people? Determine the shortest distance from the point (5, 2) to the line represented by y=2x+1. What are the locations and end products for the processes of transcription andtranslation? an effective annual interest rate of 12.95% how many years will it take a given amount to Triple in value Project: Strategies for Effective CommunicationIn the lesson, there is a chart of strategies for effective communication. You will use this chart to complete your assignment. Select eight of the strategies. For four of the strategies, describe a situation where a team member models effective communication. For the other four strategies, describe a situation where a team member exhibits a breakdown in communication. Each scenario must be at least one paragraph in length.For example: If the strategy was to always greet a patient in a positive and friendly way, we could describe a situation where a health care worker modeled this behavior or a situation where a health care worker did not act appropriately.After you complete your scenarios, do some research online or in the library. Find at least two more strategies for effective communication. Provide an example of ineffective communication and effective communication related to each strategy. Discuss why you selected each strategy and how you think each strategy can be useful in effective communication. Make sure that you select strategies that were not mentioned in the chart or used as an example in the lesson. A boy at an amusement park has 38 ride tickets. Each ride on the roller coaster costs 5 tickets. After riding the roller coaster as many times as he can,how many tickets will the boy have left? 1. A triangle has a base of 8km and height of 3km. What is the area of the triangle? 2. What is the area of a triangle with a base of 4 inches and a height of 9 inches? Help would be much appreciated HWhich side has a length of 10 units?G8O HGO GJ4O HIOJ-8-4481-4-8DoneIntro The volumes of two cylindrical cans of the same shape vary directly as the cubes of their radii. If a can with a six-inch radius holds 1 pints, how many gallons will a similar can with a 24-inch radius hold? which statements best describes the men at the general store?