Answer:
The axial skeleton is composed of the bones of the skull, ossicles of the ear, hyoid bone, vertebral column, and ribcage.
Explanation:
brainliest
Answer:
The axial skeleton.
The skeletal system of the human body is furthermore subdivided into two distinct types, the axial and appendicular skeleton.
The axial skeleton is located almost the midportion of the human body which has 80 constituent bones and has 6 parts; the skull, the ossicles of the ear (tiny bones), sternum, rib cage, vertebral column and hyoid bone.
Explanation:
brainliest pls and thx btw!why is it important to save energy in our daily lives
Answer:
So you can be more active and do different things that need energy
Explanation:
Having energy is an important part of daily life. Without energy, the human body would not be able to go throughout the day without being tired and without their muscles and bones hurting.
Bill Nye Earth's crust
Answer:
1. rock
2. on
3. mantle
4. volcanoes
5. active
6. lava
7. hot
8. coolest
9. geyser
10. resistant
11. tectonic
12. tectonic/pangea
13. caves
14. earthquake
15. crust
Explanation:
What is the Florida state lizard (don’t search) just guess
what is the mRNA in TACCGGATGCCAGATCAAATC?
Answer:
AUGGCCUACGGUCUAGUUUAG
Which process begins the formation of sedimentary rock?
what does the respritory system do?
Answer:
The respiratory system's main job is to move fresh air into your body while also removing waste gases.
Explanation:
Your lungs are part of the respiratory system, a group of organs and tissues that work together to help you breathe.
explain how at least three pieces of evidence support the theory of evolution.
Dont put any link or else I won’t give brainlist, just answer.
Answer:
1. Fossil evidence
2. Homologous similarities.
3. Molecular evidence
Which type of muscle is long and striated and contains multiple nuclei?
Smooth Muscle
Cardiac Muscle
Muscle of the Digestive System
Skeletal Muscle
Answer:
Skeletal Muscle
Explanation:
Answer:
Skeletal Muscle
Explanation:
true or false
Photosynthesis is part of an oak tree's niche.
Answer:
True, veryyyyy true
:))
I will mark Brainliest for frist answer
Answer:C, to contain the information
Explanation:
Which organelle of a cell functions similarly to the envelope of a virus and why?
Answer: linear or circular. include genes encoding viral proteins: capsid, envelope proteins, any polymerase not found in the host cell. viruses may have a lipid envelope.
¿Con que otro nombre se le conoce a las placas de espuma de poliuretano altamente contaminante?
Answer:
La espluma de poliuretano (espluma PU) ye un material plásticu porosu formáu por un agregamientu de burbuyes, conocíu tamién polos nomes coloquiales de gomaespuma n'España o gomapluma en dellos países suramericanos. Contienen sustances d'escasu poder canceríxenu que si representen dalgún peligru, namái sería tres esposiciones intenses y teniendo contautu direutu.Tamién ye denomináu Poliuretano proxectáu, por cuenta de la forma na que se suel aplicar sobre superficies. Explanation:
4 In your own words, describe the relationship between
the processes and forces that create the different types of rocks
Answer:The three main rock types are igneous, metamorphic and sedimentary. The three processes that change one rock to another are crystallization, metamorphism, and erosion and sedimentation.
plz no bit.yl stuff, just answers
Sickle cell anemia is a disease that affects the circulatory system.It can be passed from parent to child. Which of the following indicates the significance of this disease?
A.It shows that a disease can cause genetic changes.
B.It is a reflection of how genetic factors affect health.
C.It shows how public health is affected by environmental factors.
D.It indicates how a toxin can play a role in the development of disease.
What is the relationship between the rock cycle and the plate tectonics?
Answer: The metamorphic rocks can erode into sedimentary rocks which can turn into igneous rock. Metamorphic rocks in the rock cycle is driven by tectonic plates.
Explanation:
How can a person cannot taste PTC I'd both of their parents have the ability to taste PTC?
Answer:
the parents are (Tt) and each passed down the recessive allele so the child is (tt)
Explanation:
People who have leukemia, cancer that affects white blood cells, are often given Cytarabine. This drug inhibits the synthesis of DNA. Which phase of the cell cycle is most affected by Cytarabine?
30. Which of the following best explains why enzymes are necessary for many cellular reactions?
A. Enzymes supply the oxygen necessary for the reactions.
B. Enzymes change reactants from solid to liquids during the reactions.
C. The reactions take up too much space in the cell if the enzymes are missing.
D. The reactions are too slow to meet the needs of the cell if enzymes are missing.
Answer:
D. The reaction are too slow to meet the needs of the cell if enzymes are missing
hope it helps
This moray eel has a small fish cleaning between its teeth. The eel gets a
clean mouth while the cleaner fish gets a nice meal.
A.Mutualism
B.Commensalism
C.Parasitism
Answer:
A. Mutualism
Explanation:
The moray eel and the small fish are both getting something out of it. Meaning they both benefit from each other.
In the mouse model of malaria, the researchers injected Plasmodium-infected human red blood cells into the mice because the Plasmodium species had surface ligand proteins that bound only to cell membrane proteins of human red blood cells. Assume that the researchers noticed that some of the parasites no longer infected human red blood cells but instead infected mouse red blood cells. Predict the most likely cause of this change in the host specificity of the parasites. Plasmodium reproduces both sexually in the host vertebrate and asexually in mosquitoes. The researchers claim that the Plasmodium organisms that infect the two different types of red blood cells are likely to evolve into two separate species of Plasmodium. Based on the biological species concept, provide reasoning that would support the researchers’ claim.
Thank you to anyone who answers .
Answer:
D
Explanation:
Answer:
i think its D but im so sorry if it wrong my second answer would probably be A
Explanation:
i really hope this helps sorry if it doesn't
Someone suggested that everything to be sent to the base on the moon must be sterelized so that no bacteria of any kind are present.Do you think this is a good idea
Answer:
Yes.
Explanation:
Yes, it is a good idea by sterilizing everything because this sterilization process kills bacteria or other harmful microbes on the items and no chance of bacterial infection occurs in the base that is present on the moon. This sterilization process is very important in order to make the health of the crew members and scientists that lives in the base on the moon. If the bacteria or other harmful microbes enters in the base so its maintained environment will triggers its growth and infections in the humans so it is a good idea.
Explain the lifecycle of mosquito in short
Answer:
Mosquitoes have 4 life stages: egg, larva, pupa and adult. Mosquitoes can live and reproduce inside and outside the home. The entire life cycle, from an egg to an adult, takes approximately 8-10 days. Hope this helps! :)
This is a question that has been confusing - In addition to carbon dioxide, what other two ingredients does a plant need for photosynthesis?
Answer:
Carbon dioxide, water and sunlight
Answer:
water and sunlight
Explanation:
How is information for a specific protein carried on the DNA molecule?
a. as a sequence of nucleotides
b. in the double helix shape of the condensed chromosome
c. in the ratio of adenines to thymines
d. as a pattern of phosphates and sugars
Answer:
b
Explanation:
Genetic information is carried in the linear sequence of nucleotides in DNA. Each molecule of DNA is a double helix formed from two complementary strands of nucleotides held together by hydrogen bonds between G-C and A-T base pairs. ... In eucaryotes, DNA is contained in the cell nucleus.
The information for a specific protein is being carried on the DNA molecule as a sequence of nucleotides. Hence, option (a) is the correct answer.
Nucleic acids are of two types. They are namely deoxyribonucleic acid (DNA) and ribonucleic acid (RNA). DNA molecule carries the information for a specific protein. They are described as follows:
DNA is the genetic material of the cell DNA molecules undergo a process called transcription to code for codons on mRNA strand These codons tend to pair with tRNA molecule which holds the amino acids The amino acids will then form a chain in the sequence of DNA nucleotides to result in protein formationThus, we can conclude that the information for a specific protein is being carried on the DNA molecule as a sequence of nucleotides. Thus, option (a) is the correct answer.
Learn more about DNA here:
https://brainly.com/question/264225
Which statement below is NOT a statement within the Cell Theory?
A. all cells come from other cells
B. all organisms are composed of cells
C. the cell is the basic unit or organization of organisms
D. all cells contain DNA (genetic information)
When a person loses consciousness due to a head injury from a car crash, the ______ keeps the body functioning by regulating the flow of information between the brain and the rest of the body
Answer:
Brain stem
Explanation:
I hope this helps
Can someone please help me on this plz I beg u :(
Answer:
Coleoptera is correct! Hope this helps.
Earth science question. Please help
Answer:
answer choice 4, more rain and a steeper slope cause it to flow faster
Explanation:
dead cells are removed from the Dermis by phagocytosis. true or false?
