What can people do if they feel that a law is unfair?
Answer: People who think that the law is not fair can approach the court to decide on the issue. The court has the power to modify or cancel laws if it finds that they don't adhere to the Constitution.
Explain any 2 significance of public administration.
Public administrators play a crucial role in aiding federal agencies, such as the Department of Health and Human Services and the Transportation Security Administration.
On a local level, public administrators organize efforts to improve communications and share data between public safety services
Which television show or movie shows procedures/or a process to collect evidence from a violent crime scene that differs from the actual procedures/process that happen in real life. Then discuss how these two procedures or processes regarding evidence collection portrays the criminal investigation process and how these processes or procedures differ from the actual reality of a crime scene investigation.
* I’m not really. Interested in crime shows so I don’t have a clue
Answer:
Criminal law
Explanation:
Answer:
Mindhunter
America's Most Wanted
Criminal: UK
WHAT CRIMES ARE COMMITTED BY BOTH MEN AND WOMEN (give 5 crimes)
, murder, robbery, assault, kidnapping.
Answer:
1. Embezzlement
2. Domestic Violence
3. Murder
4. Car Theft
5. Extortion
Explanation:
Bistro Caterers contracts with Corporate Towers to cater the firm’s business meetings. Later, the contract between Bistro and Corporate is completely rescinded. Even later, Bistro offers to make a new deal. Corporate is willing to deal, but for a new price. Bistro and Corporate
a. may agree to a new contract, but it cannot include a new price.
b. must perform the part of their original contract that is executory.
c. must perform their original contract.
d. may agree to a new contract that includes the new price.
Answer:
d. may agree to a new contract that includes the new price.
Explanation:
A contract can be defined as an agreement between two or more parties (group of people) which gives rise to a mutual legal obligation or enforceable by law.
There are different types of contract in business and these includes: fixed-price contract, cost-plus contract, bilateral contract, implies contract, unilateral contract, adhesion contract, unconscionable contract, option contract, express contract, etc.
Mutual assent is a legal term which represents an agreement by both parties to a contract. When two parties to a contract both have an understanding of the parameters, terms and conditions surrounding a contract, it ultimately implies that they are in agreement; this is generally referred to as mutual assent.
Since the original contract has been completely rescinded (declared void, repealed or annulled), Bistro and Corporate may agree to a new contract that includes the new price based on mutual assent between the two parties.
How many repeats are there for this STR? Refer to the following DNA sequence to answer the questions: CTAGAAGCTTAAAGCTTCATCATCATCATCATCATCATTTAAGCTTCAAAGCTT
Answer:
The number of repeats within an STR is referred to as an allele. For instance, the STR known as D7S820, found on chromosome 7, contains between 5 and 16 repeats of GATA. Therefore, there are 12 different alleles possible for the D7S820 STR.
Essay on civil and criminal laws on malaysia?
Answer:
are various definitions of the term “legal system”. A Legal System is the framework of rules and institutions within a nation regulating individual’s relations with one another and between them and the government.(Book) In this world, there are many types of legal systems, but the few major legal sytems of the world today are civil law, common law, customary law, religious law, socialist and mixed law systems.
Civil law is the dominant legal tradition today in most of Europe, all of Central and South America, parts of Asia and Africa, and even some discrete areas of the common-law world, like Louisiana and Quebec. The origin of civil law is from the Roman law. The civil law is a set out of comprehensive system of rules which are applied and interpreted by judges. Besides that, civil law is older, more widely distributed and in many ways more influential than the common law.
Common law is a system of law that is derived from judges’ decisions, rather than statutes or constitutions. It is based on tradition, past practices and legal precedents set by courts through interpretation of statues, legal legislation, and past rulings.It is english origin and is found in United States and other countries with strong english influences
Customary law is a traditional common rule or practice that has become an intrinsic part of the accepted and expected conduct in a community, profession, or trade and is treated as a legal requirement. Not many countries in the world today will operate under a legal system which could be wholly customary. However, customary law still plays a sometimes significant role, like in the matters of personal conduct, in many countries or political entities with mixed legal systems.
Islamic law is derived from the interpretation of the Koran. Its primary objective is social justice, but also includes property rights, economic decision making, and types of economic freedom. Islamic law is mostly found in Pakistan, Iran, and other Islamic states.
Socialist law is based on fundamental tenets of Marxist-socialist state and center on concept of economic, political, and social policies of the state. It can be found in some independent states of the former Soviet Union, China and other Marxist-socialist states.
A mixed legal system is a mixture of two or more legal system practised by some countries.
2.0 Malaysia’s Legal System
Different country practices different types of legal system. Some country practices one type of legal system while others practices the mixed legal system which means a combination of two or more legal systems. Malaysia for example, practices the mixed legal system which includes the Common Law, Islamic law and Customary Law. Malaysia’s legal system comprises laws which have arise from three significant periods in Malaysian history dating from the Malacca Sultanate, to the spread of Islam to Southeast Asia, and following the absorption into the indigenous culture of British colonial rule which introduced a constitutional government and the common law. Malaysia’s unique legal system is designed to balance the delicate racial and religious needs of its heterogeneous people. The Malaysian legal system law can be classified into two . However, according to the democratic ruling system, the Chief Executive is the Prime Minister. This does not mean that the Yang di-Pertuan Agong is unable to voice any opinion, but rather that he must act on government advice, whatever his personal view might be. The Yang di-Pertuan Agong appoints a Cabinet to advise him on country’s matter. The Cabinet consists of the Prime Minister and a number of Ministers who must all be members of Parliament. Besides that, the Government has set up various agencies to ensure the smooth enforcement of the law. It comprised of three main components, namely ministries, departments and statutory bodies.
laws pertaining to persons professing the religion of Islam.
Share this:
Cite This Work
To export a reference to this article please select a referencing stye below:
OSCOLA
APA
MLA
MLA-7
Harvard
Vancouver
Wikipedia
All ltd, 'L
Trustedsite Law
Brown v. Board, Main points, argument, and violations. I am expecting a decent paragraph! (10 Sentence!) Majority Opinion for the brief also!
Answer:
The Supreme Court's opinion in the Brown v. Board of Education case of 1954 legally ended decades of racial segregation in America's public schools. Originally named after Oliver Brown, the first of many plaintiffs listed in the lower court case of Brown v. Board of Education of Topeka, KS, the landmark decision actually resolved six separate segregation cases from four states, consolidated under the name Brown v. Board of Education. While the attorneys originally argued the cases on appeal to the Court in 1952, the featured document, School Segregation Cases - Order of Argument, offers a window into the three days in December of 1953 during which the attorneys reargued the cases.
A reargument was necessary because the Court desired briefs from both sides that would answer five questions, all having to do with the attorneys' opinions on whether or not Congress had segregation in public schools in mind when the 14th amendment was ratified. The document lists the names of each case, the states from which they came, the order in which the Court heard them, the names of the attorneys for the appellants and appellees, the total time allotted for arguments, and the dates over which the arguments took place.
The first case listed, Briggs v. Elliott, originated in Clarendon County, South Carolina, in the fall of 1950. Harry Briggs was one of twenty plaintiffs who were charging that R.W. Elliott, as president of the Clarendon County School Board, violated their right to equal protection under the fourteenth amendment by upholding the county's segregated education law. Briggs featured social science testimony on behalf of the plaintiffs from some of the nation's leading child psychologists, such as Dr. Kenneth Clark, whose famous doll study concluded that segregation negatively affected the self-esteem and psyche of African-American children. Such testimony was groundbreaking because on only one other occasion in U.S. history had a plaintiff attempted to present such evidence before the Court.
Explanation:
networks
Guided Reading Activity
Economic Systems
Lesson 1 Scarcity and the Science of Economics
Review Questions
Answer:
Explanation:
networks
Guided Reading Activity
Economic Systems
Lesson 1 Scarcity and the Science of Economics
Review Questions
A(n) ___ is a type of microscope that can analyze the characteristic glow of different fibers.
Damian and Hunter are college roommates from very different walks of life. Damian was raised in a poverty-stricken city by a single mom. Hunter is the son of a small-town doctor and his socialite wife. Regardless, they get along well. Over time, they become known around campus as a good source for illegal drugs. For several years, Damian and Hunter run their business successfully. When the police finally catch up with them, they are both arrested. Following the theory of radical criminology, what is MOST likely going to happen to the two men?
A.
Damian will get an easier sentence because he did not have the advantages that Hunter did.
B.
Hunter will get a harder sentence because he had more privileges growing up.
C.
Both men will get equal sentences under the law.
D.
Damian will get a harder sentence because of his background.
Answer: D. Damian will get a harder sentence because of his background
Explanation:
Radical criminology bases its opinion on the fact that the state uses its power to make laws that will be beneficial to the ruling class while the working class are left out. It simply means that the laws made benefits the rich at the expense of the poor in the society.
Therefore, since Damian was raised in a poverty-stricken city by a single mom while Hunter is the son of a small-town doctor and his socialite wife, Damian will get a harder sentence because of his background.
The legalization of drugs is neither unwise nor immoral. It is not unwise because by legalizing drugs we would eliminate the illegal drug trade. Hence, by legalizing drugs, we would rid our nation of all the violence that goes along with the illegal drug trade. Furthermore, the legalization of drugs is not immoral because it can be combined with a massive program of moral education. The conclusion in a standard argument form is often presented as __________
Answer:
Inductive
Explanation: