The economy of ancient Rome did not depend heavily on (1 point) a industry b slaves c trade d agriculture

Answers

Answer 1
A I believe only because I can’t find them having a big industry
Answer 2

Answer:

Industry

Explanation:

Rome lacked some characteristics in the industrial community. There wasn't really any culture, inventions or discovery, and they lacked tinkerers and machine builders. There also wasn't any evidence of labor scarcity that could've driven their inventions of labor-savings.


Related Questions

Which of the following led to the founding of SNCC?
a. Greensboro sit-ins
b. March on Washington DC
c. Freedom rides
d. Albany movement

Answers

A. Greensboro sit-ins

Match the following Post Secondary options with their description.

PLEASE HELP!!! I HAVE A D+ AND I NEED TO GET IT TO AN A BY THE END OF THE DAY!!!! HHHHHHHHEEEEEEEELLLLLLPPPPPPPP

Answers

Answer:

Explanation:

1. A

2.B

3.C

4.D

Hope this help

P.S. sorry i'm late

HELP ASAP
Click to review the online content. Then answer the question(s) below, using complete sentences. Scroll down to view additional questions.
Online Content: Site 1

List several economic indicators. What is the purpose of measuring economic indicators? What do they measure? (Site 1)

Answers

Answer:An economic indicator is a macroeconomic measurement used by analysts to understand current and future economic activity and opportunity. The most widely-used economic indicators come from data released by the government and non-profit organizations or universities.

Explanation:Read this and see if any of it helps.

PLZ PLXZ PXZ I NEED HELP !!!!!!!!!!!!!!!!!!!

Answers

Answer:

Number three

Explanation:

The argument is about the amount they are willing to spend on education

Answer:

ummm i think it the first one

Explanation:

HEYYYY SO i need halp- someone halp meh plz

The map above shows the state of Indiana with every recorded earthquake epicenter in its history. Based on this map, where is a fault line most likely located?

A) in the middle of the state
B) in the northeast corner of the state
C) in the southeast corner of the state
D) in the southwest corner of the state

Answers

Answer:

i believe its A

brainliest pls

Explanation:

Answer:I'm sure its A

Explanation:

Which of the following helped women in the workplace?

A. the Civil Rights Act of 1964
B. the Voting Rights Act of 1965
C. Hernandez v. Texas
D. the end of segregation

Answers

Answer:

b. I think??

Explanation:

not really sure so don't depend on me

B. The Voting Rights Act of 1965

Why is keeping the authority that the people and the government have equal?

Answers

So the government can’t have too much power I think
So that the government does not become too controlling while abusing their powers.

Explain how the story of Exodus illustrates the important ideas taught in the Jewish religion.

Answers

Answer:

The Exile tale describes the Jews' struggle in Egypt, their redemption by Yahweh, and their expulsion from Egypt. They promised to become his people after being selected and forming a pact with him.

Answer:

The Book of Exodus tells us about the special relationship between the Jewish god, Yahweh, and the Israelite people.

The Book of Exodus is the second book of the Torah, the most holy book in the Jewish tradition. The word “exodus” means when many people leave a place. The Book of Exodus tells how the Israelite people were freed from slavery in Egypt by their god, Yahweh, and under the leadership of Moses. Moses is considered an important prophet in three major world religions: Judaism, Christianity, and Islam.

The Book of Exodus is a sacred story to these three religions. While many followers of these faiths believe Moses wrote the Book of Exodus, modern historians believe Moses was not a real person and the Book of Exodus is a collection of stories from earlier times. Students of history can use the story to understand the history and culture of the Israelite nation and the origin of these three faiths.

Explanation:

which of the following phrases belongs in the section labeled "A"?

Answers

Answer:

All of them

Explanation:

Click to review the online content. Then answer the question(s) below, using complete sentences. Scroll down to view additional questions.
Online Content: Site 1

Why is the koala considered a vulnerable species in Australia? What do scientists consider to be the major threats to the koala population? (Site 1)

Answers

Answer:

In April 2012, the Australian Government declared the Koala as 'VULNERABLE” under the Federal EPBC Act in New South Wales, the Act and Queensland.

Explanation:

it did not allow me too look at the  online content so if its correct please give me feedback.

Answer:

The koala is a vulnerable spiece because its by itself most of the time. Suffering from the effects of habitat destruction and Domestic dog attacks, bushfires, road accidents

Explanation:

i hope its right!

6. Do citizens vote directly for the Prime Minister? ____________________________________

7. How is the Prime Minister elected? ______________________________________________

____________________________________________________________________________

8. Does the Prime Minister have a set “term of office”? _________________________________

9. Since the entire ___________________________ is controlled by _______________ body

(the ____________________________), one ________________________ party usually has

all of the _____________________ in a Parliamentary __________________________.

10. What type of leader other than the Prime Minister does a Parliamentary Democracy have?

________________________________________________

//////////////////////////////////do as many as you like plz help and do not take my points plz

Answers

Answer:

6.)a prime minister is usually appointed by the head of state, and not elected to office by the entire nation, as is the case with some presidential polls.

7.) Read 6!

8.) I don't know

9.)I don't know

10.)A prime minister is the head of the cabinet and the leader of the ministers in the executive branch of government, often in a parliamentary or semi-presidential system.

Explanation:

Hope this helps :)

Help, please...
Word bank: Genetic variation, environment, adaptations, traits, extinct

1.When a(n) ________________changes, _______________ can help an organism survive.
2. A species becomes ________________ when an environment changes and the species does not have specific _______________ for survival and reproduction.
3. ______________ _________________ increases the chance of survival of a species.

Answers

Answer: 1. Adaptions. 2. extinct, traits. 3. genetic variation,  environment.

Explanation:

1. When an environment changes, adaptation can help an organism survive.
2. A species becomes extinct when an environment changes and the species does not have a specific traits for survival or reproduction
3. Genetic variation increases the chance of survival of a species

Who worked together to educate citizens in California about appropriate water use during a drought?
Question 4 options:

Girl Scouts, Boy Scouts, and Armed Forces

Conservation groups and government

Olympic athletes and coaches

Schoolchildren and parents

Answers

It is conservation groups and government

Under which system did landowning nobles govern and protect the people in return for services?

A) feudalism
cross out

B) mercantilism
cross out

C) protectionism
cross out

D) vassalism

Answers

The best answer to go with is b you’re welcome
i think the answer is b

Can someone please help me--

Answers

Answer:5 1 2 8 9 6 10 13 4 7 3 11

Explanation:

Please help
Will give Brainiest

Answers

Events at the Marne signaled the demise of Germany's aggressive two-front war strategy, known as the Schlieffen Plan; they also marked the end of the general belief, held on both sides of the line, that the conflict that broke out in the summer of 1914 would be a short one. So #3. Your welcome. Have a nice day!
The second answer would be the correct one I believe. I apologize if I am wrong.

Analyze the map below and answer the question that follows.



The main economic activity that occurs in the US regions circled on the map above is __________.
A.
farming
B.
fishing
C.
manufacturing
D.
mining

Please select the best answer from the choices provided
A
B
C
D

Answers

the answer is D: mining

Answer:

A

Explanation:

if i'm wrong i'm so sorry my reasoning to this is because most of what was circled was in the great planes so i thought i would be farming i'm so sorry if its wrong.

so uh- i need help again

When a huge amount of gas is trapped within magma, the eruption is usually violent. Ash and lava are thrown out in large amounts, settling around the vent after the eruption. What kind of volcano would be formed as a result?

A) shield volcano
B) composite volcano
C) underwater volcano
D) cinder cone volcano

Answers

Answer:

Maybe D, but I could be wrong. I' sos sorry if I am.

Explanation:

The answer is D!!!
Cinder cone volcano :)

Why are terrorists more dangerous today than they were in the past?

A. Today's terrorists are more committed to their causes

B. Today's terrorists try to blend in with their surrounding

C. Today's terrorists have access to modern technology and weapons

D. Today's terrorists are more willing to commit murder

Answers

C. Today’s terrorists have access to modern technology and weapons
todays terrorists have access to modern technology and weapons

PLEASE HELP IM IN DESPERATE NEED

Answers

what even is the question
Yes if will keep cutting trees there is less photosynthesis meaning there’s more carbon in the air because the factories It’s all the cycle we breathe oxygen in breathe out carbon plants and trees breathe carbon and release oxygen and and since were cutting trees there’s more Carbon

What was a positive effect of the Columbian Exchange?Please be authentic in your responses .

Answers

Answer:

There was lots of new crops such as corn, which was good, but a negative is the enslavement of African people who were taken from their home.

Explanation:

Hope this helps! good luck!

Why might the author have started and ended the article with details about the Crucible? *
A. to highlight challenges that male and female recruits can face after training separately
B. to explain the history of the Marine Corps
C. to illustrate how a single-gender platoon works
D. to argue that the Crucible should be done at the beginning of basic training

Answers

Answer:

c to illustrated how a single -gender platoon work

C - it explains a lot I hope that this helps you!!!!!!

Write true or false after each statement about why hoppers hop off the table.

The rubber band is stretched when the hopper is flat. True or false

The stretched rubber band is pulling on the sides of the cardboard. True or false

When you let go, the rubber band contracts and pulls the sides together causing the cardboard to push off the table. True or false

The push makes the hopper fly up into the air. True or false

Answers

Answer: The rubber band is stretched when the hopper is flat. True

The stretched rubber band is pulling on the sides of the cardboard.  false

When you let go, the rubber band contracts and pulls the sides together causing the cardboard to push off the table. false

The push makes the hopper fly up into the air. True

Explanation:

True, false, false, true

What is this quote saying in your own words.

Answers

the meaning of this quote is that it isn’t just the long journey ahead and final destination that destroys our motivation, it’s the everyday distractions and little things that slowly drift us away from what’s ahead.
Some let the small stuff get in your way of the big picture (the mountain or the bigger goal).

How did Samuel Morse's invention affect communication in the country?

Allowed messages to be sent in seconds over long distances
Blocked people's ability to send messages east and west
Delivered messages to the wrong people
Slowed the delivery of messages over long distances

Answers

Answer:

third one

Explanation:

test prep

The answer is C: slowed the delivery of messages over long distances

what was the compromise?

Answers

The Compromise of 1850 consists of five laws passed in September of 1850 that dealt with the issue of slavery and territorial expansion.

Two of the major climate regions on Earth include _____.


wet and cold


polar icecaps and tundra


mountainous and flat


tropical and temperate continental


Which statement about air movement is true?


Global belts of air, called cells, circulate in each major latitude division.


Air movement in the temperate zones has little effect on precipitation.


Most winds across the U.S.A. and Europe blow from east to west.


Air movement affects temperature only when there are strong storms.


What are deciduous trees?


Trees that lose their leaves in the fall.


Trees that form a dense canopy.


Trees that have needles instead of leaves.


Trees that produce seed cones.


The average weather over many years is the _____.


climate


water cycle


temperature


precipitation


“Vegetation” refers to _____.


increasing plant growth in an area with a changing climate


the plants that naturally grow in a region


plants that bear tropical fruits


seasonal changes in the number of plants, usually during spring

Answers

two of the major climate regions on earth include mountain and flat

Describe how the rocket, the satellite, and the airplane combine to create a space shuttle
that successfully takes off, orbits, and lands.

Answers

Answer:

By mixing the aerodynamics of each machine, you get a space shuttle.

Explanation:

You need the power of the rocket to propel it into the sky, you need the "brain" of the satellite, (all the equipment used to run it) and from the airplane you need some shape of wings, to help steer is and help with tension.

(Hope this helps)

For victoria4ny NinTendoSatori Hurry up!!

Answers

Answer:

are u talking to someone else? i think you are wait this answers for 50 points?!!! oh well um do  u mind if i uh take em?.......

thank u i guess :DDDD oh and good luck with that person unless this is a real question then ill feel bad.. but if it is ill answer  in the comments but if it isnt then alrighty then peace

Explanation:

What does this mean in modern language?

Such has been the patient sufferance of these colonies; and such is now the necessity which constrains them to alter their former systems of government. The history of the present king of Great Britain is a history of repeated injuries and usurpations, all having in direct object the establishment of an absolute tyranny over these states. To prove this, let facts be submitted to a candid world.

Answers

Answer:

What follows is a bill of indictment. Several of these items end up in the Bill of Rights. Others are addressed by the form of the government established—first by the Articles of Confederation, and ultimately by the Constitution.

The assumption of natural rights expressed in the Declaration of Independence can be summed up by the following proposition: “First comes rights, then comes government.” According to this view: (1) the rights of individuals do not originate with any government, but preexist its formation; (2) the protection of these rights is the first duty of government; and (3) even after government is formed, these rights provide a standard by which its performance is measured and, in extreme cases, its systemic failure to protect rights—or its systematic violation of rights—can justify its alteration or abolition; (4) at least some of these rights are so fundamental that they are “inalienable,” meaning they are so intimately connected to one’s nature as a human being that they cannot be transferred to another even if one consents to do so. This is powerful stuff.

At the Founding, these ideas were considered so true as to be self-evident. However, today the idea of natural rights is obscure and controversial. Oftentimes, when the idea comes up, it is deemed to be archaic. Moreover, the discussion by many of natural rights, as reflected in the Declaration’s claim that such rights “are endowed by their Creator,” leads many to characterize natural rights as religiously based rather than secular. As I explain in The Structure of Liberty: Justice and the Rule of Law, I believe his is a mistake.

Other Questions
How many repeats are there for this STR? Refer to the following DNA sequence to answer the questions: CTAGAAGCTTAAAGCTTCATCATCATCATCATCATCATTTAAGCTTCAAAGCTT At one time, dinosaurs were rulers of the earth. What are the nouns? Hello, I need help in this part of chemistry, I need the chemical names of the following four:1) B and F32) Se and I23) As2 and Se3ASAP! Please,,, 25 ft 8 yd 11 in.Which is greater? NO SCAM LINKS. please reply ASAP PLEASEEEE I'LL GIVE YOU BRAINLIEST!!Which is the best definition of air pressure? *1 pointthe weight of the air pressing on everything in the environmentthe amount of precipitation in a certain areathe type of clouds in the atmospherethe amount of water vapor in the air Can I have some help with this math? Pls hurry, I will mark brainliest Evaluate the expression 4 25 . A human resources manager selected a random sample of 200 workers who donate to charity. The following table shows the distribution of the 200 workers. Count Type of worker Management Other white collar 96 50 S Blue collar 54 The manager conducts a goodness-of-fit test to determine whether the proportions of workers of these types are identical to the population proportions of workers donating to charity, which are 50 percent for management, 30 percent for other white-collar workers, and 20 percent for blue-collar workers. Which of the following statements must be true about the sample?A. The expected number of blue-collar workers donating to charity is less than 30. B. The expected number of management workers donating to charity is 100. C. The expected numbers of other white collar and blue-collar workers donating to charity are the same. D. The expected number of other white-collar workers donating to charity is 50 E. The combined expected numbers of other white collar and blue-collar workers donating to charity is greater than the expected number of management workers donating to charity. I have to find the missing angles In what Century did people learn how traits pass from one living being to itsdescendants? Find the sum or typeimpossible"Help Resources[1 -2 1] + [4 -5 -6]Skip[[?]Enter Texas Roadhouse opened a new restaurant in October. During its first three months of operation, the restaurant sold gift cards in various amounts totaling $1,800. The cards are redeemable for meals within one year of the purchase date. Gift cards totaling $728 were presented for redemption during the first three months of operation prior to year-end on December 31. The sales tax rate on restaurant sales is 4%, assessed at the time meals (not gift cards) are purchased. Texas Roadhouse will remit sales taxes in January.Required:a. Record (in summary form) the S3,500 in gift cards sold (keeping in mind that, in actuality, the firm would record each sale of a gift card individually). b. Record the S728 in gift cards redeemed. c. Determine the balance in the Deferred Revenue account (remaining liability for gift cards). HEY CAN SOMEONE HELP ME WITH MY LASTEST MATH QUESTION I WILL GIVE BRAINLIST PLEASE :))) Mongar Corporation applies manufacturing overhead to products on the basis of standard machine-hours. Budgeted and actual overhead costs for the most recent month appear below: Original Budget Actual Costs Variable overhead costs: Supplies $7,980 $8,230 Indirect labor 29,820 29,610 Total variable manufacturing overhead cost $37,800 $37,840The original budget was based on 4,200 machine-hours. The company actually worked 4,350 machine-hours during the month and the standard hours allowed for the actual output were 4,190 machine-hours. What was the overall variable overhead efficiency variance for the month?a. $130 Unfavorableb. $950 Favorablec. $1,440 Unfavorabled. $1,310 Favorable The owner of Chips etc. produces two kinds of chips: lime (L) and vinegar (V). He has a limited amount of the three ingredients used to produce these chips available for his next production run: 4800 ounces of salt, 9600 ounces of flour, and 2000 ounces of herbs. A bag of lime chips requires 2 ounces of salt, 6 ounces of flour, and 1 ounce of herbs to produce; while a bag of vinegar chips requires 3 ounces of salt, 8 ounces of flour, and 2 ounces of herbs. Profits for a bag of lime chips are $0.40, and for a bag of vinegar chips $0.50. geometry ^please help me Help me ASAP!!!!!!!!!!!!! Match the western nations to their coloniesUnited StatesFranceGreat BritainThe Netherlands evaluate 3 + jk + k ^3 when j = 2 and k = 6 Which one is not an adverb ?HappySlowlyVery