Answer:
The correct answer is - a. If these two mite chromosomes have different genes at different loci.
Explanation:
If it is 2n= 2, it means that it is diploid and has two sets of chromosomes in which one set comes from mother and the other from father which means parent's genes contribute to diploid equally. Both sets of chromosomes form homologous chromosome pair. Each homolog of the pair has the same gene at the same loci in diploid and if it has not the same homologous gene at the same loci these are haploid.
1. What features are located medial to the cranium and the mandible. Identify the category here.
2. How many individual items are included in this category?
2. There is a total of six individual items in this category.
The human skull is made up of two parts, the cranium, which contains the face and the brain and the only movable bone called the mandible or lower jaw.
The features that are medial to the cranium and the mandible are those structures that are nearer to the mid-line.
The above mentioned features works together to provide the following functions of the cranium:
protection of the delicate structures including the brain, eye and the inner ear.maintaining patency of the nasal passage enabling breathing.the movement of the mandible allows chewing.Learn more here:
https://brainly.com/question/20273756
.
A plant of genotype C/C ; d/d is crossed to c/c ; D/D and an F1 testcrossed to c/c ; d/d. If the genes are linked, and 20 map units apart, what will be the percentage of c/c ; d/d recombinants
Answer:
10%
Explanation:
The parental crossings = Cd/Cd x cD /cD
The distance the genes C and D = 20 map units
Determine the percentage of cd / cd recombinants that will be formed
the distance shows that there is only 20% recombinant progeny
The recombinants are : CD/CD and cd/cd = 20%
i.e. each recombinant progeny = 20% / 2 = 10%
hence % of cd/cd recombinant = 10%
atoms May bond together to make larger what
Atoms bond together to make larger molecules or elements.
number of chiasmata during the stage of diakinesis:
a) increases
b) decreases
c) remains the same
d) there is no kiazma
Explain the answer
Answer:
a because it harm the people
explain how misuse of human resources can be harmful
Which organisms always have groups of cells organized into tissues?
Answer:
All living things
Explanation:
How many cranial nerves is it?
Explanation:
there are 12 cranial nerves
Enter the sequence of the DNA coding strand with a 5-3 polarity. DO NOT WRITE 5 OR 3 OR 5' OR 3' IN THE BOX!
Complete question:
Use the sequence below to answer the following questions
3’-ACGGATCCTCCCTAGTGCGTAATACG-5’
5’-TGCCTAGGAGGGATCACGCATTATGC-3’
1. Enter the sequence of the coding strand with a 5’-3’ polarity
Answer:
coding strand → 5´- GCATAATGCGTGATCCCTAGGCA -3´
Explanation:
When referring to the coding strand, we are talking about the sequence that turns to be the same as the mRNA that results from the transcription of the same DNI segment -switching bases T for U-.
The coding strand receives that name because it is the sequence that codes for each amino acid composing the proteins.
When the DNI molecule separates into two strands to form the transcription bubble, we can identify two separate segments: coding strand and template strand.
The coding strand goes in direction 5´ to 3´, while the complementary strand -template strand- grows in direction 3´ to 5´.
Whenever we have a DNI molecule and we need to determine which strand is the coding one, we just need to look for the presence/absence of start or stop codons.
So, in the exposed example we have two strands, but we do not know yet which one is the coding one.
Conventionally, the first strand is always the coding one. However, let us analyze it by using the presence/absence of codons.
First-strand:
3’-ACGGATCCTCCCTAGTGCGTAATACG-5’
let us write it is 5´to 3´direction
5´- GCATAATGCGTGATCCCTAGGCA -3´
now let us identify the start and stop codons in 5´⇒3´direction.
Start codon ⇒ ATGStop codon ⇒ TAA, TAG, TGA5´- GCATAATGCGTGATCCCTAGGCA -3´ ⇒ 1 start codon at the beginning
5´- GCATAATGCGTGATCCCTAGGCA -3´ ⇒ 3 Stop codons
Second strand: We will do exactly the same procedure
5’-TGCCTAGGAGGGATCACGCATTATGC-3’⇒ 1 start codon near the end
5’-TGCCTAGGAGGGATCACGCATTATGC-3’⇒ 1 stop codon at the beginning
What we did here was to identify in both provided strands, where the start and stop codons are placed. We can see that in the first strand we have the start codon near the beginning, while in the second strand we have it near the end of the sequence. From this information, we can assume that the first strand is the coding one. However, you need to know that some coding sequences do not have start and stop sequences, because they might correspond to a sequence in the middle of a gene.
So, the sequence of the DNA coding strand with a 5-3 polarity is
5´- GCATAATGCGTGATCCCTAGGCA -3´
Congestive heart failure (CHF) is an inability of the heart to pump sufficient blood to the body. One sign of CHF is excess fluid in the tissue spaces, known as edema. Describe the location of the edema if the left side of the heart fails, compared to the location of edema if the right side of the heart fails.
Answer:
Explanation:
When the left side of the heart (left ventricle) starts to fail, fluid collects in the lungs (edema). This extra fluid in the lungs (pulmonary congestion) makes it more difficult for the airways to expand as a person inhales. Breathing becomes more difficult and the person may feel short of breath, particularly with activity or when lying down.
When the right side of the heart (right ventricle) starts to fail, fluid begins to collect in the feet and lower legs. Puffy leg swelling (edema) is a sign of right heart failure, especially if the edema is pitting edema. With pitting edema, a finger pressed on the swollen leg leaves an imprint. Non-pitting edema is not caused by heart failure.
Take the gram seeds. Divide the seeds into three sets A, B and C.
➢ Put the seeds of set A onto the moist cotton.
➢ Soak the seeds of set B in the water overnight and then put on the moist cotton for seed germination.
➢ Put the seeds of set C in the boiling water for some time then allow it to germinate on the moist cotton.
➢ Grow a plant in another set.
➢ Note the observations every week.
Set A
Set B
Set C
Plant 1 st week 2 nd week So on….
Explanation:
set A ,seeds will germinate
set B,seeds will rot due to the presence of alot of water
set C,seeds will not germinate
Antennae development in ants is thought to be a trait controlled by maternal effect. In ants, zig-zag coils are dominant to curly coils. Assume that a female develops zig-zag coils. What can be determined about inheritance of this trait in her family?
a. Her mother has zig-zag antennae.
b. Her brother has zig-zag antennae.
c. This female carries the zig-zag allele
d. This female's offspring will have zig-zag antennae.
Answer:
a. Her mother has zig-zag antennae.
b. Her brother has zig-zag antennae.
Explanation:
Available data:
Antennae development ⇒ controlled by maternal effectZig-zag coils are dominantCurly coils are recessiveA female develops zig-zag coilsMaternal effect: Refers to the influence of the “environment provided by the mother” on the progeny phenotype. The mother´s genotype directly determines the progeny phenotype. Even though the progeny has a different genotype, it is irrelevant, as well as the father´s genotype or phenotype. This means that no matter what is the genotype of the offspring, all of them will express the same phenotype as their mother. The maternal effect is commonly seen in insects and might be seen in some mammals and plants.
So, if a female has zig-zag coils, this means that the mother also has zig-zag antennae and that all the brothers and sisters of this female ant have zig-zag antennae, independently of their genotype.
a. Her mother has zig-zag antennae ⇒ True. The trait is inherited from the mother.
b. Her brother has zig-zag antennae ⇒ True. The whole progeny will express sig-zag antennae.
c. This female carries the zig-zag allele ⇒ Not necessarily.
d. This female's offspring will have zig-zag antennae ⇒ Depends on it´s genotype
what are the difference between DNA and RNA
Answer:
There are two differences that distinguish DNA from RNA: (a) RNA contains the sugar ribose, while DNA contains the slightly different sugar deoxyribose (a type of ribose that lacks one oxygen atom), and (b) RNA has the nucleobase uracil while DNA contains thymine.
how digestion happens in human
Explanation:
The muscles of the small intestine mix food with digestive juices from the pancreas, liver, and intestine, and push the mixture forward for further digestion. The walls of the small intestine absorb water and the digested nutrients into your bloodstream.
Answer :Once foods are broken into small enough parts, your body can absorb and move the nutrients to where they are needed. Your large intestine absorbs water, and the waste products of digestion become stool. Nerves and hormones help control the digestive process.
Unlike other plants, trees are plants living for several years thus they are
A. Annual
B.shade
C.perennial
D. Fence
Suppose that 1 mL of an enzyme solution can completely catalyze 10 mL of substrate in 8 minutes. Now suppose that you change the amount of enzyme, the amount of substrate, or add another substance to the mixture. How would each type of change affect the reaction rate?
Match the results you would expect with each change to the experimental design. The same result may occur with more than one experimental change.
1. Use 0.5 mL of enzyme instead of 1 mL
2. Use 5 mL of substrate mixed with 5 mL water instead of 10 mL of substrate
3. Add a molecule to the mixture that preferentially binds and blocks the enzyme's active site
4. Use 20 mL of substrate instead of 10 mL
a. The reaction rate will be close to zero over the entire 8 minutes
b. The reaction rate will remain steady over the entire 8 minutes
c. The reaction rate will approach zero before 8 minutes.
Answer:
1. b. The reaction rate will remain steady over the entire 8 minutes.
2. c. The reaction rate approach zero before 8 minutes.
3. a. The reaction rate will be close to zero over the entire 8 minutes.
4. b. The reaction rate will remain steady over the entire 8 minutes.
Explanation:
When 0.5 mL of enzyme is introduced with water, the reaction will remain steady. When more substrate solution is mixed with water, then reaction will approach to zero depending on the amount of substrate mixed with water.
define cell and atom.....
Cell: A cell is the structural and fundamental unit of life. The study of cells from its basic structure to the functions of every cell organelle is called Cell Biology.
Atom: atom is the smallest component of an element, characterized by a sharing of the chemical properties of the element and a nucleus with neutrons, protons and electrons. The protons and the neutrons reside in the nucleus.
whats the difference between atom and cell?
function wise atoms take part in every chemical reaction while cells are responsible for the development and growth of living existences. Atoms do not have life. They do not need food, water, and they do not reproduce. Cells are alive. Cells consume food and water and can reproduce. Atoms construct molecules and Cells make tissues for organs.
A penicillin reaction is a life-threatening event. In those who are allergic to penicillin, the drug acts as a __________ that binds to blood proteins, causing a strong immune response.
Answer:
A penicillin reaction is a life-threatening event. In those who are allergic to penicillin, the drug acts as a hapten that binds to blood proteins, causing a strong immune response.
Explanation:
Low molecular weight chemicals can bind to antibodies, but cannot activate B lymphocytes by themselves (they are not immunogenic). To generate specific antibodies to these small chemicals, immunologists typically bind them to macromolecules prior to immunization. In these cases, the chemical is called a hapten. Penicillin G is a typical hapten that tends to covalently bind to lysine residues both in solution and in protein-bound cells. Penicillin is a drug that behaves as a hapten, since the beta-lactam ring under physiological conditions opens and reacts with the lysine residues of proteins, forming a complex that is the main antigenic determinant of penicillin and other beta-lactams and is capable of to stimulate responses mediated by antibodies or by T cells.
Erosion and deposition constantly change Earth’s surface. Erosion carries natural materials like rock and soil from one place to another. Through deposition, these natural materials may be deposited in areas where they build up over time.
Which landform results from the deposition of materials in a valley during volcanic eruptions?
A.sill
B.mud pot
C.caldera
D.lava plateau
(Science)
Human belongs to Class of?
which property has not been observed for membrane proteins being degraded for energy during biological pathways
Answer:
energy storage
Explanation:
Membrane proteins are proteins that are either form part of or interact with cell membranes. Based on their interactions, membrane proteins can be categorized into integral proteins, which are a permanent part of a cell membrane, and peripheral proteins, which adhere temporarily to the cell membrane. Membrane proteins play many critical functions, for example, 1-they are involved in the passive and active transport of substances across cell membranes, 2-act as enzymes that catalyze chemical reactions, 3-act as receptors that bind specific molecules (such as hormones or neurotransmitters) in order to activate signaling cascades, 4-mediate communication between cells, 5-provide a mechanical link between the extracellular matrix and the cytoskeleton, etc.
what is the function of neurotransmitters?
neurotransmitters are often reffered to as the body's chemical messangers. They are the molecules used by the nervus system to transmit messages between neurones, or from neurones to muscles. Communication between two neurones happens in the synaptic cleft (the small gap between the synapses of neurones).
Brain researchers have found wider surface fissures, enlarged ventricles, and atrophy of the brain areas for regulating motivation, emotion, attention, actions, and perception in persons suffering from:________
a. bipolar disorder.
b. schizophrenia.
c. multiple personalities.
d. conversion disorders.
Answer:
B. Schizophrenia
Explanation:
yes
Drag each of the following labels into the appropriate box to identify which motor division of the peripheral nervous system is identified by the given function.an be excitatory or inhibitory on the target organ Principally involved with movement of materials through the body Skeletal muscle activation Intestinal smooth muscle activation Voluntary Sweat gland activation Lacrimal gland activation Principally involved with movement "of" the body principally invvedPiloerector muscle Involuntary activation Somatic Autonomic
Answer:
Somatic: Skeletal muscle activation VoluntaryPrincipally involved with movement "of" the body.Autonomic: Can be excitatory or inhibitory on the target organ. Principally involved with the movement of materials through the body. Intestinal smooth muscle activation. Sweat gland activation Lacrimal gland activation Piloerector muscle Involuntary activation.Explanation:
We can divide the nervous system into the central nervous system, which consists of the brain and spinal cord, and the peripheral nervous system, which consists of all the nerves that are throughout the body carrying information from and to the central nervous system.
We divide the peripheral nervous system into the somatic nervous system and the autonomic nervous system.
The somatic nervous system is the conscious one, that is to say, that we know and control what it does. It is voluntary. It has motor and sensory neurons that carry information to and from the central nervous system. The somatic nervous system is the one that makes us move our muscles to do an action.
The autonomic nervous system is involuntary. In other words, we can not control it consciously. It is the one that controls glands, organs, and smooth muscle, like the one that surrounds the digestive tract to move the food. As we can not consciously control it, this system can work exiting or inhibiting an organ depending on the situation.
The peripheral nervous system is simply divided into 2 types, which are the somatic nervous system and the autonomic nervous system.
SOMATIC
Voluntary principally involved with movement "of" body skeletal muscles activation
AUTONOMIC
Involuntary lacrimal gland activation intestinal smooth muscle activation principally involved with movement "through" body sweat gland activation arrector pili activation can be excitatory or inhibitory on target organThe peripheral nervous system (PNS) is the simply known as the division of the nervous system that has all the nerves that is found outside of the central nervous system (CNS).
Its primary role is to connect the central nervous system to various organs such as the limbs, and skin. simply divided into 2 types, which are the somatic nervous system and the autonomic nervous system.
Learn more from
https://brainly.com/question/10802414
Afferont neurons
a.transmit sensory input to the CNS
b.are multipolar neurons
c.have many dendrites and a single long axon
d.are found only within the brain and spinal cord
Answer:
a.transmit sensory input to the CNS
Explanation:
Afferent neurons will take input from your muscles, skin etc. and send it to your CNS (usually via spinal nerves).
2. What is the percentage likelihood that the couple will have a child that has the allele for cystic fibrosis
Answer:
the answer I got for the question you asked is 75%
Which non-mineral nutrient is essential for photosynthesis? ANSWER ASAP!!!!!!!!
A.hydrogen
B.potassium
C.nitrogen
D. carbon dioxide
A. hydrogen
Nearly all organic compounds also contain H atoms, which explains why plants need the H they get from water molecules through photosynthesis. Hydrogen ions are vital in both aiding proton gradients to help drive the electron transport chain in photosynthesis, and for plant respiration.
#CarryOnLearningAnswer:
carbon dioxide
Explanation:
because carbon dioxide is needed for respiration
are oxygen and glucose products in cellular respiration?
Answer:
no the oxygen and glucose are used to produce ATP in cellular respiration
Predict what will happen to the concentration of pyruvate, NADH and H+ when the Krebs cycle is stopped by arsenic
Answer: Pyruvate would increase, NADH would decrease, and intermembrane H+ would decrease as well.
Explanation:
Glycolysis would raise pyruvate, but the Krebs Cycle would not produce NADH, decreasing it. No protons (H+) will be pushed into the intermembrane gap, lowering its H+ content and raising its pH.
What is Kreb's cycle?The tricarboxylic acid (TCA) cycle, commonly referred to as the Krebs cycle or the citric acid cycle, is the primary route that cells use in order to acquire energy and is an essential component of aerobic respiration. The cycle transforms the oxidative potential of acetyl coenzyme A (acetyl CoA) into the reductive potential of nicotinamide adenine dinucleotide (NADH).
The synthesis of ATP via the Krebs cycle is disrupted when arsenic is present because it prevents pyruvate from being converted into acetyl coenzyme A (acetyl-CoA). In addition to the effects described above, arsenic also prevents glucose uptake at the cellular level, as well as gluconeogenesis, the oxidation of fatty acids, and additional acetyl-CoA formation.
Learn more about Kreb's cycle, here:
https://brainly.com/question/13153590
#SPJ2
Most streams result from _____.
a. altitude
b. melted snow
c. oceans
d. rivers
Answer:
....b........ melted snow
sexually produced offspring are indentical to their parent . true or false ?
