The graph of f(x) = (xl is reflected across the y-axis and
translated to the left 5 units. Which statement about the
domain and range of each function is correct?

The Graph Of F(x) = (xl Is Reflected Across The Y-axis Andtranslated To The Left 5 Units. Which Statement

Answers

Answer 1

Answer:

The range is different. (Last option)

Step-by-step explanation:

Since the graph was reflected, the range will change since it is no longer a minimum amount but a maximum amount that it will reach. The domain will continue to stay the same because the x values it will reach are still all real numbers.


Related Questions

how do you write the algebraic notation when the scale factor is 3 ​

Answers

Answer:

(x,y) = (3x,3y)

Step-by-step explanation:

Answer:

I can agree

Step-by-step explanation:

Amy must choose a number between 55 and 101 that is a multiple of 3, 6, and 7. Write all the numbers that she could choose. If there is more than one number, separate them with commas.

Answers

Answer:

84

Step-by-step explanation:

L.C.M. of 3,6,7=42

42×1=42

42×2=84

42×3=126

55<84<101

Find the value of the expression (2x - 12) + ( 1/2xy - 10) for x = 8 and y = 2

Answers

(2x - 12) + (1/2xy - 10)
(16 -12) + (8 - 10)
4 + (-2)=
2
answer is 2
(2x-12) + (1/2xy-10)
16-12 + 8-10
4+(-2)

The polynomial f(x) is written in factored form:
f(x) = (x - 3)(x + 8)(x - 11)
What are the zeros of the polynomial function?
O x = 3, x = 8, x = 11
O x = 3, x = -8, x = 11
OX=-3, x = 8, X = -11
x = -3, x = 3, x = -8, x = 8, x= -11, x = 11

Answers

Answer:

F(x)=(x-3)(x+8)(x-11)=0

(x-3)=0, (x+8)=0, (x-11)=0

X=3

X=-8

X=11

The hourly wages earned by 20 employees are shown in the first box-and-whisker plot below. The person earning $15 per hour quits and is replaced with a person earning $8 per hour. The graph of the resulting salaries is shown in plot 2. A box-and-whisker plot is shown. The number line goes from 7 to 15. The whiskers range from 8 to 15, and the box ranges from 8.8 to 10.2. A line divides the box at 9.5. Plot 1 A box-and-whisker plot is shown. The number line goes from 7 to 15. The whiskers range from 8 to 11, and the box ranges from 8.7 to 10. A line divides the box at 9.6. Plot 2 How does the mean and median change from plot 1 to plot 2? The mean and median remain the same. The mean decreases, and the median remains the same. The mean remains the same, and the median decreases. The mean and median decrease.

Answers

Answer:

The mean decreases, and the median remains the same.

Step-by-step explanation:

Remember that a box plot is made by the quartiles of the distribution, the maximum value and the minimum value. So, from a box plot we can deduct the range, the median and the interquartile range.

In this case, the median remains the same at $9.5 per hour. The median is indicated by the middle line of the box, and you can observe that it doesn't change.

Now, the range of the data set decreases from 7 to 3.

On the other hand, the mean must decrease, because data greater than $11 doesn't exist in the box plot number 2, and the mean is a central measure sensible to those changes.

Therefore, the right answer is The mean decreases, and the median remains the same.

Answer:

the awswer is b

Step-by-step explanation:

took the test

if y=4x-1, determine the value of y when x=7/2

Answers

Answer:

y=13

Step-by-step explanation:

Answer:

y =13

Step-by-step explanation:

y=4x-1

Let x = 7/2

y = 4(7/2) -1

y = 14 -1

y =13

Find the growth rate (b) if the amount of growth is 11.8%

Answers

Answer:

B

Step-by-step explanation:

I think.

What is the range of the relation?
[(-4, 3), (-4, 4), (-3, 1), (1, 1)}
{-4, -4,-3, 1}
{-4, -3, 13
{1, 1, 3, 4]
{1,3,4​

Answers

So the right answer is of option D.

Look at the attached picture..

Additional Information:

The second components of a relation is called range

Hope it will be helpful to you. .

The range of the function is {-4, 4, -3, 1}.

What is the range of the function?

The range of a function is a set of all its possible outputs.

The range is the spread of the values of the output of a function. If we are able to calculate the maximum and the minimum values of the function, we can get an idea of the range of the function.

The given relation is;

[(-4, 3), (-4, 4), (-3, 1), (1, 1)}

The range of a function refers to the entire set of all possible output values of the dependent variable.

The range of a function is a set of all its possible outputs.

The range of the function is {-4, 4, -3, 1}.

Learn more about the range here;

https://brainly.com/question/393946

#SPJ2

Can someone help me with my maths I’ll give brainliest.

Answers

Answer: A is 40

B is 92.5

C is 27.5

Step-by-step explanation:

"
5 ft
A
13 ft
a.
sin A=7
islam
/
A= 12,
A = 12 sec A
-
12
cos A = 132
n la
12
COS A = 13
CP
5, CSC A =
b.
sin A = , tan A = o, sec A = 1
12
sin A = 13, tan A =
12
5, sec A =
13
12
COS A = 5, cot A = 5, CSC A =
al
5
COS A = 13, cot A = 12, CSC A -

Answers

Answer:

i don't understand what the question is please explain what the question is.

2 divided by one over 3 the awnser is a fraction

Answers

Answer:

1/6

Step-by-step explanation:

2/1÷  1/3 (First make 2 a fraction, because 2= 2/1 we will use 2/1)

1/2÷  1/3 (Now we flip the numerator and denominator on a fraction)

1/2 (1/3) (Now we multiply straight across numerator times numerator, denominator times denominator)

1/6 (This is our answer!)

Hope this helped! Stay safe and have a good day or night!

0 0 1 2 3 4 4 5 6 6

Which of the following could be the one missing data item for the above
set, if the mode is 4?

OA) 0
OB) 3
OC) 4
OD 5​

Answers

D- I could be wrong

Which expression is equivalent to the following complex fraction?

Answers

Answer:

Step-by-step explanaAnswer:

\frac{-2y+5x}{3x-2y}

Step-by-step explanation:

Given:

\frac{\frac{-2}{x}+\frac{5}{y}}{\frac{3}{y}-\frac{2}{x}}

To simplify this expression, first make the addition and the subtraction, to get:

\frac{\frac{-2y+5x}{xy}}{\frac{3x-2y}{xy}}=

Next, simplify the two denominators, to get:

\frac{-2y+5x}{3x-2y}tion:

So the right answer is of option B.

Look at the attached picture

Hope it will be helpful to you ..

If I have a probability of 2/5, what is the percentage of probability.


A. 52%

B. 40%

C. 2.5%

D. 80%

Answers

B 40
2 divide by 5= 0.4 which equals to 40%

Answer: 40%

Step-by-step explanation: To write a fraction as a percent, first remember that a percent is a ratio of a number to 100.

So to write 2/5 as a percent, we need to find a fraction equivalent to 2/5 that has a 100 in the denominator.

We can do this by setting up a proportion.

[tex]So[/tex] [tex]we[/tex] [tex]have[/tex] [tex]\frac{2}{5} = \frac{n}{100}[/tex].

Now, we can use cross-products to find the missing value.

So we have (2)(100) which is 200 is equal to (5)(n) or 5n.

So we have 200 = 5n.

Next, dividing both sides of the equation by 5, we have 40 = n.

So 2/5 is equal to 40/100 or 40%.

Which function describes the graph shown below?

On a coordinate plane, a curve crosses the y-axis at (0, negative 2), increases to negative 2.5, decreases to negative 2.5, and then increases again.
y = one-half sine (x) minus 2
y = 2 sine (x) minus one-half
y = one-half cosine (x) minus 2
y = 2 cosine (x) minus one-half

Answers

Answer: A

Step-by-step explanation:

The amplitude is .5 and the vertical translation is -2. So, y= 1/2sin(x)-2

Answer:

A. y= 1/2 sin(x)-2

Step-by-step explanation:

Correct in edge 2021!

NEED HELP ASAP
Find the volume of the cylinder. r measures 7 inches, height measures 8 inches ​

Answers

Answer:

1230.88

Step-by-step explanation:

Volume= pi(r^2)h

Volume=3.14(49)(8)

Volume=1230.88

Find the interquartile range (IQR) of the data in the box plot below.

Asap ASAP Please PLZ

Answers

Answer:

3

Step-by-step explanation:

IQR is the difference between the upper and lower medians so the IQR = 7 - 4 = 3

The interquartile range (IQR) of the data in the given box plot is: 3.

What is the Interquartile Range (IQR) of a Data?

In a box plot, the interquartile range (IQR) is the difference between the upper quartile and the lower quartile which are represented as each edge of the rectangular box.

Upper quartile = 7Lower quartile = 4

Interquartile range (IQR) = 7 - 4

Interquartile range (IQR) = 3

Learn more about Interquartile range (IQR) on:

https://brainly.com/question/17083142

#SPJ2

Which ordered par Woud form a proportional relationship with the point graphed Below?

A (10,10)
B (25,35)
C (70,50)
D (90,60)​

Answers

D: (90,60) that’s the answer

math question below

Answers

Answer: The package reaches the ground in

4.67 s

and hits the ground with a speed of

33.8 m/s

Answer:

3m/s or option 1

Step-by-step explanation:

Given,

Height(h)=90m

time(t)=30s

Speed(v)=?

Now,

Speed(v)=distance/time

v=height/time(Since,height here is the distance covered by the balloon)

v=90/30

v=3

Unit of speed is m/s

Therefore,v=3m/s

By the way,this is a question related to physics

Can someone please help me?

Answers

Answer:

-2

Step-by-step explanation:

Help!!!!!!
Describe the process you can use to solve a system of equations using a matrix.

Answers

Answer:

To solve a system of linear equations using an inverse matrix, let A be the coefficient matrix, let X be the variable matrix, and let B be the constant matrix.

Step-by-step explanation:

It just be that way sometimes

Based on the boxplot, which statement below is true?
A) The range of both box plots is about the same.
B) The means of both plots are approximately equal.
C) Plot B contains more data points than Plot A.
D) The mediums are approximately equal.

Answers

Answer:

A

Step-by-step explanation:

3) Which of the equivalent expressions for P(x) reveals the profit when the price is
zero without changing the form of the expression?
a) P(x) = -3x2 + 432x - 1680
b) P(x) = -3(x - 4)(x - 140)
c) P(x) = -3(x - 72)2 + 13872
4) Find the profit when the price is zero.

Answers

Question:

Which of the equivalent expressions for P(x) reveals the profit when the price is

zero without changing the form of the expression? P(x) = -3x² + 432x - 1680

a) P(x) = -3(x - 4)(x - 140)

b) P(x) = -3(x - 72)² + 13872

Find the profit when the price is zero

Answer:

- P(x) = -3(x - 140)(x - 4).

- P(0) = -1680

Step-by-step explanation:

Given

P(x) = -3x² + 432x - 1680

Required

- Find equivalent of P(x)

- Find P(x) when x = 0

To find the equivalent of P(x), we simply factorize P(x) = -3x² + 432x - 1680.

This is done as follows

P(x) = -3x² + 432x - 1680

P(x) = -3x² + 12x + 420x - 1680

P(x) = -3x(x - 4) + 420(x - 4)

P(x) = (-3x + 420)(x - 4)

Further expand -3x + 420

P(x) = -3(x - 140)(x - 4).

Hence, the equivalent of

P(x) = -3x² + 432x - 1680

without changing its form is

P(x) = -3(x - 140)(x - 4).

When price is 0, then x = 0.

Substitute 0 for P(x) in P(x) = -3(x - 140)(x - 4).

P(0) = -3(0 - 140)(0 - 4).

P(0) = -3(-140)(-4)

P(0) = -1680

Hence, the profit when price is 0 is -1680

The louvre museum is a metal and glass structure that serves as the main entrance to the louvre museum paris, france. The pyramid has a volume of 8820 cubic meters. The base is a square with sides that are 35 meters long. Calculate the surface area of the louvre pyramid

Answers

Answer:

A≈3170.96m²

Step-by-step explanation:

I need some help with this question, I got a different answer.

Answers

Answer:

The median is the middle number.

Step-by-step explanation:

You have to order the numbers from least to greatest, or greatest to least, and choose the number in the middle. Since there is an even number of values, you have to take the mean of the two middle numbers. I hope this helps.

A square pyramid has a base with a total area of 144 m2 and the volume of 384m3, what is the slant height of the pyramid

Answers

Answer:

8m

Step-by-step explanation:

Volume of a square based pyramid is expressed as [tex]V = a^{2} \frac{h}{3}[/tex] where;

a is the base edge

a² is the base area

h is the slant height

Given Volume of the pyramid V = 384m³

Base area a² = 144m²

h =?

On substituting to get the slant  height;

[tex]384 = 144*\frac{h}{3}\\ 1152 = 144h\\h = \frac{1152}{144} \\h = 8m[/tex]

The slant height of the pyramid is 8m

A line passes through the point (6,-6) and has a slope of 3/2. Write a equation in point-slope form for this line

Answers

Answer: [tex]y+6=\frac{3}{2} (x-6)[/tex]

Step-by-step explanation:

use the equation [tex]y-y_{1} =m(x-x_{1})[/tex]

we know the slope, y, and x, so plug in

[tex]y-(-6)=\frac{3}{2} (x-(6))[/tex]

[tex]y+6=\frac{3}{2} (x-6)[/tex]

Answer:

[tex]y=\frac{3}{2}x-15[/tex]

Step-by-step explanation:

The point-slope equation is [tex]y-y_{1} =m(x-x_{1} )[/tex]

Here our m is our slope which is [tex]\frac{3}{2}[/tex] and our [tex](x_{1},y_{1})[/tex] point is (6, -6)

Plugging in these values to our equation gives us

y - (-6) = [tex]\frac{3}{2}[/tex](x - 6) → distribute the negative to the -6 on the left side and then distribute the [tex]\frac{3}{2}[/tex] to the x term and the -6 on the right side → y + 6 = [tex]\frac{3}{2}x[/tex] - 9 → then subtract the 6 from both sides → [tex]y=\frac{3}{2} x-15[/tex]

Solve the following equation for x. x2 + 8x + 7 = 0 A. x = -1; x = -7 B. x = 1; x = -7 C. x = 1; x = 7 D. x = -1; x = 7

Answers

So the right answer is of option A.

Look at the attached picture

Hope it will be helpful to you..

Answer:

a

Step-by-step explanation:

i took this text

2/5 of it is 22.\
help

Answers

Answer:

55

Step-by-step explanation:

First, you do 22 divided by 2, which is 11. Then, you would multiply that by 5 which equals 55. So, the number is 55.

Answer:

55

Step-by-step explanation:

x=missong number

of means *

2/5 * x = 22

multilpy both sides by 5/2

x =22* 5/2

x = 55

The area of a parallelogram 420 square cm and the height is 35 cm. Find the corresponding base.

Answers

Answer:

12

Step-by-step explanation:

420/35

12

12*35=420

Answer:

The corresponding base is 12 cm.

Step-by-step explanation:

The area of a parallelogram is calculated with the formula of A=bh, where b is the base and h is the height.

You can apply the problem to the formula:

420=b(35)

To solve, work backwards.

Divide 35 to both sides.

420 divided by 35 is 12

b=12

Hope this helps!

Other Questions
In a series circuit, electrons only flow along one path. Given this information, which of the following is an advantage of series circuits? A. The voltage is the same everywhere in a series circuit. B. Less resistance is produced as more devices are added to the circuit. C. Series circuits are simpler than parallel circuits. D. If one part of the circuit breaks, the other parts will still be able to operate. Describe two methods that can be used to find the area of the composite figure. On January 1, 2020, Pina Corporation sold a building that cost $263,240 and that had accumulated depreciation of $101,140 on the date of sale. Pina received as consideration a $253,240 non-interest-bearing note due on January 1, 2023. There was no established exchange price for the building, and the note had no ready market. The prevailing rate of interest for a note of this type on January 1, 2020, was 11%. At what amount should the gain from the sale of the building be reported? 1.Si tengo el siguiente ejercicio x = 8+9*4+(32*2+5*4)+3*6 aplicando la jerarqua de operaciones, el resultado sera? a.25 b.45 c.78 d.Ninguna de las anteriores The half-life of cobalt-60 is 5.26 years. If 50 grams are left after 15.78 years, how many grams were in the original sample? Evaluate 9 b 9b9, minus, b when b = 8b=8b, equals, 8. what is the degree of x^4-3x+22 How does the American work week compare to the rest of the world? Is this better for US or them? Defend your answer with facts. EquationsWhat is the solution of the system of linear equations?-3x + 4y = -182x - y = 7(-2,-3)(-2,3)(2, -3)(2, 3) How does the narrator repeating My favorite at the beginning of every paragraph contribute to the story? (My favorite things by joy cowley) can anybody give me some options and some tips for my portfolio poem. for school. free verse poem. Take 2 y2 - 3 y - 5 from y3 - 6 y2 + 5 y . Select the correct answer.A) y3 - 2 y2 + 3 y + 5B) y3 - 4 y2 + 2 y - 5C) y3 - 4 y2 + 2 y + 5D) y3 - 8 y2 + 8 y + 5 How many Liters are in 17.3 moles of Iron? What is the volume of a rectangular prism with a length of 2 inches, a width of an inch & is a quarter of an inch in height? Is the below sequence DNA or RNA? How do you know?GTTTACAGGCGGCGCAATATCTGATCG Identify the vertex of the function graphed below.A. (1,2)B. (2,-1)C. (3,-2)D. (0,7) Davi has 75 flower seeds. He wants to plant the seeds in pots so that every seed is planted, and every pot hasthe same number of seeds. In the 1994 elections, Republicans won a clearmajority in states. The landform pictured above is _____, which has formed out of _____ and _____.O A. a glacier, snow; iceB. a glacier; ocean water, snowO C. a mountain; snow; iceOD. an iceberg; ocean water, snow Help asap!!! GIVING BRAINLIST