The image of the observation balloons moving across the sunset is created using

Answers

Answer 1

Answer:

using few adjectives

Explanation:

Answer 2

Answer:

he used imagery and adjectives to describe the details of the way they looked and moved across the sky


Related Questions

question is on picture​

Answers

Answer:

B

Explanation:

it seems most fitting

Since she tried blueberry ice cream Black Canary has
refused to eat any other flavor.

Answers

Answer:

taste aversion

Explanation:

complete the following story​

Answers

Answer:

Explanation:

There are two goats coming from the beach and they have to cross a stream. There is a narrow log that bridges over the stream. The goats stop and think for a while until they come up with a solution. One lies down while the other crosses over it then the first crosses the log over the stream this makes them both happy.

I don't understand why the one has to lay down but, that's what I came up with. Hope this helps:/

How do the words clapping and stomping in the poem "Latin & Soul" convey the speaker's feelings about the music? They demonstrate that the speaker dislikes how music affects people. They suggest that the speaker feels like the music is inappropriate. They reveal that the speaker feels that the beat of the music is harsh. They show that the speaker feels the music is lively and brings people together.

Answers

Answer:

They show that the speaker feels the music is lively and brings people together

Explanation:

I just did the quiz and got it right

The words clapping and stomping in the poem "Latin & Soul" convey the speaker's feelings about the music as hey show that the speaker feels the music is lively and brings people together. Thus the last option is correct.

What is the central idea of the poem "Latin & Soul"?

The poem "Latin & Soul" describes the central idea of the power of music. It tells the reader how music enhances one's understanding and helps to bring change in the mood of someone.

The words clapping and stomping reflect together like when a  person joins his hands in order to perform the activity so with the use of these words, the speaker feels the music is lively and brings people together.

This entails the enthusiasm and excitement created by the music which brings people together to share their joy and happiness and makes them closer to sharing their emotions with one another.

Therefore, the last option is appropriate.

Learn more about "Latin & Soul", here:

https://brainly.com/question/18342028

#SPJ6

What is the penalty in Mantua for selling certain drugs?

banishment

jail

death

Answers

Answer:

death

Explanation:

Just goo gle questions like this itd be quicker

What was the name of the first acting company Shakespeare worked?

Answers

King's Men
King's Men, English theatre company known by that name after it came under royal patronage in 1603. Its previous name was the Lord Chamberlain's Men. Considered the premier acting company in Jacobean England, the troupe included William Shakespeare as its leading dramatist and Richard Burbage as it principal actor.

According to neighborhood legend, what terrible things did Boo and his gang do?
What did they do one night to get in trouble with the law?

Answers

Answer:

They escaped and hid in a Trunk

What is the role of line 2 in the excerpt?

Answers

Answer:

Number Two

I hope this helps you :)

Answer:

2 :)

Explanation:

Which sentence is most clearly objective?
A. During recess, we often pranked mean old Mr. Granger.
B. My sister always made "plans" that fell through quickly.
C. As a chess club member, I was destined for great things.
D. I grew up in a small town in Illinois called Shady Glen.

Answers

Answer:D.

Explanation:

1. What was the role of women in literary life during the 1800's?

Answers

Answer:

Prior to the 1850’s, women had little influence in the literary sphere. “Women writers were stereotyped as being brainy, selfish, unladylike, and unattractive,” leaving the role to the “more capable” men of the time.[1] These men, fearful of competition, harshly criticized any woman who tried to impose on their livelihood. Thus, they attached little value to female literary products, claiming the inadequacy to be the result of “their supposed deficiencies as women.”

Explanation: I found this here: https://commons.trincoll.edu/1862/2012/12/20/1862-the-explosion-of-women-writers/

a.
1. Which of the following is not considered a good research question?
What features do most popular national parks have in common?
b. What factors have influenced population growth in the fastest
growing countries?
c. What effect do social media have on people's minds?
d. What effects does daily use of Twitter have on the attention span of
under-16s?
2. All of these are ways to limit and narrow your research topic except
a. by geographical area
b. by interest
c. by culture
d. by time frame​

Answers

Answer:

1. what feature do most popular national parks have in common

2. I am guessing that the one answer should be by geographical area

I really need help so please help me

Answers

Answer:

B

Explanation:

because the plot is where you see what time it takes place

(HELP)Which of the following concluding sentences best supports this
statement?
[Stimulus] Adopting an older dog can be a rewarding experience for both
the animal and the owner.

Answers

Answer:

I think it's no. 2

Explanation:

can you please help me:)​

Answers

Answer:

put a . after game and before it

Put a period after the word game, then proceed to capitalize the word “it”.

HELPPPPPPPPPPPPPPP!!!!!!!!!!! BRAINLIEST IS ON THE LINE!!!!!!!!!!!!!!!!!
Write a summary for Macbeth Act 1 Scene 2.

Answers

Answer:

In Act 1, Scene 2 of Macbeth, a wounded officer brings King Duncan news of Macbeth's bravery in battle. He talks about how soon after he defeats the Irish rebel Macdonwald, he begins fighting the massive Norwegian army. ... He also tells how the Thane of Cawdor betrayed the King by helping the Norwegian army.

Whats the answer please

Answers

Answer:

i answered that awhile back i think it was d

Explanation:

who are the three protagonists in American-Born Chinese?

Answers

Jin Wang
Chin-Kee/The Monkey King
Wei-Chen Sun

Answer:

Jin Wang/Danny. The novel's protagonist.

The Monkey King/Chin-Kee. The Monkey King is a deity who rules over monkeys on Flower-Fruit Mountain in the world created by Tze-Yo-Tzuh.

Wei-Chen Sun.

5.3. He left in a hurry after he got a phone call
, but
he came back five minutes later.
(2 Points)
simple
compound
complex
compound-complex

Answers

Compound sentence is the answer

The sentence "He left in a hurry after he got a phone call, but he came back five minutes later" is a compound-complex sentence.

A compound-complex sentence has, at least, two independent clauses and one dependent clause.

An independent clause has a subject and a predicate. It conveys a full thought and can stand alone as a sentence.

One of the two independent clauses in a compound-complex sentence will be introduced by a coordinating conjunction - but, for, and, nor, or, yet, so.

A dependent clause is introduced by a subordinating conjunction - after, because, etc.. It also has a subject and a predicate, but it cannot stand alone as a sentence.

We can break down the sentence we are analyzing here in the following manner:

1. Independent clause: "He left in a hurry"

2. Dependent clause: "after he got a phone call"

3. Independent clause: "but he came back five minutes later."

Learn more about the topic here:

https://brainly.com/question/9405721

What specific descriptive words are found in stanzas one and two to describe a mayflower? List at least five.

Answers

Answer:

Pink, small, aromatic, Dear to the moss, and Candid in May.

Explanation:

Emily Dickinson, in her poem Mayflower uses adjectives as pink, small, low, and sentences to describe a flower and how it looks while it grows to its best in May. In the second stanza, the author uses phrases to describe it in relationship with its surroundings and how it affects it. We can see this when she says: "Dear to the moss,

Known by the knoll".

Answer:

1. pink

2. small

3. punctual

4. Aromatic

5. low

Explanation:

PLEASEE HELP ME BRO !!!!!Adrian Miller is accused of sneaking lnto the school to try to change his
grades. Which plece of evidence from source 2 most conflcts with Alma's
claim that she saw Adrian entering the school?
SOURCE 1: Testimony of Alma Fernandez Thls time of year, I usually
come to school on Saturday between 3:00 p.m. and 7:00 p.m. to help
Coach Rawls sort cases for the debate team, because the Nebraska
state debate tournament is coming up soon. He asked me to take
some files over to the administration bulding, and on my way I saw
Adrian sneaking in.It was too dark out to see his face, but I recognized
his hoodie because it has tiger stripes on it.
SOURCE 2: Report on Adrian Mllers movements: Adian clocked into
work at Chuck's Quick Grille at 10:59 a.m. The cooks reported him
missing at around 12:30 p.m., and the manager noticed that his car
was missing from the parking lot at that time, though his tiger-striped
sweatshirt was still hanging in the break room. A local traffic camera
spotted his car moving up Grape Avenue at 1:07 p.m. Adrlan returned
to work at a 2:40 p.m, and several witnesses noted that he stayed
there until closing time at 9:00 p.m.

Answers

Answer:it was too dark out to see his face

Explanation:

PLEASE HELP ASAP!!!!!!!!!!!!
Which shared psychological traits can advertisers use to influence buying decisions? (Select all correct answers.)

1. the need for belonging
2. empathy toward others
3. natural curiosity
4. the desire to be remembered

Answers

Answer:

no.1 and 3 is that your answer

Answer:

1 and 3 i hope this help you

Please help me I will mark u brainliest please someone

Answers

Answer:

I think 2 I'm having bad cramps and can't think well lol

Explanation:

Can someone plss help me I don't understand this!

Answers

Answer:

4. A

5. D

6. B

Explanation:

4. Appeal to authority is a technique used in argument by quoting what an authority figure said. They then firm a conclusion based on what the authority said.

Option A is the best answer. The person is quoting an authority figure to persuade the audience into accepting his argument.

5. Appeal to reason simply involves making logical statements, or giving reasons why something occured in a logical manner, in an attempt to make the audience accept the argument.

Option D appeals to reason. It simply gives a reason why people should vote against the mayor's plan.

6. Appeal to mention only merely seeks to touch the emotions of people, and thereby sway and seek the support of the audience.

Option B is a perfect example, as the statement would move the audience to pity rather than reasoning.

Titles, Headings and Subheadings help the reader understand the text.


False


True

Answers

Answer

ithink its true cause Titles, Headings and Subheadings always helped me get a better understanding but please do correct me if im wrong

How is language used figuratively to convey meaning?

ps: the answer is not Figurative language refers to the use of words in a way that deviates from the conventional order and meaning in order to convey a complicated meaning, colorful writing, clarity, or evocative comparison. It uses an ordinary sentence to refer to something without directly stating it.

Answers

Spanish and Arabic because they are th emits complex languages to learn.

Why is being supportive vital?

Answers

Research has shown that having a strong support system has many positive benefits, such as higher levels of well-being, better coping skills, and a longer and healthier life. Studies have also shown that social support can reduce depression and anxiety. A strong support system can often help reduce stress.

Select the correct text in the passage.
Which sentence from the excerpt best expresses a call for unity?
excerpt from
Democratic National Convention Keynote Address, 1976
by Barbara Jordan
Barbara Jordan, a US representative from Texas, delivered the following speech at the 1976 Democratic National Convention. She was the first
woman and the first African American to deliver a keynote speech at a Democratic National Convention
Let there be no illusions about the difficulty of forming this kind of a national community. It's tough, difficult, not easy. But a spirit of harmony
will survive in America only if each of us remembers that we share a common destiny, If each of us remembers, when self-interest and
bitterness seem to prevail, that we share a common destiny.
I have confidence that we can form this kind of national community.
I have confidence that the Democratic Party can lead the way.
I have that confidence.
We cannot improve on the system of government handed down to us by the founders of the Republic. There is no way to Improve upon that.
But what we can do is to find new ways to implement that system and realize our destiny.
Now I began this speech by commenting to you on the uniqueness of a Barbara Jordan making a keynote address. Well I am going to close my
speech by quoting a Republican president and I ask you that as you listen to these words of Abraham Lincoln, relate them to the concept of a
national community in which every last one of us participates:
"As I would not be a slave, so I would not be a master." This-This-"This expresses my idea of Democracy. Whatever differs from this, to the
extent of the difference, is no Democracy."

Answers

there’s an app I suggest using it helps with problems like this, the app is GradeSaver.

Good Luck with your assignment!

can someone help me understand this better on what she means by this with procedures

Answers

Answer:

Procedures: a series of actions conducted in a certain order or manner.

BRAINLIST PLS!

Which document is an example of self-government?

English Bill of Rights
Magna Carta
Mayflower Compact
Treaty of Paris

Answers

Answer:

Mayflower compact

Explanation:

Just took a test on this

Mayflower Compact is the document that serves as an example of self-government.

We can reach this conclusion because:

Self-government refers to a system where a group of people can organize all the social and political functions of their territory, without the presence of an authority.With this, this group of people has full control of the region and the citizens, themselves, manage this control.The Mayflower Compact is an example of a document created in a self-governing system.This is because this document was created by the pilgrims of the Plymouth colony, to organize how pilgrims should act within the colony and to establish how this colony would be governed.

Thus, we can say that even establishing a type of government, the Mayflower Compact did not determine an authority that controlled the population, and the population itself promoted this control.

More information on the link:

https://brainly.com/question/13833030?referrer=searchResults

Pls help me ..............

Answers

2. do

3. does

4. is

5. do

6. does

7. do

8. do

9. is

10. is

Do
Does
Is
Do
Does
Do
Do
Is
Is
Other Questions
Can anyone please help me solve this?? A: x/8=3/4B: 2/5=x/40C: 1/8=x/40D:x/10=12/15 3(2(8-2x4)+25divided by 5 )-(2(8 divided by 4x2)-7(7-2x3) Calculate the volume of 1280 kilograms of aluminium if the density is 2700kg/m3 can you please help me:) What is a central idea in the Newsela article "Washed-Up Plastics Become Art with a Vital Message"?Children enjoy the art displays of sea creatures.Many people now look for trash to pick up when they are visiting the beach.Creating artwork can be both beautiful and horrifying.Increased awareness of the dangers of ocean pollution are creating interest in Pozzi's art.Question 2Part BWhich detail from the text best conveys the answer in Part A?"'It's the only thing he's liked all day,' his grandmother said.""An army of about 10,000 volunteers in Oregon help her collect, prepare and assemble the beach trash into art.""All of the art is made from plastic trash that washed ashore, including a great white shark""She now has more than 70 pieces in three exhibitions currently traveling throughout the United States. She also has requests from overseas." Please help 4 questions for 10 points!!!------------------------------------------------------------1) Which expression is equivalent to 4(23)?4(20+3)4(2+3)4(2+13)4(20+30)..................................................................................................2. Which expressions are equivalent to 4(42)?Select each correct answer.4(20+22)4(40+2)4(4+20)4(4+2).......................................................................................................3.Which expression shows how 645 can be rewritten using the distributive property?640+6206+205640+6564+65...............................................................................4.Tori uses the greatest common factor and the distributive property to rewrite this sum:24 + 84What expression does Tori write?2(24+42)12(2+7)24(1+4)4(6+21).....................................................................my last one got deleted.... paid rent of Rs.25000 by cheque. make journal entry Use a number line to order the numbers from least to greatest. HELLLPPPP!!!!! write the code for RNA from this DNA STRAND :AAAAAATTTTTTCCCGGGGTTTATATATC RIP grandsonhow does earths crust change earths surface [2.1 + (9.2 x 3.3)] x 0.8 PLEASE HELPPFill in the blanks in the following sentences with the logical word(s). Pay attention to the pronunciation.Spell out the following numbers in french: 1. 200:2. 256:3. 987:4. 875:5. 435:Based on the context, fill in the blanks in the following sentences with either the logical word or the appropriate forms of voir or croire. Say the whole sentence aloud.6. Est-ce que tu crois________Paul va aller au cinma ce soir?7. Elles_________les pommes sur la table.8.________vous aux fantmes?Oui! Vous_________ce fantme, l! Mais non, je ne le___________pas! i need help lol i forgot how to do this y32c-4-3 -2 -1-1+1 2 3 4-2+-3+-4+41What is the slope of the line? Since she tried blueberry ice cream Black Canary hasrefused to eat any other flavor. Explain why the Hitler youth had only mixed success among the young German people. You may use the following in your answer comradeship (friendship), compulsory membership. hi...need help....thank you.. A restaurant customer left $1.35 as a tip...Plz help me complete the addition equation that represents the associative property