Three students each calculated the volume of a sphere with a radius of 6 centimeters.

Diego found the volume to be 288π cubic centimeters.
Andre approximated 904 cubic centimeters.
Noah calculated 226 cubic centimeters.
Do you agree with any of them? Explain your reasoning.

EMERGENCY!!!!!!

Answers

Answer 1

Answer:

Not sure if this is correct, so sorry if not but I agree with diego.

Step-by-step explanation:

Given: A sphere of radius 6 cm

Find: Volume

Volume = 4/3 π x 6³ cm³

Volume = 288 π cm³

Therefore the volume of the sphere is 288 π cm³


Related Questions

hey dale plzzzz helppp

Answers

Answer:

Step-by-step explanation:

To find the mean absolute deviation of the data, start by finding the mean of the data set. Find the sum of the data values, and divide the sum by the number of data values. Find the absolute value of the difference between each data value and the mean: |data value – mean|.

12+ 12+ 14+ 16+17+18+18= 123

hold up one

123 I think and if it not sorry

Valentino needs 4 1/2 pounds of chicken for a recipe. He already has
2 3/4 pounds of chicken. How many more pounds of chicken does Valentino need?

Answers

Answer:

Valentino needs 1 [tex]\frac{3}{4}[/tex] more pounds of chicken for the recipe.

Step-by-step explanation:

You just need to know how to subtract fractions.

Valentino needs 4 and 1/2 pounds of chicken for a recipe, and he already has 2 and 3/4. We want to know how many more pounds of chicken we need, so you subtract.

4 1/2 - 2 3/4 = 4 2/4 - 2 3/4

= 1 3/4

Valentino needs 1 and 3/4 pounds of chicken still.

Answer:

c

Step-by-step explanation:

Anybody can do it I believe in y'all pls

Answers

13 miles per hour

Step-by-step explanation:

Answer:

Step-by-step explanation:

1/5mi=1/65hr65/5mi=hr13mi hrThe bicyclist rides 13 miles per hour

Mr. Barsotti has cards numbered 1 through 12. What is the theoretical probability that he draws a number less than 5

Answers

4/12 or 1/3
explanation: just completed algebra two
4/12 or 1/3 simplified

plessssss help meeee


also the numbers are:

22

12

20

15

Answers

Answer:

38

Step-by-step explanation:

Answer:

12

Step-by-step explanation:

you look at the line before 22

yoyoyoyoyo help due june 30

Answers

Answer:

m=10-r

Step-by-step explanation:

Which two expressions are equivalent?
A
B
C Or
D?

Answers

D because it's d and I know it's d

[tex]\longrightarrow{\green{D.\:6x\:+\:9x\:and\:3\:(\:2x\:+3x\:) }}[/tex] ✔

[tex]\large\mathfrak{{\pmb{\underline{\red{Step-by-step\:explanation}}{\orange{:}}}}}[/tex]

A.

z + z + z = [tex]{z}^{3}[/tex]

➡ 3z [tex]{z}^{3}[/tex]

➡ L. H. S R. H. S

Clearly, the two expressions are not equivalent.

B.

13x + 9 - 2x = 15x + 9

➡ 11x + 9 15x + 9

➡ L. H. S R. H. S

The two expressions are not equivalent.

C.

11 x² + 4x + 9 15 x² + 9

➡ L. H. S R. H. S

The two expressions are not equivalent.

[tex]\boxed{D.}[/tex]

6x + 9x = 3 ( 2x + 3x )

➡ 3 ( 2x + 3x ) = 3 ( 2x + 3x )

➡ L. H. S = R. H. S

Since L. H. S is equal to R. H. S., the two expressions are equivalent.

[tex]\large\mathfrak{{\pmb{\underline{\orange{Mystique35 }}{\orange{♡}}}}}[/tex]

Which of the expressions below are equivalent to 0.5( 4x + 12)
A. 8x
B. 2x + 6
C.16x
D. 4x

Answers

The correct answer is B.
0.5(4x + 12)
2x + 6
The correct answer is B.

Answer this question please :)

Answers

Answer:

Step-by-step explanation:

9*7=63

63

triangle area=21

63+21=84

Answer:

Its 63

Step-by-step explanation:

Area is founded by multiplying the width and height. Therefore, 9 * 7 is 63. Thus is ur answer.

A car can travel a distance of 12s + 3s2 (exponent) meters over some number of seconds s. What distance does the car travel in 8 seconds

Answers

(12s) + (3s2)
(12s) + (3s x 2)
12s + 6s=18s

The distance traveled by car in 8 seconds is 96 meters if the distance-time relationship is 12s+3s²

What is a function?

It is defined as a special type of relationship and they have a predefined domain and range according to the function every value in the domain is related to exactly one value in the range.

A car can travel a distance of (12s+3s²) meters over some number of seconds s.

The above expression is representing an equation for the distance at the given time or seconds s.

Let's suppose:

f(s) = (12s+3s²)

Let's assume the total distance traveled by car in 8 seconds is x meters.

Then at s = 8 seconds f(8) = x put these values in the above function, we get:

f(8) = 12×8 - 3×8²

x = 96 - 192

x = -96

The distance cannot be a negative quantity, so taking the absolute value of x

|x| = 96 meters

Thus, the distance traveled by car in 8 seconds is 96 meters if the distance-time relationship is 12s+3s²

Learn more about the function here:

brainly.com/question/5245372

ANSWER PLEASEEEEEEEEEEE

Answers

We will use Area... Because Area=L*B*H of the building
The answer is perimeter, because you want to find the outside of it

A little help here
Which quotient is equivalent to 3 3/4?
3 ÷ 4
12 ÷ 3
15 ÷ 4
4 ÷ 15

Answers

Answer:

3 3/4 is equal to 3.75, and 15 divided by 4 =3.75!

Step-by-step explanation:

3.3/4 is equal to 3.75 and divide by 4 = 3.75

Find the area of this figure

Answers

Answer:

165

Step-by-step explanation:

Put the extra half rectangle in the empty space. It will end up being a perfect rectangle, then you did the area like you usually do..:

22 x 7.5.    

=165

Good luck, hope i helped

What is the value of y in the triangle?



Enter your answer in the box. Round your final answer to the nearest hundredth.

y =
ft

A right triangle. The hypotenuse is labeled as 15 feet. The perpendicular is labeled as y. The alternate base angles are labeled as right angle and 26.5 degrees, respectively.

Answers

55°
We have to keep in mind, that the sum of three angles of a triangle is always 180°. This data will help us to solve this mathematical problem. Hence,the value of y
All the angles add up to 180 degrees therefore the answer is
55 degrees

cmonnnnnnnnnnnnnnnnnnnnnnn

Answers

Answer:

75

Step-by-step explanation:

Area of a triangle is l x w (length x width)

That's 4 cm x 12 cm. Now you could go ahead and figure it out from there, but you have to remember it wants the answer in meters. It tells us that for every 4cm, it is 5m. The easiest way to figure this out is to convert to meters before multiplying. Since 4 cm is 5m, the l becomes 5m. 4 goes into 12 three times. So we would do 5 x 3 to get 15m for the new w. Now we can solve for area.

l x w = A

5m x 15m = A

75m = A

I hope this helped :)

Answer: Joe mama

Step-by-step explanation: Joe mama

plz help it's confusing me i will give brainliest

Answers

The answer is to put the data from least to greatest. You can’t do anything with the data until you put it from least to greatest. (I am 98% sure that is correct)
This is the answer, I hope what I did makes sense! Normally it would help to put the numbers from least to greatest but I skipped that step. If you have any questions comment them and I will answer!
Hope this helps!

Write an equation for the relationship between the number of cups of blue paint, x, and the number of cups of red paint, y in the table in #3.
Hint: Use the formula y = kx

Answers

Answer:

Step-by-step explanation:

A certain shade of pink is created by adding 3 cups of red paint to 7 cups of white paint.

Write an equation for the relationship between the number of cups of blue paint, x, and the number of cups of red paint, y in the table in #3.
Hint: Use the formula y = kx

What is the area of the shaded region? Use 3.14 for pi.

Answers

Answer:

= 50.24

Step-by-step explanation:

the small circle is 28.26 and the big circle is 70.5 so 78.5 - 28.26 = 50.24

Your answer is gonna be 50.24

Lara drove 110 miles in 2 hours. The next day she drove 275 miles in 5 hours. Write an equation that relates the amount of miles driven, m, to the amount of hours, h.

Answers

Lara drove 55 miles per hour
Lara drove 55 miles per hour

Identify the possible solutions for the INEQUALITY: x > 5 *

Answers

Answer is d I just did this test a got it wrong and it told me the answer
The two parties came to gather

Penny has jogged a total of 15 miles this week, which is 4 miles further than last week. How many miles (m) did she jog last week?

Choose the equation that correctly models this situation.

1) 15m = 4m
2) m + 4 = 15
3) 15m + m = 4
4) m divided by 4 = 15

Answers

Answer:

answer is number 2

hope this helps:)

Answer:

lo mas lógico es que es:

2) 11m + 4 = 15m.

Which set of side lengths will make a triangle?
a.6,8,13
b.7,7,14
c.7,9,18
d.2,6,9

Answers

The triangle inequality states that the sum of any 2 sides of a triangle exceeds the third one. 6,8,13 is the only one satisfying it

Answer:

A)

Step-by-step explanation:

Creates an obtuse scalene triangles.

I can drive my Vespa 3 1/2 miles on one-fourth of a gallon of gas. How many miles can I drive on 1 gallon of gas? PLEASE HELP!!!! WORTH 15 POINTS

Answers

Answer:

It will take 1/14 of a gallon to drive one mile.

hope this helps<3


1 gallon is 4 times 1/4 of a gallon.
If 3.5 miles is 1/4 gallon, then 4 x 3.5 is what you drive on a full gallon.

4 x 3.5 = 14 miles on one gallon

Describe triangle ABC in terms of its sides and angles

Answers

Answer:

Right angle triangle

Step-by-step explanation:

Given triangle is right angle triangleIt is a type of triangle that has one of it's angles equal to 90 degrees.The other two angle sum up to 90 degrees.Here AC  side is perpendicular and the AB side is base of the triangle.And the third side that is called CB which longest side of all three sides that is called hypotenuse.

Answer: Scalene, Right Triangle

Step-by-step explanation:

There are three main terms that describe triangles by their side length: equilateral (all three sides are the same length), isosceles (two sides are the same length), scalene (all three sides are different lengths).

Since all of the sides are different lengths, this is a scalene triangle.

There  are three main terms that describe triangles by their angles: acute triangle (all three angles are acute), obtuse triangles (one obtuse angle and two acute angles) and right triangles (on right angle, which means the other two will be acute).

Since this triangle has a right angle (indicated by the square symbol on angle A), it must be a right triangle.

HELP A HOMIE!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!

Answers

Answer: One, how are you still in school bro?

Step-by-step explanation:

And I think it's the 2nd one

The answer is number 2

The perimeter of a square is 100 feet. What is the length of one of its​ sides? Explain your work.

Answers

Answer:

25

Step-by-step explanation:

to find the perimeter you add up all the sides and since it's a square and squares have all four equal sides

you just divide 100/4=25

4 sides of a square. Each side of a square is equal. You said the perimeter is 100. So if we put it in an equation, lets say S = Side. 4s=100. Now we just divide. s=25

Each side is 25

Thank or brainliest if helpful :D

Please answer the question

Answers

39.5 hope it helps you

Answer:

51.5

Step-by-step explanation:

What is 33 divided by 12?

Answers

Answer:

2.75

Step-by-step explanation:

Umh, either write it down and solve or use a calculator… I don’t know how to explain it tbh.

Uh hope this helps! :D

Dividing 33 by 12, the quotient is 2 with a remainder of 9

To find the result of 33 divided by 12, follow these steps:

Write down the division problem.

33 ÷ 12

Divide the first digit of the dividend by the divisor.

In this case, the first digit of 33 is 3, and when divided by 12, the quotient is 2. Write down 2 as the first digit of the quotient.

Multiply the quotient digit by the divisor and subtract from the dividend.

Multiply 2 by 12: 2 × 12 = 24

Subtract the result from the dividend: 33 - 24 = 9

Bring down the next digit of the dividend.

Since we have no more digits in the dividend, stop here.

Write down the final result.

The quotient is the result of the division: 33 ÷ 12 = 2 with a remainder of 9.

Therefore, when dividing 33 by 12, the quotient is 2 with a remainder of 9.

Learn more about Divided here:

brainly.com/question/15381501

#SPJ6

HELPPPPPPP!!!!!!!!!!!!!!!!

Answers

Answer:

A) Surface area is 488 cm^2

B) Surface Area

C) Volume

b) is surface area
C) is volume

Suppose Triangle ABC has vertices A(-2,10), B(-4,5) and C(3,2). It is dilated with a scale factor of ¼. What are the vertices of the image after the dilation? Write a mathematical argument that can be used to defend your solution. PLSSS HELP ASAP WILL GIVE BRAINLY PLSSSS

Answers

Answer:

26

Step-by-step explanation:

26 what that person had said
Other Questions
Joelle is a manager at a construction company, and she is interested in the chemistry behind the materials they use. She has begun studying the materials used to fill walls. She knows that to keep the temperature inside a room steady the material must be a thermal insulator, and she predicts that materials should not be acidic or else they would dissolve too easily in water.Which of these is a molecular ingredient that could be used in a wall-filling material ?C27H36N2O10Na6Ba6NeNaHCl Please help me with this I need it bad Which line from "I'm Nobody! Who Are You? by Emily Dickinson contains a sime?"Then there's a pair of usdon't tell"They d banish us you know.""How public. like a frogTo tell your name the livelong day" In young Goodmans Brown hawthornes reveals his feelings about his Puritan ancestors when Which is the definition of chronology? In what ways were the ideals of the Fourteen Points honored and ignored? Please help, only a couple of days left!!! Translate and solve: twenty-three greater than b is at least 276. Solve the inequality.1x+5 < 62Help me please Please help! I dont understand how to solve it with no angle Qu funcin cumple la poltica en los conflictos sociales Say you had the following DNA sequence: ATGCTGCGAAACTTTGGCTGA Let's say there was a mutation that removed one letter (the first C): ATGCTGCGAAACTTTGGCTGA Provide the 6 DNA codons that would be read following the mutation. Are they the same as the original 6 DNA codons that would have been read 1.Name the canan that connects the Red sea to the Mediterranean Sea2.Name the country where coffee was discovered3.Name the system of racial segregation seen in South Africa4What is the term given to the peninsula that forms the easternmost projection of the African continent5Name the precious gem that is the major natural resource of Africa6Name the Savannah region that is the site of the largest mammal migration on Earth A digital signal differs from an analog signal because it a.consists of a current that changes smoothly. b. consists of a current that changes in pulses. c.carries information. d. is used in electronic devices. Write an equation for the line that is parallel to the given line and that passes through the given point. y = 1/2x - 8; (-6, -17). Find the equation of the line that passes through the points A (2, 3) and B (5, -7) how did advancements in technologry help bring a quick end to conflict in the pacific during world war II My School in vanacola In what way was the Third Reich most successful?Strikes only occasionally affected production of goods.Factories and the infrastructure were expanded.The media enthusiastically supported the work of the ruling party.The workplace was open to many individuals. Consider the functionsf(x) = xn and g(x) = xmon the interval [0, 1], where m and n are positive integers and n > m. Find the centroid of the region bounded by f and g.