Uracil pairs with
O any nitrogen base
O uracil.
O adenine.
O thymine.

Answers

Answer 1

Answer: adenine

Explanation:


Related Questions

Which type of volcanic mountain has wide, gentle slopes?

Answers

Answer:

Shield volcanoes

Explanation:

Answer:

Shield volcanoes

Explanation:

Shield volcanoes erupt thin, 'runny', lava that forms a gently sloping structure. Where a volcano produces low viscosity, runny, lava it spreads far from the source forming a volcano with gentle slopes. This type is called a shield volcano. Mauna Kea and Mauna Loa are shield volcanoes.

what is not a goal of science

Answers

Answer:

to goof around

Explanation:

all members of the plant kingdom contains chlorophyll? true or false

Answers

Answer:

this is true

Explanation:

if it isnt in the leaves of a plant, then its in the stem, or maybe, the entire thing is green!

flowers have green stems, trees have green leaves, lily pads are green, etc.

hope this helped

Answer:

True

Explanation:

All plants contain chloryphyll

what does Ecology mean

Answers

The branch of biology that deals with the relations of organisms to one another and to their physical surrounding

Answer:

a branch of science concerned with the relationships between living things and their environment or the pattern of relationships between living things and their environment.

Explanation:

Please choose the answer that best fills in the blanks of this statement in the correct order. Photosynthesis proceeds in two phases: the light-_______ reactions which proceed only in the presence of sunlight, and the light-________ reactions which proceed regardless of the lighting conditions.

Answers

Answer:

first blank dependent

second blank independent

Explanation:

Light Dependent reactions depend on light and right independent reactions don't

Earth is heated by global warming how Ian the water cycle affected global warming

Answers

Answer:

The heat increases the rat of the water making it easier for the water to turn onto vapor

Explanation:

Answer:

[tex]\boxed{\mathrm{view \: explanation}}[/tex]

Explanation:

As the global temperatures increases, more evaporation and precipitation will be the result. Hence, speeding up the water cycle.

At higher temperatures, there is more evaporation from land and sea into the atmosphere. Since the air gets warmer, it can hold more water vapor, this can lead to high rainstorms or precipitation.

A 6-month-old who is failing to thrive is brought to your clinic. Tests reveal hepatosplenomegaly, muscle weakness and atrophy, hypotonia, and decreased deep tendon reflexes. Biopsy of the liver reveals initial stages of cirrhosis due to the accumulation of an abnormal glycogen whose structure resembles amylopectin. These results indicate the child is suffering from Andersen disease. Which of the following would also be expected in this child?a) aminoaciduriab) hyperglycemiac) hyperlipidemiad) hypoglycemiae) normal glycemia

Answers

Answer:

c) hypoglycemia

Explanation:

Hyperglycemia refers to the condition in which blood contains low amount of sugar or glucose molecules. The feeling of hunger, sweating and weakness of muscles are the symptoms of this disease and we know that the child has weak muscles so we can say that the child is suffering from hypoglycemia which is another disease that is present in the child.

Mr. B has been transferred to your floor to wait and see whether the chest tube allows his lungs to completely re-expand. But when he arrives, he is in severe respiratory distress. He says "I felt better before I came into the ER! Is this tube doing anything

Answers

The question is incomplete,below is the complete question.

Mr. B has been transferred to your floor to wait and see whether the chest tube allows his lungs to completely re-expand. But when he arrives, he is in severe respiratory distress. He says "I felt better before I came into the ER! Is this tube doing anything?"

You tell the Clinical Nurse Specialist (CNS). As the two of you move him into the bed, you notice that his chest tube bottle is lying on its side on the gurney, with air going into it. When you point this out to the CNS, she immediately grabs the bottle and sets it upright on the floor. You see air start bubbling through the fluid right away. "That was the problem!" she says. "They lost the water seal, and air was going into his chest from the bottle. You would not believe how many times that happens on transport." When you examine Mr. B, you have trouble detecting his lung sounds on the left. Even stranger, his apical heart sound is in the wrong place - it is over toward the right side of his chest. His respiration rate and heart rate are both increased, and he is struggling to breathe. "Let's give him a little oxygen. He'll be a lot better in a half-hour," says the CNS. "Check back on him."

QUESTION - Why would accumulation of air in his pleural space cause his heart sounds to be in the wrong place?

Accumulation of air in Mr B pleural space will cause his heart sound to be heard in the wrong place because the left side is his chest is being filled up with air making the organs in his chest to to be pushed over to the right side.

Which of the following best characterizes an adaptive radiation? Which of the following best characterizes an adaptive radiation? Natural selection is particularly intense because disruptive selection occurs. A single lineage diversifies rapidly, and descendant species occupy many habitats and ecological roles. Descendant species occupy a large geographic area. Species recover after a mass extinction.

Answers

Answer:

A single lineage diversifies rapidly, and descendant species occupy many habitats and ecological roles.

Explanation:

In biology, adaptive radiation refers to a phenomenon in which organisms tend to diversify rapidly from a common ancestor and then radiate into a multitude of new organisms.

These new organisms may have to change their environment in order to survive. This change in their environment creates new challenges and may lead to the appearance of new environmental niches.


What is a scientific theory? What is a hypothesis? How are they similar? How do they differ?

Answers

Answer: Scientific theories can be backed up with evidence/data (the evidence that backs the theory isn't common knowledge to everyone yet), while a hypothesis is just an educated guess, meaning that you are making a prediction based on something already known.

They are both similar in the sense that they are questions that are answered by facts, but theories are answered with factual evidence rather than factual reasoning (hypothesis).

In CaF2, the oxidation number of Ca is , and that of F is . In H2SO4, the oxidation number of H is , that of S is , and that of O is . In CaSO4, the oxidation number of Ca is , that of S is , and that of O is . In HF, the oxidation number of H is , and that of F is

Answers

Answer:

1. The oxidation number of Ca is 2, F is -1 in CaF₂

2. The oxidation number of H is 2, S is 6, O is -8 in H₂SO₄

3. The oxidation number of Ca is 2, S is 6, O is -8 in CaSO₄

4. The oxidation number of H is 1, F is -1 in HF

Explanation:

To get the oxidation number, we need to take the oxidation number of the whole compound 0. Then we need to know the oxidation number of the other elements and we need to take 'x' as the oxidation number of the unknown element.

Example:

In case of CaSO₄,

We can write an equation as-

CaSO₄ = 0

If we need to know the oxidation number of S

We can write the equation like this-

→2+ x+ (-2*4) = 0 (as we know the oxidation number of Ca is 2 as it has two electrons in its last shell which it gives to other elements to form bonds and the oxidation number of O is -2 as it takes 2 electrons to complete its outer shell)

→2+ x+ (-8) = 0

→2+ x- 8 = 0

→x- 6 = 0

→x = 6; which is the oxidation number of S

                       

The following are the oxidation numbers:

In CaF2, the oxidation number of Ca is +2, and that of F is -1.

In H2SO4, the oxidation number of H is +1, that of S is +6, and that of O is -2.

In CaSO4, the oxidation number of Ca is +2, that of S is +6, and that of O is -2.

In HF, the oxidation number of H is +1, and that of F is -1.

What is oxidation number?

Oxidation numbers are a way of representing the degree of oxidation (loss of electrons) or reduction (gain of electrons) of an element in a chemical compound. The oxidation number of an element is calculated based on the number of valence electrons (electrons in the outermost energy level of an atom) and the rules for assigning oxidation numbers.

In general, the oxidation number of an element is equal to the charge it would have if all the bonds in the compound were ionic (made up of positive and negative ions). This allows chemists to predict the behavior of elements in a compound and to balance chemical equations.

Learn more about oxidation number, here:

https://brainly.com/question/29257381

#SPJ2

Type 2 diabetes (insulin-independent diabetes) is a non-infectious disease. If not treated this disease is characterised by large fluctuations in the concentration of glucose in the blood Maltase is an enzyme that completes the digestion of starch in humans Molecules of maltase are bound to the microvilli of epithelial cells in the small intestine Ascorbate is a drug used in the treatment of type 2 diabetes. Molecules of ascorbic have a very similar shape to that of the substrate for maltase. (1) Explain how ascorbase acts to inhibit these membrane-bound enzymes.

Answers

Answer: Ascorbase a form of ascorbate, a drug used in the treatment of type 2 diabetes which acts to inhibit maltase a membrane bound enzyme that completes the digestion of starch in the human body.this inhibition is done through;

- By preventing substrates from binding to the active site therefore forming few enzyme complex substrates.

- it also inhibits the enzymes by binding to the active sites of that enzyme.

- it also does so by reacting slowly and also because it has a complementary shape to the active site of the enzyme maltase.

Which statement below correctly describes what the model shows? *
1​

Answers

Answer:

I reckon it's part D.

Explanation:

An 18-month-old boy was referred to the pediatrics clinic because of persistent anemia and associated failure to thrive. Laboratory analysis confirmed a microcytic anemia and revealed blood lead levels of 50 mg/dL (2 times normal levels) and high levels of coproporphyrinogen III in the urine. The child was put on chelation therapy and recovered uneventfully. The cause of the child's difficulty was most likely due to the effects of the lead. The findings in this patient most closely reflect lead inhibition of which of the following enzymes of heme biosynthesis?a) δ-aminolevulinic acid (ALA) dehydrataseb) ferrochelatasec) porphobilinogen (PBG) deaminased) proporphyrinogen III cosynthasee) uroporphyrinogen decarboxylase

Answers

Answer:

B) Ferrochelatase

Explanation:

The hematological effects of lead poisoning includes the inhibition of the body's ability to produce hemoglobin. This is done by interfering with several enzymatic steps in the heme synthesis pathway.

Lead inhibits or decreases heme synthesis by inhibiting Ferrochelatase enzyme activity.

Ferrochelatase catalyses the insertion of iron into protoporphyrin IX and is very sensitive to lead.

What is another name of molecular biology????

Answers

Answer:

biotechnology

Explanation:

hope it help you

Answer:

biotechnology biotech

biological engineering biological science

HEEEELP PLZ who invented the Binomial nomenclature

Answers

Answer:

Carl Linnaeus invented the binomial nomenclature

Answer:

Carolus Linnaeus or Carl von Linné (born in Älmhult, 23 May 1707 - died in Uppsala, 10 January 1778 at the age of 70) was a Swedish scientist who laid the foundation of biological nomenclature. He is known as "the father of modern taxonomy" and is also one of the fathers of modern ecology.

Why is environmental science important?

Answers

Explanation:

it is where we live and share resources with order species

I hope this was helpful

How do we use magnetic force every day?

Answers

magnet on the doors of fridges provide a tight seal to prevent the food from spoiling/rotting

pls give brainliest

Magnets are used everyday with your refrigerator and counters .

Please I need help with this

Answers

TAAGCCGATAAATGCTAACGGTA

3. Why are some potentially
renewable resources currently
nonrenewable resources?

Answers

Some potentially renewable resources are currently nonrenewable because... species are taken faster than they can reproduce.

what mode of nutrition is house fly​

Answers

Answer:

Houseflies do not have chewing mouthparts like a cockroach or piercing-sucking mouthparts like a mosquito. They regurgitate digestive enzymes, soften and liquify the food material, and then they sop it up with their sponging mouthparts.

Hope this makes sense and helps

a student hypothesized that pillar coral eat and digest zooxanthellae. which of these observations would cause the student to change this hypothesis

Answers

Answer:

the zooxanthellae in a pillar coral's body are alive

Identify the error in the following statement: “Photosynthesis is a chemical
reaction that takes place in the chloroplasts of green plant cells, where chemical
energy is used to convert carbon dioxide and water into glucose and oxygen."
A. No errors
B. "water" and "oxygen" should be switched
C. "chemical" should be "light"
D. "chloroplasts" should be "mitochondria"

Answers

Answer:

It is 'C'

Explanation:

The chemical reaction that occurs in the chloroplast is:

6CO₂ + 6H₂O → C6H₁₂O₆ + 6O₂

The electromagnetic energy of sunlight is converted to chemical energy in the chlorophyll-containing cells of photosynthetic organisms. The granum stores the photon particles from light and converts its energy into chemical energy to convert carbon and water into glucose and oxygen.

Answer:

c

Explanation:

The removal of waste products from the body is called

Answers

Answer:

It is called EXCRETION.

Explanation:

This is a process by which metabolic waste is removed from a living organism.

The excretory organs removes these waste.

Accumulation of these in the body is very harmful to our system.

Hope all these helps.

In soccer, Hai is a goal scorer who plays in forward positions, always keeping his eyes trained on the ball and chance to put one past a goalkeeper. He's not above playing advantages. "(Other players) don't want to hurt me," he said. "I try to juke them." His coach said opponents soon learn to play him honestly or pay the consequences

Answers

Complete question reads;

Read the following paragraph from the article.

In soccer, Hai is a goal scorer who plays in forward positions, always keeping his eyes trained on the ball and chance to put one past a goalkeeper. He’s not above playing advantages. “(Other players) don’t want to hurt me,” he said. “I try to juke them.” His coach said opponents soon learn to play him honestly or pay the consequences.

Which idea is BEST supported by the above paragraph?

(A) Hai's coach recognizes that Hai needs to be protected from bullying.

(B) Hai is a very skilled soccer player who consistently outdoes his peers.

(C) Hai's coach wants Hai to understand that it is not acceptable to cheat to win a soccer game.

(D) Hai is sometimes underestimated by other players, and he uses this to his advantage.

Answer:

(C) Hai's coach wants Hai to understand that it is not acceptable to cheat to win asoccer game.

Explanation:

The expression, "pay the consequences" as used by Hai's coach indicates  his intention of letting Hai know the rules governing soccer; meaning there's a penalty when opponents hurt a rival player.

Interestingly, in the game of soccer, it is a foul to deliberately bring down your opponent. Major consequences arrive when a player receives a red card from the referee, due to an offense committed by the player; the red card indicates that the player would be sent out of the court.

6. Which type of seismic wave is highlighted in the image?
O A. P wave
B. S wave
O C. Love wave
D. Rayleigh wave

Answers

Answer:

Rayleigh wave

Explanation:

Rayleigh waves are a type of surface acoustic wave that travel along the surface of solids. They can be produced in materials in many ways, such as by a localized impact or by piezo-electric transduction, and are frequently used in non-destructive testing for detecting defects.

hope it helps :)

please mark it the brainliest!

Rayleigh wave, surface acoustic waves called Rayleigh waves move along the surface of solids, hence option D is correct.

What is seismic wave?

They are commonly employed in non-destructive testing to find flaws and can be created in materials in a variety of methods, as by a localized impact or by piezoelectric transduction.

These include what are known as Rayleigh waves. A Rayleigh wave's amplitude decreases with depth below the surface and becomes noticeably tiny at depths greater than a few wavelengths.

As a result, the disturbance is limited to a solid's surface layers. The motion experienced by the surface layers includes both transverse and longitudinal components.

Therefore, Rayleigh wave type of seismic wave is highlighted in the image.

Learn more about seismic wave, here:

https://brainly.com/question/12651581

#SPJ5

Which describes a grizzly bear’s habitat? all the biotic factors in the ecosystem all the abiotic factors in the ecosystem the role of the bear in the ecosystem the physical area where the bear lives

Answers

Answer:

it is D

Explanation:

A grizzly bear’s habitat comprises of the physical area where the bear lives

What is a habitat?

A habitat is defined as the dwelling home of living organisms.

There are three major types of habitat; namely:

Terrestrial habitatAquatic habitatArboreal habitat

Terrestrial habitat is the land habitatAquatic habitat is the water habitatArboreal habitat is the tree habitat

Learn more about habitat:

https://brainly.com/question/25832580

Los cuyes del pelo crespo, al ser cruzados con cuyes de pelo liso, producen solamente cuyes de pelo crespo, si se cruza uno de los cuyes de pelo crespo de F1 con el homocigoto recesivo. ¿Qué proporciones es posible esperar

Answers

Answer and Explanation:

Datos:

El alelo dominante del gen que codifica para el tipo de pelo, determina el pelo crespo. Llamemos P al alelo dominante. Genotipos que expresan pelo crespo: PP (Homocigota dominante) y Pp (Heterocigota)El alelo recesivo del gen que codifica para el tipo de pelo determina el pelo liso. p es el alelo recesivo.Genotipo homocigota recesivo, pp, expresa pelo liso.La cruza entre un cuy de pelo crespo y un cuy de pelo liso producen solo cuyes de pelo crespo. Esto implica que el parental con pelo crespo era homocigota dominante.

1º Cruza: un cuy de pelo crespo y un cuy de pelo liso

Parental)  PP    x    pp

Gametas) P   P      p   p

Cuadro de Punnet)      P          P

                             p     Pp       Pp

                             p     Pp       Pp

F1) 100 % de la progenie posee pelo crespo

     4/4 tienen genotipo heterocigoto.

2º Cruza: un cuy heterocigoto de la F1 y un cuy homocigoto recesivo

Parental)   Pp      x       pp

Gametas) P    p        p     p

Cuadro de Punnet)     P         p

                          p    Pp        pp

                          p    Pp        pp

F2)   50% de la progenie tiene pelo crespo

       50% de la progenie tiene pelo liso

       2/4=1/2 de la progenie es heterocigota

       2/4 = 1/2 de la progenie es homocigota recesiva.

what effect does smoking have on cilia.

Answers

Answer: The cilia sweep out mucus and dirt so your lungs stay clear. Smoking temporarily paralyzes and even kills cilia. This makes you more at risk for infection. Smokers get more colds and respiratory infections than non-smokers.

Explanation:

cientists tried inserting the jellyfish gene that codes for luminescence into bacteria. Not all bacteria where transformed. Which bacteria were transformed?
a Only the bacteria that glow in the dark were transformed.
b Both glowing and non-glowing bacteria were transformed.
c Only the bacteria that can now survive in the sea were transformed.
d Only the bacteria that do not glow in the dark were transformed.

Answers

Answer:

a. Only the bacteria that glow in the dark were transformed.

Explanation:

If the bacteria can now glow in the dark, they have been transformed. If not, they have not been transformed.

Other Questions
Barrys Bagel Emporium sells a dozen bagels for $5.00. This price is no longer high enough to create a profit. The owner decides to raise the price. He does not want to alarm his customers with too large of an increase. He is considering four different plans.Plan A: Raise the price by $0.05 each week until the price reaches $8.00.Plan B: Raise the price by 10 percent each week until the price reaches $8.00.Plan C: Raise the price by the same amount each week for 6 weeks, so that in the sixth week the price is $8.00.Plan D: Raise the price by $0.25 each week until the price reaches $8.00. The formula for the area of a circle is A= ar?m where A is the area and r is the radius. The subject ofthe formula is A. Rearrange the formula to make r the subject. Why did Washington refuse to help France or Britain? What man was known as being a powerful orator to encourage the people of France and used his voice to call for the execution off the king and the removal of moderates from the government who did not support the radical changes necessary to improve France What part of the brain is known as the pleasure center?A. Brain stemB. HypothalamusC. ThalamusD. MidbrainSUBMIT what are two groups who discovered america by crossing the atlantic before columbus? (not the vikings) While on vacation far from home, Candice wants to go to a restaurant where the locals go, wanting something different than what she can get back home. However, while looking for a place to eat, all she sees are the same chain restaurants she has near her home. This is an example of a toy propeller fan with a moment of inertia of .034 kg x m^2 has a net torque of .11Nxm applied to it. what angular acceleration does it experience Katherine Johnson reached for the stars long before she helped send humans into space. Born on August 26, 1918 in West Virginia, Johnson had a gift for numbers. As Johnson later described, she spent her life countingcounting the steps she walked, the dishes she washed. Anything that could be counted, I did, she once said. School came easily for Johnson, and she completed eighth grade by the age of 10. After that, she couldnt continue learning locally because her county denied African American students access to secondary education. Johnsons father, Joshua, moved the family 120 miles away so she could attend high school. By 18, she graduated with honors from West Virginia State College, receiving degrees in mathematics and French. She then went on to teach these subjects at a public school. After teaching for many years, one job posting changed the arc of her life. The National Advisory Committee for Aeronautics (NACA) was looking to hire women to fill unique positions. The job title: Computer. Based at Langley Research Center, these human calculators checked the math done by NACAs male engineers and mathematicians. Johnsons sharp intellect and resourcefulness were quickly recognized at Langley; she was promoted after only two weeks. Nonetheless, Johnson faced barriers at the agency. At the time, many workplaces werent integrated, and Johnson and her African American colleagues were segregated within an area of Langley named West Computers. Regardless, she steadfastly asked questions and made her voice heard. In 1958, NACA began to focus more on space travel, and the agency was newly dubbed the National Aeronautics and Space Administration (NASA). Johnsons career flourished at NASA. In 1961, Johnson plotted astronaut Alan Shepards path into space. Then in 1962, Johnson helped astronaut John Glenn to be the first American to orbit the Earth. Even though NASA had started using electronic computers, Johnson was the one to double-check the machines calculations before blast-off. Additionally, Johnson contributed to Apollo 11s milestone 1969 moon landing. She also helped Apollo 13 return safely home after an equipment malfunction. Later in her career, Johnson worked on calculations for NASAs space shuttles and satellites. Even with such stellar contributions, many people in America didnt know Johnsons name until long after her retirement. In 2016, writer Margot Lee Shetterly published Hidden Figures, a chronicle of Johnson and two of her fellow mathematicians work at NASA. Later that year, shetterlys bestselling book was turned into a movie of the same name. Finally, the whole world saw the magnificent trajectory of Katherine Johnsons career. Read the excerpt. Even with such stellar contributions, many people in America didnt know Johnsons name until long after her retirement. In 2016, writer Margot Lee Shetterly published Hidden Figures, a chronicle of Johnson and two of her fellow mathematicians work at NASA. Choose the two synonyms that have the same meaning as the word figures as its used in the title of Shetterlys book. Choose 2 answers: (Choice A) A definitions (Choice B) B answers (Choice C) C numbers (Choice D) D questions (Choice E) E shapes (Choice F) F people if your computer is gliching what do you do to stop it and some times it turnes off what do you do Waldnice!8. I have a maximum/minimum thermometer in my greenhouse. It records the highest andlowest temperatures reached since the time I reset it. I reset it on Sunday when thetemperature was 4C. Overnight the temperature fell by 5C. Then during Monday it rose by6C. before falling by 10C during the night. On Tuesday it rose by 4C and fell by 2Covernight.What were the maximum and minimum temperatures recorded when I looked at thethermometer on Wednesday morning? Suppose a tank filled with water has a liquid column with a height of 10 meters. If the area is 2 square meters (2 m), what's the force of gravity acting on the column of water? I don't think this is correct plz check me Mathys Inc. has recently hired a new independent auditor, Karen Ogleby, who says she wants "to get everything straightened out." Consequently, she has proposed the following accounting changes in connection with Mathys Inc.'s 2017 financial statements.1. At December 31, 2016, the client had a receivable of $820,000 from Hendricks Inc. on its balance sheet. Hendricks Inc. has gone bankrupt, and no recovery is expected. The client proposes to write off the receivable as a prior period item.2. The client proposes the following changes in depreciation policies.(a) For office furniture and fixtures, it proposes to change from a 10-year useful life to an 8-year life. If this change had been made in prior years, retained earnings at December 31, 2016, would have been $250,000 less. The effect of the change on 2017 income alone is a reduction of $60,000.(b) For its new equipment in the leasing division, the client proposes to adopt the sum-of-the-years'-digits depreciation method. The client had never used SYD before. The first year the client operated a leasing division was 2017. If straight-line depreciation were used, 2017 income would be $110,000 greater.3.In preparing its 2016 statements, one of the client's bookkeepers overstated ending inventory by $235,000 because of a mathematical error. The client proposes to treat this item as a prior period adjustment.4. In the past, the client has spread preproduction costs in its furniture division over 5 years. Because its latest furniture is of the "fad" type, it appears that the largest volume of sales will occur during the first 2 years after introduction. Consequently, the client proposes to amortize preproduction costs on a per-unit basis, which will result in expensing most of such costs during the first 2 years after the furniture's introduction. If the new accounting method had been used prior to 2017, retained earnings at December 31, 2016, would have been $375,000 less.5. For the nursery division, the client proposes to switch from FIFO to LIFO inventories because it believes that LIFO will provide a better matching of current costs with revenues. The effect of making this change on 2017 earnings will be an increase of $320,000. The client says that the effect of the change on December 31, 2016, retained earnings cannot be determined.6. To achieve an appropriate recognition of revenues and expenses in its building construction division, the client proposes to switch from the completed-contract method of accounting to the percentage-of-completion method. Had the percentage-of-completion method been employed in all prior years, retained earnings at December 31, 2016, would have been $1,075,000 greater.Instructions(a) For each of the changes described above, decide whether:(1) The change involves an accounting principle, accounting estimate, or correction of an error.(2) Restatement of opening retained earnings is required.(b) What would be the proper adjustment to the December 31, 2016, retained earnings? Test scores in a Test were normally distributed with a mean of 75 and a standard deviation of 10. Carl scored 90 in the Test . What is the z-score of Carls test score? Bob is mailing packages. Each small package costs him $2.30 to send. Each large package costs him $2.80 . How much will it cost him to send 7 small packages and 1 large package? 3. What is the mass of an object with a volume of 4 L and a density of 1.25 g/mL? PLEASE HELP!! (3/5) - 50 POINTS - the person coming to pick up Abraham is? can anyone ans this question