Using complete sentences, discuss four functions of a family.

Answers

Answer 1

Answer: See explanation

Explanation:

Family, refers to the group of people that are united by the blood, marriage, or through adoption. The functions of family include:

1. Care for family members: A family should care for its members and everyone should lookout for each other.

2. Teaching of norms: Adults in the family should teach the younger ones about norms and values so that they'll be active member of the society and good behavior should be imbibed in them.

3. Socialization of the children

4. Fulfillment of the sexual and the emotional needs.

5. Provision of love and support to each other.

Answer 2

Answer:

hello there!!! here's your answer:

Four functions of a family can be: support each other, affection and love, teaching of norms, and socialization of the family.

HAVE A NICE DAY!!!


Related Questions

express your views on how the law the citizens and community can protect and support victims of human rights violation​

Answers

Answer:

plz mark me as brainiest

Explanation:

On the support of victims of human rights violation, the law should clearly state and express the repercussions of violating human rights. ... The community can mobilize and make aware the people of their rights and also allow any victim of human rights violations to face the law and seek justice

what do you think about the death penalty? Should it be abolished or not why?

Answers

Answer:

well the answer is an opinion, I believe it shouldn't be left away depending on the crime or situation, if there's a mass murderer I do believe life in prison or the death penalty should be used to serve justice

Explanation:

take lives, give your life, you pay

who is the first prime minister of nepal​

Answers

Bishweshwar Prada Koirala

Answer:

Bhishweshar Prasad Koirala in 1959

Explanation:

Only a handful of Nepalese prime ministers have carried a democratic mandate. The first elected prime minister was B. P. Koirala, in 1959.

PLEEEASE! I BEG OF YOU!! i'm sobbing rn! please any science experts out there!?!?


Why was the method of using farmyard mature invented
(read the question well. It wasn't when was it invented but why was it invented)
PLEEEASE! I BEG OF YOU!!

Answers

Answer:

It helped minimize nutrient pollution to water resources and helps build healthy soils.

Explanation:

good luck dudeeeeee

Jill went to Harry's Hair Salon to get a permanent wave; the lotion Harry applied to Jill's hair burned her scalp. The test to determine whether the common law or Article 2 applies here is the ____________ test.

Answers

Explanatiohmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmm-QXFRjvi0crdjc

what is reaction of light​

Answers

Answer:

what is reaction of light​?

Explanation:

The light reactions are the first step in photosynthesis. The pigment chlorophyll in the thylakoid membranes of the chloroplast absorbs the energy from sunlight during these processes. The energy is subsequently briefly transferred to two molecules, ATP and NADPH, which are needed in photosynthesis's second step. Two electron transport networks produce ATP and NADPH. During the daytime.

-----------------------hope it helps..have a great day!!
The right answer is the one above it’s the same one I got

Did you disagree with a point raised during the discussion? How did you respond to it?

Answers

Answer:

I had disagreed. I responded to it by calmly stating my opinion towards the point that had been raised and made sure that I didn't offend anyone during me doing so.

Which laws protect citizens from human rights violation?​

Answers

Answer:

the bill of rights

Explanation:

it pretty much has every law to protect citizens infact all laws help protect citizens besides animal laws.

the answer would be The bill of rights. The bill of rights ensures and guarantees civil rights to citizens in the U.S. including: Freedom of speech, Freedom of religion, etc.

Which philosopher stated that democracy is "a system that makes it possible to get rid of a government without spilling blood"?

Answers

Answer:

the answer is professor Chukwurah

How can communities and governments help people when they may not have jobs, food, or homes?

Answers

Answer:

Explanation:

do what china did

start partnering with other countries

to find out what those countries needed

setup factories to provide those products

this will employ a lot of people

used the increase tax money to create a safety net for those cannot work

Government plays an important role in addressing lifestyle behaviors and population health, reducing health disparities and chronic disease. Areas for government involvement include surveillance, research, programming, access to health care, quality assurance and guidelines for diet and physical activity (PA).

What was one key WEAKNESS of the Articles of Confederation?

A.
it was not ratified by every state


B.
it was too structured for the states to follow


C.
it gave too much power to the federal government


D.
it gave too much power to the states

Answers

Answer:

D.

it gave too much power to the states

Explanation:

No explanation

what is meant by women education​

Answers

What is meant by women education?

Every form of education aimed at developing the knowledge and skills of women and girls is referred to as women's education. General education in schools and colleges, vocational and technical education, professional education, health education, and so on are all included.

☆彡Hanna

#CarryOnLearning

cuando te conviertes en ciudadano

Answers

La respuesta correcta para esta pregunta abierta es la siguiente.

A pesar de que no anexas opciones o incisos para responder, ni tampoco especificas a qué país te refieres, podemos comentar lo siguiente.

Vamos a poner el caso de México, que es similar a la mayoría de países en Latinoamericana.

Te conviertes en ciudadano cuando llegas a la mayoría de edad, que en este caso es los 18 años cumplidos. En este momento te conviertes en miembro formal de la comunidad porque estás adquiriendo los derechos y las obligaciones que marca la Constitución.

Entre otras, ya eres capaz de decidir por ti mismo, de acuerdo a la ley, ya no eres considerado menor de edad, y ya puedes sacar ti credencia de identidad nacional para poder votar en las elecciones.

Your employer leaves a message on your voice mail
asking you to work overtime this weekend, but you plan to
attend your friend's birthday party.
1. What medium (Email, Text, call) would you use to
explain why you can't work overtime?
2. Explain why did you choose that medium?
3. Draft a message you might send via email explaining
your situation.
4. In the email Message you drafted above, what type of
email style did you use?(note, memo or letter style)
IE
M

Answers

I am pretty sure it is #3 not sure though

I just wanna know how yo day goin n who ur top 3 fav rappers are

Answers

kendrick lamarrrr, biggie, kanyeee

One of Mrs. Finch's kindergarteners can identify most letters and knows the sounds of some, but is not able to decode many words with multiple syllables. What would best describe this student's stage of literacy development

Answers

Answer:

Early Reader Stage

Explanation:

Because they are at such a young age that they are still able to identify letters and know sounds of some. But they still deal with many everyday difficulties such as not being able to decode words with many syllables.

A 2. Name 3 strong structures that make use of triangulation for their stre strah b) c) memb a) 3. Which one of the shapes above is stable and more rigid? ta 4. Explain why the joints in structures need to be strengthened? 5. What method of strengthening corners has been used in each​

Answers

Answer:

Explanation:

bremon

The yoruba are predominantly found in
which of the following geo-political zones?
A. North-East
B. North-West
C. South-East
D. South-South
E. South-West

Answers

Answer:

North - East is the answer

Explanation:

No A

Answer:

A

Explanation:

because it a and A the only answer that it can be

explain how Human Development Index (HDI) are used as indicator to measure development

Answers

Answer:

plz mark me as brainiest

Explanation:

The Human Development Index (HDI) is a summary measure of average achievement in key dimensions of human development: a long and healthy life, being knowledgeable and have a decent standard of living. ... The HDI uses the logarithm of income, to reflect the diminishing importance of income with increasing GNI                                      

plzzzzzzzzzzzz mark me as brainiest

what are violations of sport personalities rights by the media​

Answers

Answer:

"Media develops an image of the sports personalities." They portray them good/bad, which affects the sponsorship being received by the sports persons. "Any negative image or personal behavior hampers their image or sometimes entire career."

I hope this helps you :)

los eventos políticos que ocurrieron en el Tahuantinsuyo y en Europa posterior a la muerte de Huayna Cápac y ubícalos en una línea de tiempo. Ayudaaaaaaa

Answers

Answer:

Explanation:

I wanna help but i dont speak your language

Sofia was a graduate student living alone in New York City. One evening a man climbed in to her apartment through the fire escape and raped her in her bed. Since that time she can barely sleep as she has horrible nightmares of the incident and she can't go into her bedroom anymore because it makes her feel like she is back in that horrifying situation. Which symptom(s) of PTSD is Sofia experiencingSofia was a graduate student living alone in New York City. One evening a man climbed in to her apartment through the fire escape and raped her in her bed. Since that time she can barely sleep as she has horrible nightmares of the incident and she can't go into her bedroom anymore because it makes her feel like she is back in that horrifying situation. Which symptom(s) of PTSD is Sofia experiencing

Answers

Traumatic experience and stress

Answer:

the answer is either:

C or E

(sorry if this was little help)

What is the best representation of this political cartoon

Answers

Answer:

The Plumb-pudding in Danger

James Gillray's The Plumb-pudding in Danger (1805). The world being carved up into spheres of influence between Pitt and Napoleon. According to Martin Rowson, it is "probably the most famous political cartoon of all time—it has been stolen over and over and over again by cartoonists ever since."

What two types of ideas does Locke believe we have? What is the difference between the two? Give an example of each. (philosophy)

Answers

Answer:

According to Locke there are two and only two sources for all the ideas we have. The first is sensation, and the second is reflection. In sensation, much as the name suggests, we simply turn our senses toward the world and passively receive information in the form of sights, sounds, smells, and touch.

Explanation:

hope I help u

how has society influenced our opinions on lithium mining?!!!!

Answers

Answer:

It is not environmental friendly.

Explanation:

Society influenced our opinions on lithium mining by thinking it not environmental friendly but this mining is very important because lithium is used in various electrical instruments such as laptops and mobile phones etc. The society seems it bad for the environment due to removal of vegetation and degradation of soil but this metal is very important for making of various technology so in this way society influenced our opinions on lithium mining.

"The ball / pulled from the bag is a red. Therefore, all the balls in the bag are red." This illustrates a
1. weak statistical argument
2. strong statistical argument
3. strong inductive generalization argument
4. weak inductive generalization argument​

Answers

Answer:

4. weak inductive generalization argument

number four is correct

The world has seen a dramatic explosion of movements emphasizing ethnic uniformity as the sole basis for unity in recent years. Based on what you know, which of the following is likely to accompany such a movement?

a. A nation-state that emphasizes multiculturalism.
b. Increasing communication between people in the movement's territory and those outside of it.
c. An increase in security and stability in the region
d. The violent restoration of a strict gender binary and gender roles

Answers

Answer:

d. The violent restoration of a strict gender binary and gender roles

Explanation:

All the other answers are associated with greater intergroup contact and empathy at the social and legislative level. Furthermore, ethnic uniformity is often accompanied by an emphasis on the control of reproduction and womens' rights, in an effort to maintain racial 'purity'.

The correct option is d.) The violent restoration of a strict gender binary and gender roles. which  is likely to accompany such a movement.

What does ethnic nationalism look like?

Some organizations might think that because of their shared racial or ethnic background, their members can be viewed as "relatives" because they share the same ancestors. The distinction between the Gujarat and Punjab tribes of India, the Croatians and Bosnians of the former Yugoslavia, and other ethnic groups are examples of Ethnonationalism.

Ethnic nationalists' main argument is that "nations are characterized by a shared legacy, which typically comprises a common language, a common faith, and a common ethnic ancestry." People from other ethnic groups could be viewed as second-class citizens.

Which 4 categories best describe social movements?

Reform movements, revolutionary movements, reactionary movements, self-help movements, and religious movements are the main categories of social movements. Social movements typically need to draw sizable numbers of people in order to be successful.

learn more about ethnic nationalism movement here-

https://brainly.com/question/1216276

#SPJ2

Write down 5 ways you have interacted with technology today.

Answers

Answer:

Communications technologies.

Adoption of virtual and augmented reality.

Office productivity.

Internet and search.

Automation, robotics and future factories.

Answer:

- typing

- doing homework

- on games

- on social media with friends

-  meetings

hope that helps bby<3

You are conducting a research project about life during the Civil Rights Movement. Which source of information would be the MOST credible and reliable source for the project? Group of answer choices Asking your US History teacher questions History An interview of someone who lived during the Civil Rights Movement Jackie Robinson’s personal diary

Answers

Answer: An interview of someone who lived during the Civil Rights Movement

Explanation:

Since the research project is about life during the Civil Rights Movement, the source of information that would be the most credible and reliable source for the project will be an interview of someone who lived during the Civil Rights Movement.

Unlike the other options such as asking the US History teacher questions, Jackie Robinson’s personal diary or the website, an interview of someone who lived during the Civil Rights Movement will help in giving a first hand account of what happened. This will serve as an authoritative price of information

what is meant by the term
microsociological?

Answers

Answer:

Small-scale sociological analysis that studies the behavior of people in face-to-face social interactions and small groups to understand what they do, say, and think.

Explanation:

Hope this helps!

Answer:

Microsociology is one of the main levels of analysis (or focuses) of sociology, concerning the nature of everyday human social interactions and agency on a small scale: face to face.

Other Questions
Joelle is a manager at a construction company, and she is interested in the chemistry behind the materials they use. She has begun studying the materials used to fill walls. She knows that to keep the temperature inside a room steady the material must be a thermal insulator, and she predicts that materials should not be acidic or else they would dissolve too easily in water.Which of these is a molecular ingredient that could be used in a wall-filling material ?C27H36N2O10Na6Ba6NeNaHCl Please help me with this I need it bad Which line from "I'm Nobody! Who Are You? by Emily Dickinson contains a sime?"Then there's a pair of usdon't tell"They d banish us you know.""How public. like a frogTo tell your name the livelong day" In young Goodmans Brown hawthornes reveals his feelings about his Puritan ancestors when Which is the definition of chronology? Please help, only a couple of days left!!! Translate and solve: twenty-three greater than b is at least 276. Qu funcin cumple la poltica en los conflictos sociales Say you had the following DNA sequence: ATGCTGCGAAACTTTGGCTGA Let's say there was a mutation that removed one letter (the first C): ATGCTGCGAAACTTTGGCTGA Provide the 6 DNA codons that would be read following the mutation. Are they the same as the original 6 DNA codons that would have been read 1.Name the canan that connects the Red sea to the Mediterranean Sea2.Name the country where coffee was discovered3.Name the system of racial segregation seen in South Africa4What is the term given to the peninsula that forms the easternmost projection of the African continent5Name the precious gem that is the major natural resource of Africa6Name the Savannah region that is the site of the largest mammal migration on Earth A digital signal differs from an analog signal because it a.consists of a current that changes smoothly. b. consists of a current that changes in pulses. c.carries information. d. is used in electronic devices. Find the equation of the line that passes through the points A (2, 3) and B (5, -7) how did advancements in technologry help bring a quick end to conflict in the pacific during world war II My School in vanacola Write 8 as a percentage of 32Plssss helppp A senator introduces a bill by taking it to the president pro tempore, the majority leader, and the minority leader.TrueFalse****If a bill cannot be voted on due to the lack of members present, it is unlikely that the bill will make it to the House floor.True***False por qu se termina el bombardeo de Hiroshima y nagasaki Explain how the slow recovery of the bald eagle population likely affected the recovery of the salmon population Last month, the Tecumseh Corporation supplied 400 units of three-ring binders at $6 per unit. This month, the company supplied the same quantity of binders at $4 per unit. Based on this evidence, Tecumseh has experienced:_________.a. a decrease in supplyb. an increase in supplyc. an increase in the quantity suppliedd. a decrease in the quantity supplied. James Polk believed in which of the following ideas?A) The United States should not expand west of the Mississippi River.B) The United States should negotiate with native tribes in the western territories in order to acquire land.C) The United States should extend from the Atlantic Ocean to the Pacific Ocean.D) The United States should acquire land only through peaceful compromise.